KR101688807B1

KR101688807B1 - Method and kit for detecting that human saliva is present in a forensic sample using real-time PCR

Info

Publication number: KR101688807B1
Application number: KR1020150104296A
Authority: KR
Inventors: 임시근; 박현철; 이경명; 안상현; 강필원
Original assignee: 대한민국
Priority date: 2015-07-23
Filing date: 2015-07-23
Publication date: 2016-12-29

Abstract

The present invention relates to a method for the detection of Streptococcus salivarius, Streptococcus sanguinis and Neisseria subflava in oral or topical organs in forensic specimens using real-time PCR assays The present invention provides a method and a kit for rapidly and accurately detecting the presence or absence of saliva in a forensic sample according to whether or not three normal bacteria are detected.
According to the present invention, the presence or absence of saliva in the forensic specimen can be quickly, accurately and quantitatively determined by quantitatively detecting the presence of a combination of the three normal bacteria in forensic specimens using real-time PCR analysis Specificity and sensitivity are high, it is possible to solve the problem that the result of the conventional saliva test shows false or false negative, to increase the reliability of the result of scientific investigation, and to provide a clue to the reconstruction of the crime scene, have.

Description

TECHNICAL FIELD The present invention relates to a method and kit for detecting presence or absence of saliva in a forensic specimen using real-time PCR,

The present invention relates to a method and kit for detecting the presence or absence of saliva in a forensic specimen using a real-time PCR (real-time PCR), and more particularly, to a method and kit for detecting presence or absence of saliva in a forensic specimen, The present invention relates to a method and a kit for quickly and sensitively detecting the presence or absence of saliva in a forensic sample by quantitatively confirming three kinds of normal bacteria which reside in the foreskin sample.

Specifically, the present invention relates to the use of real-time PCR assays to detect the presence or absence of Streptococcus salivarius, Streptococcus sanguinis and Neisseria subsplafer in oral or topical organs in forensic specimens, The present invention relates to a method and kit for rapidly and accurately detecting the presence or absence of saliva in a forensic sample according to whether or not three normal bacteria are detected.

In addition, the present invention quantitatively detects whether a combination of the above-mentioned three normal bacteria is present in a forensic specimen using a real-time PCR analysis method, so that the presence or absence of the saliva in the forensic specimen can be quickly, accurately and quantitatively determined Specificity and sensitivity are high, it is possible to solve the problem that the result of the conventional saliva test shows false or false negative, to increase the reliability of the result of scientific investigation, and to provide a clue to the reconstruction of the crime scene, Lt; / RTI >

Forensic science supporting criminal investigation has developed at a rapid pace due to the rapid development of scientific and engineering base knowledge and analytical techniques. For scientific investigation, physical analysis, chemical analysis, molecular genetic analysis and diversity scientific analysis are carried out for various samples of forensic science samples collected from crime scene or large-scale disaster scene. The results obtained through such analysis play a key role in proving crimes and revealing the causes of accidents in scientific investigation.

Among the forensic specimens, evidence of saliva is one of the most important human body secretions of law and science, and is the most referenced evidence. Saliva evidence is characterized by being referred for evidence in almost all types of cases, including murder, sex offenses, robbery, and theft. Cigarette butts as well as cups and beverage bottles, cans, masks, mask, and chest swabs found in various crime scenes are typical saliva evidence for gene identification. Identification of saliva found in crime scene contributes to the resolution of crime by providing clues to reconstruction of crime scene.

For example, if a suspect smokes a cigarette or drinks a beverage, the saliva is accompanied by a discarded cigarette or cupful of oral epithelial cells. Although it is possible to analyze the suspect's genes from oral epithelial cells, it can not be confirmed by human eyes whether or not the oral epithelial cells are present in the evidence such as tobacco or cups. In such cases, if a positive saliva reaction is performed on a forensic sample such as a cigarette butt, a cup or a drink bottle, a can, a mask, a mask, or a breast of a female victim, the oral contact of the forensic specimen and the suspect can be indirectly proved , A careful sampling of the oral epithelial cells of a suspect on a saliva-positive forensic specimen can provide a strong clue for proving a crime. Therefore, detecting the presence of saliva in forensic specimens contributes to the resolution of crime by providing primary clues to the reconstruction of crime scene.

In addition, the saliva test is necessary for the identification of exhalation blood in relation to the analysis of blood forms. It is difficult to differentiate expiration blood from morphologically ejected blood, and it is sometimes necessary to distinguish it clearly for reconstruction of an incident site.

