KR102189581B1 - Primers and probes for simultaneous detection of lineage of lassa virus and detecting method for lassa virus using the same - Google Patents

Abstract

The present invention relates to primers and probes for simultaneously detecting Lineage I, Lineage II, Lineage III, and Lineage IV, which are lineages of Lassa virus, and a method for detecting Lassa virus using the same. Specifically, the primer and probe set of the present invention can specifically simultaneously detect four strains of Lhasa virus (Lineage I, Lineage II, Lineage III, and Lineage IV), and has excellent sensitivity, so detection of Lhasa virus It can be usefully used for

Description

Primers and probes for simultaneously detecting the lineage of Lhasa virus, and a method of detecting Lhasa virus using the same TECHNICAL FIELD {PRIMERS AND PROBES FOR SIMULTANEOUS DETECTION OF LINEAGE OF LASSA VIRUS AND DETECTING METHOD FOR LASSA VIRUS USING THE SAME}

The present invention relates to primers and probes for simultaneously detecting Lineage I, Lineage II, Lineage III, and Lineage IV, which are lineages of Lassa virus, and a method for detecting Lassa virus using the same.

Lhasa virus is a virus belonging to the arenaviridae, arenavirus, and mammaremavirus, is a bi-segmented single-stranded positive RNA virus, the diameter is 60-280 nm, and the envelope (envelop) Have. The Lhasa virus mainly occurs in Sierra Leone, Liberia, Guinea, and Nigeria, located in West Africa, and infects 300,000 to 500,000 people per year, killing 50 to 10,000 people. Lhasa virus is classified into four lineages of Lineage I, Lineage II, Lineage III, and Lineage IV according to genetic variation, and Lineage I, Lineage II and Lineage III occur in Nigeria, and Lineage IV occurs elsewhere in West Africa.

The Lhasa virus is transmitted through direct contact or air contact with the saliva, secretions, blood, or urine of infected patients, or pharyngeal secretions from infected rodents, or by viral-infected rodent bites. Hospitals caused by contaminated needles and medical devices Infection also occurs. 80% of patients infected with the Lhasa virus are mild or asymptomatic, and in patients with symptoms, fever, vomiting, abdominal pain, sore throat, cough, oral mucosa ulcers, exudative pharyngitis, cervical lymph node enlargement, etc. Symptoms of severe swelling, pleural and pericardial effusion appear.

There is currently no safe and effective vaccine for the Lhasa virus. If such a high-risk virus is used as a bioterrorism, it is fatal in diagnosis and treatment, and it is difficult to prevent its spread and may seriously affect public health, so it is urgent to prepare countermeasures. However, as the immunochromatographic test method mainly used at the site of a biological terrorist incident, detectable biological agents are limited, and thus, expansion of detectable biological agents is required. In addition, in the case of immunochromatography, as the need to improve sensitivity is raised, a point of care testing (POCT) test method that can be operated in a real-time PCR device that can compensate for this has been introduced. Is being demanded.

On-site diagnosis is one of the in vitro diagnosis, and it is a clinical pathology test method that can be used for treatment and treatment by promptly performing the sample without pre-processing such as centrifugation at a location close to the subject and patient. Until recently, it was widely used for the purpose of measuring personal blood sugar, but it has been gradually used and developed for the purpose of diagnosing various diseases from several years ago, and is in the spotlight as a field that can solve the cost and regulatory problems of other diagnostic products in Western Europe. Due to its low cost, demand is also increasing in developing countries.

Fichet-Calvet E. et el, 2009, PLOS Neglected tropical diseases, 3(3): e388

An object of the present invention is to provide a primer and a probe for simultaneously detecting Lineage I, Lineage II, Lineage III, and Lineage IV, which are lines of Lhasa virus, and a method of detecting Lhasa virus using the same.

In order to achieve the above object, the present invention provides a first forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 1; A second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2; A first reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 3; And it provides a primer set capable of simultaneously detecting the lineage of the Lassa virus consisting of a second reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 4.

