KR102564236B1 - Primers and probes for detection of Human immunodeficiency virus type 2 and detecting method for Human immunodeficiency virus type 2 using the same - Google Patents

Abstract

The present invention relates to primers and probes for detecting human immunodeficiency virus type 2, and a method for detecting human immunodeficiency virus type 2 using the same, wherein the primer and probe set of the present invention can detect human immunodeficiency virus type 2 with high sensitivity and specificity, and since reproducible results can be obtained when real-time RT-PCR is performed using the same, the primer and probe set of the present invention can be usefully used for detection and diagnosis of human immunodeficiency virus type 2.

Description

Primers and probes for detection of Human immunodeficiency virus type 2 and detecting method for Human immunodeficiency virus type 2 using the same }

The present invention relates to primers and probes for detecting human immunodeficiency virus type 2, and a method for detecting human immunodeficiency virus type 2 using the same.

Human immunodeficiency virus (HIV) is an RNA virus belonging to the Retroviridae Lentivirus in terms of virus classification. It has external projections composed of envelope proteins gp120 and gp41 on the surface, and the inside of the envelope is covered with matrix protein p17 and has core protein p24. form the nucleocapsid. HIV is divided into HIV-1 and HIV-2, and HIV-1 originated from the simian immunodeficiency virus (SIVcpz) of chimpanzees, and is very widespread because of its greater infectivity and toxicity than HIV-2. HIV-2 originates from the blue monkey and is mainly distributed in parts of Africa. In particular, HIV-1 exists in a total of nine types, including types A, B, and C, and the 10th new type was discovered in February 2001, but it was confirmed that they were different by more than 16% and 20%, respectively, compared to types A and B. It has also been registered as a new virus that is not an HIV-1 type virus. The reason why so many mutations occur is because HIV is an RNA virus, which synthesizes cDNA in the host cell by the reverse transcriptase that exists inside.

Acquired Immunodeficiency Syndrome (AIDS) is a disease caused by infection with the human immunodeficiency virus (HIV). HIV infection is accompanied by a gradual decrease in the number of CD4+ T cells and an increase in viral load. HIV infection is basically divided into four stages: incubation period, acute infection, incubation period, and AIDS. The incubation period is asymptomatic and lasts for 2 to 4 weeks. Symptoms such as muscle pain, chills, and pain in the mouth and esophagus may occur. During the incubation period there are few symptoms and may be asymptomatic. AIDS, which can last from two weeks to more than 20 years, is the final stage of HIV infection and presents with a variety of opportunistic symptoms.

Human Immunodeficiency virus type 2 (HIV-2) is less known than HIV-1, but it is an infectious agent that infects through the same route as HIV-2 and causes acquired immunodeficiency syndrome (AIDS). am. HIV-2 weakens the immune system more slowly than HIV-1 and is less infectious than people with HIV-1, so detecting HIV-2 in early AIDS patients is very difficult.

Methods for diagnosing HIV include antigen-antibody simultaneous detection, antigen detection, and gene detection. The antigen-antibody simultaneous detection method has a high sensitivity, but has the disadvantage of requiring a secondary confirmation test such as Western blot because there is a possibility of false positive reaction. In addition, the antigen detection method can be tested in the early stage of infection, when the antibody is not formed, but when the antibody formation increases, the amount of antigen detection is relatively reduced, so it can be used only to identify an infected person in the early stage. The genetic detection method detects the gene (RNA) of HIV and has the advantage of being detectable after about 11 days after being infected with the virus, and having high sensitivity and enabling quantitative testing.

Since HIV-2 has no effective vaccine and treatment to date and has a very high mortality rate, development of a test method capable of rapidly detecting HIV-2 is required for prevention of rapid spread and efficient quarantine and quarantine in the event of a virus outbreak.

Prior art related to the HIV-2 detection method includes

Accordingly, the present inventors completed the present invention by developing primers and probes for real-time RT-PCR for detecting HIV-2 with high sensitivity and specificity.

An object of the present invention is to provide primers and probes for detecting human immunodeficiency virus type 2 (HIV-2), and a method for detecting human immunodeficiency virus type 2 using the same.

In order to achieve the above object, the present invention

A forward primer represented by the nucleotide sequence of SEQ ID NO: 1; and

A reverse primer represented by the nucleotide sequence of SEQ ID NO: 2; Provided is a primer set for detecting human immunodeficiency virus type 2 (HIV-2) consisting of.

In addition, the present invention provides a composition for detecting human immunodeficiency virus type 2 (HIV-2) comprising the primer set.