The saliva test to check for the presence of saliva involves the enzyme Amylase, which is present in the saliva. Unlike the blood test or semen test, there is no definite confirmation test. In addition to saliva, amylase is present in trace amounts (about 1 / 1,000 times as much as saliva) in urine, blood, semen, and vaginal fluid, and amylase activity may be different among individuals. For these reasons, the conventional saliva test is only a preliminary test, and the saliva test result may be false or negative. Thus, it is required to provide a new technique to replace the conventional amylase test method.

Recently, saliva-specific mRNA analysis and methylation analysis methods have been actively studied, and DNA of Streptococcus salivarius, which causes bad breath, has been amplified and detected from saliva (Forensic Dentistry and Microbial Analysis Bite Marks, APJ March, 2001).

The human oral cavity also has normal bacterial flora as in other organs of the body. In general, a variety of microorganisms such as Streptococcus, Neisseria, etc. are known as representative normal bacterial strains in the oral cavity. For reference, normal bacteria flora is a generic name of the organisms in each organ of the body, and functions as a defense mechanism of the body, thereby preventing the invasion of various pathogenic microorganisms derived from the outside.

Streptococcus (streptococci) microorganisms are streptococcal gram-positive strains. Streptococcus salivarius is a typical streptococci present in saliva. As described above, Streptococcus salivarius constitutes a normal flora in the oral cavity.

Streptococcus sanguinis is a normal bacterium normally found in the oral cavity of a healthy person, such as Streptococcus salivarius. It is not generally pathogenic but occasionally, it may cause inflammation of the endocardium in the bloodstream. Neisseria subflava is also a gram-negative bacterium that is present in the upper respiratory tract of a normal person and may cause non-pathogenic or opportunistic infections. However, in the prior art, the detection of these bacteria present in the oral cavity or in the superior organs was performed for the diagnosis of endocarditis or bacteremia, and was far from the analysis of forensic specimens.

Conventional oral microorganism detection techniques are limited to endocarditis or rare microorganisms that cause bacteremia, and limited to detection of single species using real-time PCR or detection of pathogenic microorganisms causing oral infection such as periodontal disease . However, the use of microorganisms or blood specimens present on the tooth surface is limited to forensic specimens and development of new technologies is required.

In response to the demand of the technical field of the present invention, the present inventors have developed a technique for confirming whether or not saliva is mixed with a forensic specimen using a combination of three kinds of normal bacteria in the oral cavity or the upper gastrointestinal tract The present invention has been completed.

Forensic Dentistry and Microbial Analysis of Bite Marks. APJ March, 2001 (released March 2001)

The present invention uses a real-time PCR (real-time polymerase chain reaction) to quantitatively identify three types of normal bacteria in the oral cavity or upper gastrointestinal tract in a forensic specimen, thereby promptly and sensitively detecting the presence or absence of saliva in the forensic specimen And to provide a kit and a method for the same.

Specifically, the present invention relates to the use of real-time PCR assays to detect the presence or absence of Streptococcus salivarius, Streptococcus sanguinis and Neisseria subsplafer in oral or topical organs in forensic specimens, The present invention relates to a method and kit for detecting the presence or absence of saliva in a forensic sample according to the presence or absence of three kinds of normal bacteria in a fast, accurate, high specificity and sensitive manner.

In addition, the present invention quantitatively detects whether a combination of the above-mentioned three normal bacteria is present in a forensic specimen using a real-time PCR analysis method, so that the presence or absence of the saliva in the forensic specimen can be quickly, accurately and quantitatively determined Specificity and sensitivity are high, it is possible to solve the problem that the result of the conventional saliva test shows false or false negative, to increase the reliability of the result of scientific investigation, and to provide a clue to the reconstruction of the crime scene, The purpose of the technology is to provide.

As a result of intensive studies to solve the technical problem of the invention described above, the inventors of the present invention have found that by quantitatively confirming three kinds of normal bacteria by real-time PCR analysis, It has come to devise a technology that can promptly and sensitively identify the presence or absence. The present invention relates to a method for detecting the presence or absence of saliva in forensic specimens according to the detection of three kinds of bacteria by real-time PCR analysis using the point that the above-mentioned three kinds of oral bacteria or normal bacteria of the above- And also provides a technique capable of quantitatively detecting various specimens including blood in consideration of the characteristics that the bacteria can cause opportunistic infection.

As used herein, the term "forensic specimen" refers to various samples collected from a crime scene or a large-scale disaster site, and includes samples for physical investigation, chemical analysis, molecular genetic analysis, and diversity scientific analysis for scientific investigation it means. For example, forensic specimens to be detected for the presence of saliva include cigarette butts, cups, beverage bottles, cans, masks, masked faces, and breast-wiping swabs from women victims. However, the forensic specimen of the present invention is not limited thereto, and it is needless to say that the specimen can be used in the present invention as various specimens collected from a crime scene and the like.