In addition, the present invention provides a composition for detection capable of simultaneously detecting the strains of Lhasa virus including the primer set.

In addition, the present invention provides a detection kit capable of simultaneously detecting the strains of Lhasa virus comprising the composition.

In addition, the present invention provides a method for simultaneously detecting the strains of Lhasa virus, including performing a polymerase chain reaction (PCR) using the primer set as a template using the nucleic acid isolated from a sample. do.

The primer and probe set of the present invention can specifically simultaneously detect four strains of Lhasa virus (Lineage I, Lineage II, Lineage III, and Lineage IV), and has excellent sensitivity, making it useful for detection of Lhasa virus. Can be used.

1 is a diagram illustrating alignment of the base sequences of the Lhasa virus strains collected to prepare the primer and probe set of the present invention.
Figure 2 is a diagram showing the detection limit when performing PCR using the primer and probe set of the present invention
(Green: internal positive control (ITC); red: Lhasa virus sample; blue line: negative control).
FIG. 3 is a diagram illustrating whether an interference reaction caused by an interfering substance is performed when PCR is performed using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Lhasa virus sample with or without interfering substances; blue: negative control).
4 is a diagram illustrating detection reproducibility when performing PCR using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Lhasa virus sample; blue: negative control).
5 is a diagram confirming the storage stability of the primer and probe set of the present invention
(Green: internal positive control (ITC); red: Lhasa virus sample; blue: negative control).

Hereinafter, the present invention will be described in detail.

The present invention is a first forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 1; A second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2; A first reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 3; And it provides a primer set capable of simultaneously detecting the lineage of the Lassa virus consisting of a second reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 4.

The lineage of the Lhasa virus may be Lineage I, Lineage II, Lineage III, and Lineage IV.

The primer may be a primer that specifically amplifies a specific region of Lineage I, Lineage II, Lineage III, and Lineage IV, which are lines of the Lhasa virus, and more specifically, specifically amplifies the S-segment gene fragment. I can. In addition, the primer of the present invention may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the specific region. In one embodiment of the present invention, the primer is a first forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 1, a second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2, and a nucleotide sequence represented by SEQ ID NO: 3 It may be a first reverse primer consisting of, or a second reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 4.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known methods. Such primers can be modified using a number of means known in the art, as long as they exhibit an effect capable of detecting Lhasa virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent. In addition, the primer of the present invention may contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32P), fluorescent molecules and chemical groups (e.g., biotin), etc. have.

The primer may be for point of care testing (POCT).

In addition, the present invention provides a composition for detection capable of simultaneously detecting the strains of Lhasa virus including the primer set.

The lineage of the Lhasa virus may be Lineage I, Lineage II, Lineage III, and Lineage IV.

The primer set may have the characteristics as described above. As an example, the primer may be a primer that specifically amplifies a specific region of Lineage I, Lineage II, Lineage III, and Lineage IV, which is a lineage of Lhasa virus, and consists of a nucleotide sequence represented by SEQ ID NO: 1. It may be a forward primer, a second forward primer consisting of a nucleotide sequence shown in SEQ ID NO: 2, a first reverse primer consisting of a nucleotide sequence shown in SEQ ID NO: 3, or a second reverse primer consisting of a nucleotide sequence shown in SEQ ID NO: 4 have.

The composition may further include a probe consisting of a nucleotide sequence represented by SEQ ID NO: 5, and a probe consisting of a nucleotide sequence represented by SEQ ID NO: 6.

The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , Double stranded DNA (DNA) probe or RNA probe, etc. may be produced.

The probe can be chemically synthesized using a phosphoramidite solid support method, or other well known method. Such probes can be modified using a number of means known in the art as long as they exhibit an effect capable of detecting Lhasa virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphoroester, phosphoroamidate. , Carbamate, etc.) or a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, e.g., proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), a chelating agent (eg, a metal, a radioactive metal, iron, an oxidizing metal, etc.), and an alkylating agent.

The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2',4',5',7'-tetrachloro) -6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine can be any one or more selected from the group consisting of However, any other known material that can be used as a reporter in the art can be used. In an embodiment of the present invention, the reporter may be 6-carboxyfluorescein (FAM).