In addition, the present invention provides a kit for detecting human immunodeficiency virus type 2 (HIV-2) comprising the composition.

In addition, the present invention

1) isolating nucleic acids from a specimen;

2) amplifying a target sequence by performing a real-time polymerase chain reaction (real-time PCR) using the nucleic acid isolated from the sample as a template and using the primer set of claim 1; and

3) detecting the amplification product of step 2) through fluorescence measurement; It provides a human immunodeficiency virus type 2 (HIV-2) detection method comprising a.

The present invention relates to primers and probes for detecting HIV-2, and a method for detecting HIV-2 using the same, and the primer and probe set of the present invention can detect HIV-2 with high sensitivity and specificity, Since reproducible results can be obtained when real-time RT-PCR is performed using the present invention, the primer and probe set of the present invention can be usefully used for detecting and diagnosing HIV-2.

1 is a diagram showing an amplification curve obtained by performing real-time RT-PCR using the primer and probe set of the present invention.
Figure 2 is a real-time RT-PCR result graph analyzing the minimum detection limit of the primer and probe set of the present invention.
Figure 3 is a real-time RT-PCR result graph measuring the analytical reproducibility of the primer and probe set of the present invention.
4 is a graph of real-time RT-PCR results measuring cross-reactivity of the primer and probe set of the present invention with an HIV-1-positive sample.

Hereinafter, the present invention will be described in detail.

The present invention provides a primer set for detecting human immunodeficiency virus type 2 (HIV-2) consisting of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2.

The primer set may specifically amplify a long terminal repeat (LTR) region of HIV-2. In addition, the primer set may be a pair of forward and reverse primers consisting of 10 to 40, specifically, 15 to 30 nucleotide sequences capable of complementary binding to the gene of the LTR region. In one embodiment of the present invention, the primer set may consist of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2.

The primers can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such primers can be modified using a number of means known in the art, as long as they exhibit an effect capable of detecting HIV-2. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer of the present invention, if necessary, may include a label that can be directly or indirectly detected by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg ³² P), fluorescent molecules and chemical groups (eg biotin), etc. there is

In addition, the present invention provides a detection composition capable of detecting human immunodeficiency virus type 2 (HIV-2) including the primer set.

The primer set may have characteristics as described above. As an example, the primers may specifically amplify the LTR region of human immunodeficiency virus type 2 (HIV-2). In addition, the primer set may be a pair of forward and reverse primers consisting of 10 to 40, specifically, 15 to 30 nucleotide sequences capable of complementary binding to the gene of the LTR region. In one embodiment of the present invention, the primer set may consist of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2.

The composition may further include a probe represented by the nucleotide sequence of SEQ ID NO: 3 and a probe represented by the nucleotide sequence of SEQ ID NO: 4.

As used herein, the term "probe" refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and includes oligonucleotide probes and single stranded DNA probes. , It can be produced in the form of a double stranded DNA probe or an RNA probe.

The probe can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such probes can be modified using a number of means known in the art, so long as they exhibit an effect capable of detecting HIV-2. Examples of such modifications include methylation, capping, substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioates, phosphorodithioates, etc.). A nucleic acid can contain one or more additional covalently linked moieties, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalants (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further conjugate a reporter to its 5' end. The reporter is VIC, FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), fluorescein chlorotriazinyl (fluorescein chlorotriazinyl), HEX (2', 4', 5', 7' -tetrachloro-6-carboxy-4,7-dichlorofluorescein), rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green , Alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), Any one selected from the group consisting of TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine It may be above, but in addition, any material known in the art that can be used as a reporter may be used. In one embodiment of the present invention, the reporter may be Cyanine 5 (Cy5).

The probe may further conjugate a quencher to its 3' end. The photon quencher is SFCQ1, MGBNFQ (Minor Groove Binder non-fluorescent quencher), TAMRA, BHQ (black hole quencher) 1, BHQ2, BHQ3, NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (deep dark quencher), It may be any one or more selected from the group consisting of Blackberry Quencher and Iowa black, but any material known in the art that can be used as a photon quencher may be used. In one embodiment of the present invention, the quencher may be MGBNFQ.

In addition to the primer set and the probe, the composition may include reverse transcription polymerase, DNA polymerase, a cofactor such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E.coli DNA polymerase I, thermostable DNA polymerase or bacteriophage T7 DNA polymerization there are enzymes The polymerase may be isolated from the bacteria itself, purchased commercially, or obtained from cells expressing high levels of a cloned gene encoding the polymerase.