The probe may be further conjugated with a quencher to its 3'end. The quencher is TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), Blackberry Quencher, Iowa black ) May be any one or more selected from the group consisting of, but any other known material that can be used as a quencher in the art may be used. In an embodiment of the present invention, the quencher may be a black hole quencher (BHQ) 1.

The composition may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg2+, dATP, dCTP, dGTP, and dTTP, in addition to the primer set and probe set. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. Polymerases can be isolated from the bacteria themselves, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

In a specific embodiment of the present invention, the present inventors use the first forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 1, the second forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 2, and the nucleotide sequence shown in SEQ ID NO: 3. A first reverse primer made up, a second reverse primer made up of a nucleotide sequence shown in SEQ ID NO: 4, a probe made up of a nucleotide sequence shown in SEQ ID NO: 5, and a probe made up of a nucleotide sequence shown in SEQ ID NO: 6 were prepared (Table 1 and 2, see Fig. 1), and when performing real-time reverse transcrption-polymerase chain reaction (RT-PCR) using this, the minimum detection limit is 37.17 copies/reaction (Table 3 and 4, see Fig. 2), only the Lhasa virus is specifically detected (see Tables 5 and 6), there is no interference reaction by an interfering substance (see Table 7, Fig. 3), and has reproducibility (Table 8, See Figure 4) was confirmed. In addition, it was confirmed that the primer and probe set maintained stability for 365 days (see Table 9 and FIG. 5).

Therefore, the primer set and probe of the present invention can be usefully used to detect and diagnose Lhasa virus.

In addition, the present invention provides a detection kit capable of simultaneously detecting the strains of Lhasa virus comprising the composition of the present invention.

* The lineage of the Lhasa virus may be Lineage I, Lineage II, Lineage III, and Lineage IV.

The composition may have the characteristics as described above. As an example, the composition comprises a first forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 1, a second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2, and a first reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 3 , And may include a primer set consisting of a second reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 4. The primer may be a primer that specifically amplifies a specific region of Lineage I, Lineage II, Lineage III, and Lineage IV, which are lines of Lhasa virus, and in an embodiment of the present invention, the primer is SEQ ID NO: 1. The first forward primer consisting of the nucleotide sequence described, the second forward primer consisting of the nucleotide sequence described in SEQ ID NO: 2, the first reverse primer consisting of the nucleotide sequence described in SEQ ID NO: 3, or the nucleotide sequence described in SEQ ID NO: 4 It may be a second reverse primer consisting of. In addition, the composition may further include a probe consisting of a nucleotide sequence represented by SEQ ID NO: 5, and a probe consisting of a nucleotide sequence represented by SEQ ID NO: 6, wherein the probe has a reporter at its 5'end, and its 3' The quencher may be further bonded to the end.

The kit may further include one or more other component compositions, solutions or devices suitable for the assay method. The kit includes a tube or other suitable container, reaction buffer (varies in pH and magnesium concentration), deoxynucleotide in addition to a primer pair specific for a specific region of Lineage I, Lineage II, Lineage III, and Lineage IV, which are lines of Lhasa virus. (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. Meanwhile, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to prepare such a dried form, a drying step is required, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a combination thereof may be used.

In addition, the present invention uses a nucleic acid isolated from a specimen as a template, a first forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 1, a second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2, and a base represented by SEQ ID NO: 3 A method for simultaneously detecting the lineage of Lhasa virus comprising performing PCR using a primer set consisting of a first reverse primer consisting of a sequence and a second reverse primer consisting of a nucleotide sequence described in SEQ ID NO: 4 to provide.

The lineage of the Lhasa virus may be Lineage I, Lineage II, Lineage III, and Lineage IV.

The specimen may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The primer set may have the characteristics as described above. As an example, the primer may be a primer that specifically amplifies a specific region of Lineage I, Lineage II, Lineage III, and Lineage IV, which are lines of Lhasa virus, and in an embodiment of the present invention, the primer is a sequence The first forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 1, the second forward primer consisting of the nucleotide sequence shown in SEQ ID NO: 2, the first reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 3, or described in SEQ ID NO: 4 It may be a second reverse primer consisting of a nucleotide sequence.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example 1. Preparation of primers and probes targeting S segment genes of Lhasa virus

Lhasa virus strains that have appeared so far were investigated and the nucleotide sequence of each strain was collected at the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/) (Table 1). Primers and probes capable of detecting 4 types of Lhasa virus strains at once (Lineage I, Lineage II, Lineage III, and Lineage IV) targeting the S-segment gene site of each strain after alignment of the collected nucleotide sequences Was prepared, and the sequences of each primer and probe are shown in Table 2 below. Reporter FAM (6-carboxyfluorescein) was bound to the 5'end of the probe, and quencher BHQ (black hole quencher) 1 was bound to the 3'end.

number year area number year area One 1981 Guinea 28 1994 Nigeria 2 1996 Guinea 29 1996 Nigeria 3 1996 Guinea 30 1972 Sierra 4 1997 Guinea 31 1975 Sierra 5 1997 Guinea 32 1976 Sierra 6 1972 Liberia 33 1976 Sierra 7 1972 Liberia 34 1976 Sierra 8 1980 Liberia 35 1977 Sierra 9 1980 Liberia 36 1977 Sierra 10 1980 Liberia 37 1978 Sierra 11 1981 Liberia 38 1978 Sierra 12 1981 Liberia 39 1978 Sierra 13 1981 Liberia 40 1978 Sierra 14 1972 Liberia 41 1978 Sierra 15 1974 Nigeria 42 1978 Sierra 16 1974 Nigeria 43 1978 Sierra 17 1975 Nigeria 44 1978 Sierra 18 1975 Nigeria 45 1978 Sierra 19 1976 Nigeria 46 1978 Sierra 20 1976 Nigeria 47 1979 Sierra 21 1981 Nigeria 48 1980 Sierra 22 1989 Nigeria 49 1982 Sierra 23 1989 Nigeria 50 1982 Sierra 24 1989 Nigeria 51 1993 Sierra 25 1989 Nigeria 52 1996 Sierra 26 1989 Nigeria 53 1996 Sierra 27 1993 Nigeria 54 1996 Sierra

Primer or
Probe ^a Sequence (5'→3') Sequence number Length (bp) GC content
(%) Tm ^b
(℃) Note ^c LASV-NG-NF1 CACTGTGGGACYATYGCCAATG One 22 55 62 84bp LASV-SL-NF1 CATTGTGGCACWGTTGCAAATG 2 LASV-NG-NR1 TTCCGGAATCAAGTGCTATRTARC 3 24 41 58 LASV-SL-NR3 GCCTGAATCAAGGGCAATGTARCT 4 LASV-NP1 CCACCCCARGCCATCCTCATRAAAGT 5 26 54 74 LASV-NP2 CCACCCCAAGCCATCCTCATGAAAGT 6

a: F;forward, R;reverse, P;probeb: melting temperature

c: size of PCR amplification product

Experimental Example 1. Evaluation of analytical sensitivity of real-time RT-PCR using the primer and probe set of the present invention

The analytical sensitivity of real-time RT-PCR using the primer and probe set prepared in Example 1 was confirmed by measuring a limit of detection (LoD). The experiment was carried out in accordance with the'Guidelines for In Vitro Diagnostic Medical Device License Review' of the Ministry of Food and Drug Safety, and the minimum detection limit was calculated as'the lowest concentration showing 95% detection rate using standard substances' as defined in the guidelines.