For the probe, an oligonucleotide modified with a reporter at the 5' end and a quencher at the 3' end is added to the PCR reaction solution, and the probe specifically hybridizes to the template DNA in the annealing step, but fluorescence of the reporter is caused by the quencher on the probe. Generation is suppressed, and in the extension step, only the probe hybridized to the template is degraded by the 5' → 3' exonuclease activity of Taq DNA polymerase, and the reporter is released from the probe, releasing the suppression by the small photon to emit fluorescence. do.

The composition may further include an internal control (IC) represented by the nucleotide sequences of SEQ ID NOs: 5, 6 and 7.

The internal control serves to confirm whether nucleic acid extraction from a specimen and multiple real-time reverse transcription polymerase chain reactions have occurred well.

In a specific embodiment of the present invention, the present inventors use a forward primer based on the nucleotide sequence of SEQ ID NO: 1, a reverse primer based on the nucleotide sequence of SEQ ID NO: 2, a probe based on the nucleotide sequence of SEQ ID NO: 3, and a sequence of SEQ ID NO: 4. A probe described by nucleotide sequence was prepared (see Tables 2 and 3), and the sensitivity of real-time reverse transcription-polymerase chain reaction (RT-PCR) was analyzed using this, It was confirmed that the minimum detection limit was 10 copies/reaction (see FIG. 2). In addition, it was confirmed that the primers and probes could specifically detect only HIV-2 and did not cross-react with HIV-1 (see FIG. 4). In addition, it was confirmed that there is analytical reproducibility of real-time RT-PCR using the primers and probes (see FIG. 3).

In addition, the present invention provides a kit for detecting human immunodeficiency virus type 2 (HIV-2) comprising the composition.

The composition may have characteristics as described above. For example, the composition includes a primer set capable of detecting human immunodeficiency virus type 2 (HIV-2) consisting of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2 may include In addition, the composition may further include a probe represented by the nucleotide sequence of SEQ ID NO: 3 and a probe represented by the nucleotide sequence of SEQ ID NO: 4, wherein the probe has a reporter at its 5' end and a quencher at its 3' end. It may be further conjugated with self. In addition, the composition may further include an internal control (IC) represented by the nucleotide sequences of SEQ ID NOs: 5, 6 and 7.

The kit may further include one or more other component compositions, solutions or devices suitable for the assay method. The kit contains a tube or other suitable container, reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), Taq- enzymes such as polymerase and reverse transcriptase, DNase inhibitors, RNase inhibitors, DEPC-water and sterile water, and the like. On the other hand, the components included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve the stability of the product by lowering the degree of freedom of the included components. For the production of such a dried form, the application of a drying step is required, and at this time, heating drying, natural drying, reduced pressure drying, freeze drying, or a combination process thereof may be used.

In addition, the present invention

1) isolating nucleic acids from a specimen;

2) amplifying a target sequence by performing a real-time polymerase chain reaction (real-time PCR) using the nucleic acid isolated from the sample as a template and using the primer set of claim 1; and

3) detecting the amplification product of step 2) through fluorescence measurement; It provides a human immunodeficiency virus type 2 (HIV-2) detection method comprising a.

The sample may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine.

The primer set may have characteristics as described above. As an example, the primers may specifically amplify the LTR region of human immunodeficiency virus type 2 (HIV-2). In addition, the primer set may be a pair of forward and reverse primers consisting of 10 to 40, specifically, 15 to 30 nucleotide sequences capable of complementary binding to the gene of the LTR region. In one embodiment of the present invention, the primer set may consist of a forward primer represented by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer represented by the nucleotide sequence of SEQ ID NO: 2.

The human immunodeficiency virus type 2 (HIV-2) detection method shows a minimum detection limit of 5 to 15 copies/reaction.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited by the following examples.

< Example 1> of human immunodeficiency virus type 2 (HIV-2) LTR targeting a region gene primer and probe produce

HIV-2 strains that have emerged so far were investigated and the nucleotide sequences of each strain were collected at the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/) (Table 1). . Primers and probes capable of binding to the most specific sites were prepared by aligning the collected nucleotide sequences and analyzing homology (Table 2). Using primer design software (Primer Express, USA), the Tm (melting temperature) of the primer and probe was designed to be 60 ° C, and Cy5 was conjugated as a reporter to the 5' end of the HIV-2 detection probe, and the 3' At the end, MGBNFQ was coupled as a quencher. VIC was bound as a reporter to the 5' end of the internal control (IC) probe, and MGBNFQ was bound to the 3' end as a quencher (Table 3).