Specifically, after setting the common region of the Lhasa virus strain described in Table 1 as a target, in vitro transcription (T7) was performed using purified DNA to synthesize an RNA gene. 300, 150, 75, 37.5 and 18.75 copies/reaction concentration of the synthesized Lhasa virus RNA gene 3 µl, 2x Master mix 5 µl, primer probe mix 1 µl and PCR was well performed After mixing 1 µl of an internal positive control to be confirmed, real-time RT-PCR was performed under the reaction conditions shown in Table 3 below (UltraFast LabChip real-time PCR G2-4). The average, standard deviation (SD), coefficient of variation (CV), and detection rate of the Ct (cycle threshold) values measured by performing 30 replicates under the same conditions were measured. The% positive interval was verified with a probit regression model using a statistical program (IBM SPSS Statistics, IBM).

division Temperature(℃) time Number of cycles Reverse transcription 50 5 minutes One Primary denaturation 95 8 seconds One Secondary denaturation 95 13 seconds 45 Annealing 54 13 seconds Total Time 34 minutes 40 seconds ^*

( ^* Total time required including reading time on the machine)

As a result, as shown in Table 4 and FIG. 2, the minimum detection limit of real-time RT-PCR using the primer and probe set of the present invention was measured as 37.17 copies/reaction.

(Target: synthesized target RNA gene of Experimental Example 1; IPC: internal positive control; Average: mean; S.D.: standard deviation; CV: ratio of standard deviation to mean (coefficient of variation)).

Experimental Example 2. Evaluation of analytical specificity of real-time RT-PCR using the primer and probe set of the present invention

The analytical specificity of real-time RT-PCR using the primer and probe set prepared in Example 1 was confirmed by the presence of cross-reaction by other strains and the presence of interference by interfering substances.

2-1. Check for cross-reaction by other strains

A total of 88 strains of pathogen genes (indicated in'bold' in Tables 5 and 6) and the transcript provided by the Korea Centers for Disease Control and Prevention (transcript, indicated in'underlined' in Tables 5 and 6) were used to determine whether cross-reactivity by other strains Confirmed. Specifically, among the strains used, the virus was applied at a concentration of 10 ⁴ copies/µl, and the remaining strains were applied at a concentration of 1 ng/µl. Real-time RT-PCR was performed in the same manner as described in Experimental Example 1, except that the same amount of the pathogen gene and transcript were used instead of the Lhasa virus gene.

number Strain name Target Ct number Strain name Target Ct One Acinetobacter baumanii N/A 23 Enterococcus faecalis N/A 2 Aeromonas hydrophila N/A 24 Escherichia hermannii N/A 3 Bacillus cereus N/A 25 EHEC N/A 4 Bacillus subtilis N/A 26 Francisella philomiragia N/A 5 Brucella abortus N/A 27 Francisella tularensis subsp. Holartica N/A 6 Brucella melitensis N/A 28 Klebsiella pneumoniae N/A 7 Brucella suis N/A 29 Listeria monocytogenes N/A 8 Brucella canis N/A 30 Micrococcus luteus N/A 9 Burkholderia cepacia N/A 31 Proteus vulgaris N/A 10 Candida albicans N/A 32 Pseudomonas aeruginosa N/A 11 Candida tropicalis N/A 33 Plasmodium falciparum N/A 12 Candida glabrata N/A 34 Rhodococcus equi N/A 13 Citrobacter freundii N/A 35 Ricinis communis N/A 14 Clostridium botulinum A N/A 36 Rickettsia powazekii N/A 15 Clostridium botulinum B N/A 37 Rickettsia typhi N/A 16 Clostridium botulinum E N/A 38 Rickettsia japonica N/A 17 Clostridium botulinum F N/A 39 Salmonella typhi N/A 18 Clostridium difficile N/A 40 Salmonella paratyphi N/A 19 Clostridium perfringens N/A 41 Salmonella enteritidis N/A 20 Coxiella burnetii N/A 42 Salmonella enterica N/A 21 Enterobacter aerogenes N/A 43 Stapylococcus aureus N/A 22 Enterobacter cloacae N/A 44 Stapylococcus epidermidis N/A

number Strain name Target Ct number Strain name Target Ct 45 Streptococcus pneumoniae N/A 67 Coronavirus Mers N/A 46 Streptococcus pyogenes N/A 68 Dengue virus type1 N/A 47 Yersinia enterocolitica N/A 69 Dengue virus type2 N/A 48 Yersinia pseudotuberculosis N/A 70 Dengue virus type3 N/A 49 Human gDNA N/A 71 Dengue virus type4 N/A 50 Aspergillus fumigatus N/A 72 Hantaan virus N/A 51 Aspergillus oryzae N/A 73 Influenza virus A. H1 N/A 52 Aspergillus terreus N/A 74 Influenza virus B N/A 53 Bordetella pertussis N/A 75 Influenza A virus subtype H3 N/A 54 Campylobacter jejuni N/A 76 Japanese encephalitis virus N/A 55 Campylobacter coli N/A 77 Para influenza virus 1 N/A 56 Haemophilus influenzae N/A 78 Para influenza virus 2 N/A 57 Pseudomonas aeruginosa N/A 79 Para influenza virus 3 N/A 58 Shigella spp. N/A 80 Para influenza virus 4 N/A 59 Vibrio parahaemolyticus N/A 81 Respiratory syncytial virus A N/A 60 Legionella pneumophila N/A 82 Respiratory syncytial virus B N/A 61 E. coli KCTC2441 N/A 83 Rhinovirus N/A 62 Mycoplasma pneumoniae N/A 84 SARS N/A 63 Adenovirus C-2 N/A 85 Seoul virus N/A 64 Adenovirus B-3 N/A 86 TBEV N/A 65 Coronavirus 229E N/A 87 West nile virus N/A 66 Coronavirus NL63 N/A 88 Yellow fever virus N/A

As a result, as shown in Tables 5 and 6, the primer and probe set prepared in Example 1 did not amplify the pathogen gene and transcript. From this, it was found that the primer and probe set of the present invention did not exhibit cross-reaction by strains other than Lhasa virus.

2-2. Check for interference reaction to the inhibitor

Using five kinds of interfering substances selected by referring to'EP7-A2' of the'CLSI Guideline', it was confirmed whether the interference reaction caused by substances that may have an experimental influence in the specimen.

Specifically, a Lhasa virus gene that does not contain an interfering substance, 1 mg/ml of hemoglobin, 12.5 µg/ml of immunoglobulin G (IgG), 0.1 mg/ml of heparin, 4 The Lhasa virus gene to which mM EDTA (ethylenediaminetetraacetic acid) or 20 mM sodium citrate (Na-citrate) was added was at a concentration of 25 or 100 times the minimum detection limit (37.17 copies/reaction) derived in Experimental Example 1. Preparation and real-time RT-PCR was performed in the same manner as described in Experimental Example 1. The difference between the Ct value of each sample and the Ct value of the positive control group was calculated and compared.

As a result, as shown in Table 7 and FIG. 3, since the difference in Ct values according to the five interfering substances is insignificant, the primer and probe set prepared in Example 1 did not exhibit an interference reaction by the five interfering substances. Did.

100×(3717 copies/reaction) 25×(929.25 copies/reaction) Ct value Ct value difference from control Ct value Ct value difference from control Control ^a 26.74 - 30.15 - hemoglobin 27.02 -0.28 29.96 0.19 IgG 26.65 0.09 30.26 -0.11 Heparin 27.03 -0.29 31.07 -0.92 EDTA 26.96 -0.22 30.02 0.13 Sodium citrate 26.83 -0.09 30.09 0.06

a: Lhasa virus gene without interfering substances

Experimental Example 3. Evaluation of analytical reproducibility of real-time RT-PCR using the primer and probe set of the present invention

The analytical reproducibility of real-time RT-PCR using the primers and probes prepared in Example 1 was confirmed through repeated experiments.

Specifically, in real time in the same manner as described in Experimental Example 1, except that the Lhasa virus gene was reacted at a concentration of 5, 25 or 100 times the minimum detection limit (37.17 copies/reaction) derived in Experimental Example 1. RT-PCR was performed. A total of 10 repeated experiments were performed twice a day for 5 days, and measured twice for each time, and the average, standard deviation and coefficient of variation of the measured Ct values were calculated and compared. The negative control was a sample that did not contain synthetic RNA of Lhasa virus.