classification number strain name country Human Immunodeficiency Virus Type 2 (HIV-2) One KX174311.1 HIV-2 isolate DE20189CI001 Cote d'lvoire, complete genome Cote d'lvoire 2 KX174313.1 HIV-2 isolate DE20108JP005 from Japan, complete genome Japan 3 KX174312.1 HIV-2 isolate DE20107NG002 from Nigeria, complete genome Nigeria 4 KP890355.1 HIV-2 isolate NWK08 from USA, complete genome USA 5 AF082339.1 HIV-2 isolate ALI from Guinea-Bissau, complete genome Guinea-Bissau 6 DQ307022.1 HIV-2 isolate CRIK 147 from India, complete genome India 7 EU028345.1 HIV-2 isolate 03CM-510-03 from Cameroon, complete genome Cameroon 8 AY530889.1 HIV-2 isolate 96FR12034 from France, complete genome France 9 EU980602.1 HIV-2 isolate NNVA from India, complete genome India

detection target primer or
probe ^a Sequence (5'→3') sequence number Length (bp) GC content
(%) Tm ^b
(℃) HIV-2 forward primer (+) ^c CCTGGGAGGTTCTCTCCAGC One 20 65.0 61.6 reverse primer (-) ^c TAAGCAAGCAAGCGTGGAGC 2 20 55.0 57.5 1st probe Cy5-GGTAGAGCCTGGGTGTTCCCTGCTAGAC-MGBNFQ 3 28 60.71 68.4 2nd probe Cy5-GGTAGAGCCTGGGTGTCCCCTGCTAGAC-MGBNFQ 4 28 64.29 69.8 internal control
(internal control, IC) forward primer GTTATCGGTGCGGTGAATGC 5 20 55.0 57.5 reverse primer CCTTTCCTGCGGTAGTGGT 6 20 55.0 57.5 probe VIC-TCAACCTTACTGGAATCGATGGTGTCTCCG-MGBNFQ 7 30 55.0 64.4

^b Melting temperature

^c (+): attached in the 5' to 3' direction to the target sequence

(-): attached to the target sequence in the 3' to 5' direction

detection target reporter (fluorescent substance) photon HIV-2 Cy5 MGBNFQ Internal control (IC) VIC

< Experimental example 1> of the present invention primer and probe Set concentrations and real-time RT- PCR Optimization of reaction conditions

Optimal concentrations of primers and probes and real-time RT-PCR reaction conditions to ensure that pathogens targeted by the primers and probes in Table 2 can be detected with high sensitivity and specificity, and that the reaction is not affected by competition with other primers and probes. confirmed.

Specifically, the amplification efficiency of each target primer and probe is similarly adjusted by similarly adjusting the ΔRn and the slope of the amplification plot of each detection target gene region, and non-specific amplification products are not generated and the amplification efficiency is maintained We tried to find conditions that can minimize the concentration of the primer on the line, and the optimized concentration conditions are shown in Table 4. Real-time RT-PCR was performed using a real-time RT-PCR device (Applied Biosystems 7500 Fast Real-time PCR system, Life technologies, USA) according to the reaction solution composition shown in Table 5 and the reaction conditions shown in Table 6.

As a result, real-time RT-PCR was performed under the conditions shown in Tables 4 to 6 to confirm the amplification curve as shown in FIG. 1, and positive or negative was determined based on Table 7.

detection target Primer or Probe final concentration HIV-2 forward primer 250 nM reverse primer 250 nM probe 150 nM Lambda (IPC)
forward primer 500nM reverse primer 500nM probe 100nM

reaction liquid composition Amount added (μl) SuPrimeScript Real-time PCR Premix,
with ROX (2X) 10 μl Primer/Probe Mixture 5 μl template RNA 5 μl Sum 20 μl

procedure Temperature (℃) hour number of cycles reverse transcription
(Reverse transcription) 50 20 minutes One Initial PCR activation 95 10 minutes One Denaturation 95 10 seconds 40 Annealing/stretching
(Annealing/extension) 60 1 min

division result Judgment method Determined by the Threshold Cycle (CT) value at the threshold reference value of 0.1 positivity When the CT value of the LTR gene and IC of HIV-2 is 37 or less voice When the CT value of the LTR gene and IC of HIV-2 is greater than 37

< Experimental example 2> of the present invention primer and probe Real-time RT-with Set of PCR Analytical Sensitivity Check

Real-time RT-PCR was performed under the conditions of Tables 4 to 6 using the primers and probes prepared in Example 1, and the analytical sensitivity was confirmed by measuring the minimum limit of detection (LoD). Based on Table 7, when the cycle threshold was 37 or less, it was determined to be positive.

As a result, as shown in FIG. 2, the primers and probes of the present invention were able to detect HIV-2 up to 10 copies/reaction, confirming that the analytical sensitivity was excellent.

serial number positive substance dilution concentration One HIV-2 positive material 1×10 ⁶ copies/reaction 2 HIV-2 positive material 1×10 ⁵ copies/reaction 3 HIV-2 positive material 1×10 ⁴ copies/reaction 4 HIV-2 positive material 1×10 ³ copies/reaction 5 HIV-2 positive material 1×10 ² copies/reaction 6 HIV-2 positive material 1×10 ¹ copy/reaction 7 HIV-2 positive material 1×10 ⁰ copies/reaction 8 HIV-2 positive material 1×10 ^-1 copies/reaction

< Experimental example 3> Confirmation of the analytical reproducibility of the minimum detection limit

In order to confirm the analytical reproducibility of the minimum detection limit (10 copies / reaction) confirmed in Experimental Example 2, the experiment was repeated 21 times in the same method and conditions as in Experimental Example 2.

As a result, as shown in FIG. 3, it was confirmed that the primers and probes of the present invention could repeatedly detect up to 10 copies/reaction of HIV-2.

< Experimental example 4> of the present invention primer and probe Real-time RT-with Set of PCR Confirmation of analytical specificity

In order to confirm the analytical specificity of the real-time RT-PCR method using the primers and probes prepared in Example 1, real-time RT-PCR was performed on 50 HIV-1 positive samples in the same manner as described in Experimental Example 1, Cross-reactivity was confirmed.

As a result, as shown in FIG. 4, no RT-PCR amplification was observed in the pathogen genes and transcripts, suggesting that no cross-reactivity was observed in the control pathogen.

<110> Korea Disease Control and Prevention Agency <120> Primers and probes for detection of human immunodeficiency virus type 2 and detecting method for Human immunodeficiency virus type 2 using the same <130> 2020P-10-009 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 1 cctgggaggt tctctccagc 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer <400> 2 taagcaagca agcgtggagc 20 <210> 3 <211> 28 <212> DNA <213> artificial sequence <220> <223> probe 1 <400> 3 ggtagagcct gggtgttcct tgctagac 28 <210> 4 <211> 28 <212> DNA <213> artificial sequence <220> <223> probe 2 <400> 4 ggtagagcct gggtgtcccc tgctagac 28 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> internal positive control (IPC) forward primer <400> 5 gttatcggtg cggtgaatgc 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> internal positive control (IPC) reverse primer <400> 6 ccttttcctg cggtagtggt 20 <210> 7 <211> 30 <212> DNA <213> artificial sequence <220> <223> internal positive control (IPC) probe <400> 7 tcaaccttac tggaatcgat ggtgtctccg 30

Claims (8)

A forward primer represented by the nucleotide sequence of SEQ ID NO: 1;
A reverse primer represented by the nucleotide sequence of SEQ ID NO: 2; and
Probes each represented by the nucleotide sequences of SEQ ID NOs: 3 and 4;
A primer and probe set for detecting human immunodeficiency virus type 2 (HIV-2), characterized in that it comprises a.
A composition for detecting human immunodeficiency virus type 2 (HIV-2), comprising the primer and probe set of claim 1.
delete The composition for detecting human immunodeficiency virus type 2 (HIV-2) according to claim 2, further comprising an internal control (IC) represented by the nucleotide sequences of SEQ ID NOs: 5, 6 and 7.
A kit for detecting human immunodeficiency virus type 2 (HIV-2), comprising the composition of claim 2 or 4.
1) isolating nucleic acids from a specimen;
2) amplifying a target sequence by performing a real-time polymerase chain reaction (real-time PCR) using the nucleic acid isolated from the sample as a template and using the primer and probe set of claim 1; and
3) detecting the amplification product of step 2) through fluorescence measurement; Characterized in that it comprises a, human immunodeficiency virus type 2 (HIV-2) detection method.
The method for detecting human immunodeficiency virus type 2 (HIV-2) according to claim 6, wherein the sample is obtained from a clinical sample or an environmental sample.
The method of claim 6, wherein the method for detecting human immunodeficiency virus type 2 (HIV-2) has a minimum detection limit of 5 to 15 copies/reaction, detecting human immunodeficiency virus type 2 (HIV-2) method.