As a result, as shown in Table 8 and FIG. 4, in the case of a negative control sample that did not contain the synthetic RNA of the Lhasa virus, it was not detected at all in all repeated experiments, and the coefficient of variation (CV) value according to 10 replicate experiments It was found to be 0.03% or less, and real-time RT-PCR using the primers and probes prepared in Example 1 had reproducibility.

Concentration (copies/reaction) 100×(3717) 25×(929.25) 5×(185.85) 1 day Primary 27.03 27.17 29.29 29.11 31.30 31.54 Secondary 26.18 26.30 28.73 28.57 31.33 30.66 2 days Primary 27.06 27.13 29.15 29.15 31.65 31.32 Secondary 25.83 25.74 28.18 28.13 30.35 30.64 3 days Primary 28.26 28.23 30.40 30.40 32.90 33.26 Secondary 28.2 28.1 30.69 30.31 33.10 32.41 4 days Primary 26.67 26.69 29.22 28.73 31.45 31.13 Secondary 26.14 26.38 28.38 28.75 31.43 31.02 5 days Primary 26.22 26.29 28.27 28.16 31.47 30.67 Secondary 27.21 27.28 29.61 29.45 32.29 31.47 Average 26.91 29.13 31.57 Standard Deviation 0.80 0.81 0.82 Coefficient of variation (%) 0.03 0.03 0.03

Experimental Example 4. Evaluation of analytical storage stability of primer and probe set of the present invention

The analytical storage stability of the primer and probe set prepared in Example 1 was evaluated through an accelerated aging experiment. The experiment was carried out in accordance with the safety test standards for medical devices presented in the'Ministry of Food and Drug Safety Notice No. 2014-178'.

Specifically, after calculating the accelerated aging factor (AAF) and the accelerated aging time (AAT) using the following calculation formula, the primer and probe set prepared in Example 1 were calculated according to the calculated conditions. Stored at 45° C. for 4 days. Thereafter, real-time RT-PCR was performed in the same manner as described in Experimental Example 1 twice each using the accelerated aging primers and probes on days 0, 1, 2, 3 and 4. At this time, the used Lhasa virus gene was at a concentration of 5, 25 or 100 times the minimum detection limit (37.17 copies/reaction) derived in Experimental Example 1, without subjecting the accelerated aging reaction to prevent denaturation of reverse transcriptase. Added. The difference between the average Ct value of each sample and the Ct value on day 0 was calculated and compared. As a positive control, a plasmid DNA consisting of a specific sequence of the Lhasa virus was used, and as a negative control, a sample without Lhasa virus synthetic RNA was used.

[formula]

AAF = Q ₁₀ ^{｜(TAA-TRT)/10｜} = 90.51

AAT = set validity period / AAF = 4.03

(Q ₁₀ (Aging coefficient when temperature rises or decreases by 10℃) = 2, T _AA (accelerated aging temperature) = 45℃, T _RT (ambient temperature, product storage temperature) = -20℃, set shelf life = 365 days)

As a result, as shown in Table 9 and FIG. 5, the primer and probe set prepared in Example 1 exhibited a Ct value within ±1, and typically, when the Ct value difference from the control group is within ±2 range. It was judged to be stable, so it showed 365 days of stability.

Concentration (copies/reaction) PC 100×(3717) 25×(929.25) 5×(185.85) 0 days
(Control) Primary 21.19 26.37 28.34 31.07 Secondary 21.22 26.54 28.25 31.05 Average 21.21 26.46 28.30 31.06 1 day
(3 months) ^a Primary 20.86 26.28 28.60 30.90 Secondary 20.83 26.42 29.05 31.28 Average 20.85 26.35 28.83 31.09 Ct value difference from control 0.36 0.10 -0.53 -0.03 2 days
(6 months) ^a Primary 21.16 26.51 28.70 31.19 Secondary 21.30 26.41 28.56 31.02 Average 21.23 26.46 28.63 31.11 Ct value difference from control -0.03 -0.01 -0.33 -0.04 3 days
(9 months) ^a Primary 20.97 26.98 29.17 31.66 Secondary 20.97 26.99 29.25 32.42 Average 20.97 26.99 29.21 32.04 Ct value difference from control 0.23 -0.53 -0.91 -0.98 4 days
(12 months) ^a Primary 20.29 25.61 28.41 30.64 Secondary 20.26 25.49 28.12 30.33 Average 20.28 25.55 28.27 30.49 Ct value difference from control 0.93 0.91 0.03 0.58

a: Actual aging period reproduced in a shortened time

<110> Korea Centers for Disease Control and Prevention MICOBIOMED CO., LTD. <120> PRIMERS AND PROBES FOR SIMULTANEOUS DETECTION OF LINEAGE OF LASSA VIRUS AND DETECTING METHOD FOR LASSA VIRUS USING THE SAME <130> 2018P-07-006 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LASV-NG-NF1 <400> 1 cactgtggga cyatygccaa tg 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LASV-SL-NF1 <400> 2 cattgtggca cwgttgcaaa tg 22 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LASV-NG-NR1 <400> 3 ttccggaatc aagtgctatr tarc 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LASV-SL-NR3 <400> 4 gcctgaatca agggcaatgt arct 24 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> LASV-NP1 <400> 5 ccaccccarg ccatcctcat raaagt 26 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> LASV-NP2 <400> 6 ccaccccaag ccatcctcat gaaagt 26

Claims (12)

A first forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 1;
A second forward primer consisting of a nucleotide sequence represented by SEQ ID NO: 2;
A first reverse primer consisting of a nucleotide sequence represented by SEQ ID NO: 3;
A second reverse primer consisting of the nucleotide sequence shown in SEQ ID NO: 4; And
Lineage I, Lineage II, Lineage III, and Lineage IV of Lassa virus consisting of a probe consisting of a nucleotide sequence of SEQ ID NO: 5 and a probe consisting of a nucleotide sequence of SEQ ID NO: 6 A composition for detection capable of simultaneously detecting the.
delete According to claim 1, wherein the probe is a reporter is additionally conjugated to the 5'end, the detection composition capable of simultaneously detecting the lines of Lineage I, Lineage II, Lineage III, and Lineage IV of Lhasa virus.
According to claim 1, wherein the probe is a quencher is additionally conjugated to the 3'end, the detection composition capable of simultaneously detecting the lines of the Lhasa virus Lineage I, Lineage II, Lineage III, and Lineage IV.
The method of claim 3, wherein the reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy- 4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green (oregon green), alexa fluor, JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro -Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. Any one selected, a composition for detection capable of simultaneously detecting the lines of Lineage I, Lineage II, Lineage III, and Lineage IV of Lhasa virus.
The method of claim 4, wherein the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dapsil ( dabcyl), Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher (Blackberry Quencher), any one selected from the group consisting of Iowa black, Lhasa virus Lineage I, Lineage II, Lineage III, and Lineage A composition for detection capable of simultaneously detecting IV lines.
A kit for detection capable of simultaneously detecting the lines of Lineage I, Lineage II, Lineage III, and Lineage IV of the Lhasa virus comprising the composition of claim 1.
delete 1) separating the nucleic acid from the specimen;
2) amplifying the target sequence by performing a polymerase chain reaction (PCR) using the composition of claim 1 using the nucleic acid isolated from the sample as a template; And
3) detecting the amplified product of step 2) through fluorescence measurement; A method capable of simultaneously detecting the strains of Lineage I, Lineage II, Lineage III, and Lineage IV of Lhasa virus comprising a.
delete The method of claim 9, wherein the specimen is obtained from a clinical sample or an environmental sample, and can simultaneously detect the lines of Lineage I, Lineage II, Lineage III, and Lineage IV of Lhasa virus.
The method of claim 9, wherein the method capable of simultaneously detecting the lineage of the Lhasa virus represents a minimum detection limit of 30 to 40 copies/reaction, of Lineage I, Lineage II, Lineage III, and Lineage IV of the Lhasa virus. A way to detect lines simultaneously.

Images