As used herein, the term "real-time PCR" refers to the application of a fluorescent material to a PCR technique, in which the amplification of a target gene existing in a specimen during the reaction, It is a method that can quickly and accurately analyze the presence or absence of amplification of a target gene and its pattern by real-time detection and quantitative analysis. This real-time PCR is divided into two methods, one using SYBR Green and the other using double-labeled probes.

The SYBR green technique combines the SYBR green dye into the DNA amplified during real-time PCR amplification and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescent signal. The fluorescent signal is detected, It is a method that can measure the presence and the amount of amplification product from it. The real-time PCR technique using a dual labeled probe is a method using a double-labeled probe in which a fluorescent substance is labeled at the 5 'end and a quencher is labeled at the 3' end, Through the fluorescence signal from the labeled probe, it is possible to confirm whether or not the double-labeled probe is annealed with the PCR amplification product of the target gene, and the presence or absence of the target gene and the amount of the amplification product generated therefrom can be measured. It goes without saying that real-time PCR known in the art such as a TaqMan probe method and the like are applicable in the present invention.

A method for detecting the presence or absence of saliva in a forensic specimen using real-time PCR according to an embodiment of the present invention,

Preparing a gene sample from a specimen,

Using the prepared gene sample as a template, primer pairs of SEQ ID NOS: 1 and 2, which specifically amplify the methionine aminopeptidase gene, which is a target gene for the identification of Streptococcus salivarius, At least one pair of primers of SEQ ID NOS: 4 and 5, a pair of primers of SEQ ID NOS: 7 and 8, a pair of primers of SEQ ID NOS: 10 and 11, and a pair of primers of SEQ ID NOS: 13 and 14 and a pair of primers of Streptococcus a pair of primers of SEQ ID NOS: 16 and 17, a pair of primers of SEQ ID NOS: 19 and 20, specifically amplifying a species-specific intergenic spacer region, which is a target gene for saddle- And at least one primer pair of the primer pairs of SEQ ID NOS: 22 and 23, and a pair of primers of Neisseria subflava a pair of primers of SEQ ID NOS: 25 and 26, a pair of primers of SEQ ID NOS: 28 and 29, and a pair of primers of SEQ ID NO: 31 and 31, respectively, which specifically amplify the aspartate-semialdehyde dehydrogenase gene, And primer pairs of SEQ ID NOS: 34 and 35 and at least one primer pair of primer pairs of SEQ ID NOS: 37 and 38 are used to amplify the methionine aminopeptidase gene, the species-specific Amplifying the aspartic acid semialdehyde dehydrogenase gene by a real-time PCR;

Time PCR results after amplification of the methionine aminopeptidase gene, the species-specific intergenic spacer region, and the aspartic acid semialdehyde dehydrogenase gene to determine the presence of Streptococcus salivarius, Streptococcus superquinis, and age Determining whether a combination of three species of ceria subsplafer is present,

And determining whether or not the saliva is contained in the specimen according to the presence or absence of the combination of the three kinds of bacteria in the specimen.

For example, when it is judged that the three kinds of bacteria are present in the forensic specimen according to the method of the present invention, it is possible to reliably judge that the saliva is contained in the forensic specimen without any doubt, And can provide clues to the reconstruction of the crime scene. On the other hand, for example, when it is determined that the three kinds of bacteria do not exist in the forensic sample according to the method of the present invention, it can be judged that the saliva is not contained in the forensic sample.

In a method for detecting presence or absence of saliva in a forensic specimen using real-time PCR in one embodiment of the present invention, a labeling substance for detecting each amplified target gene product in a real-time PCR process may be used, The amount of gene amplification related to each target gene amplified in the process is shown.

Also, the method of detecting presence or absence of saliva in a forensic specimen using real-time PCR in one embodiment of the present invention,

A positive standard, which is a gene sample known to be known in advance of amplification, of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the copy number of the aspartic acid semialdehyde dehydrogenase gene, is mixed with the methionine aminopeptidase gene, A primer pair corresponding to the target gene spacer region and the aspartic acid semialdehyde dehydrogenase gene, and a primer pair corresponding to the methionine aminopeptidase gene, the species-specific gene spacer region and the aspartic acid semialdehyde dehydrogenase gene Amplifying the amplified product by real-time PCR using a labeling substance indicating the amount of gene amplification,

Measuring a change in signal intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant signal intensity;

Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in signal intensity of the labeling substance;

The change in the signal intensity of the marker substance with respect to the entire PCR amplification period of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene present in the gene sample of the specimen is measured Analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant signal intensity,

The Cp value or Ct value obtained by PCR amplification of each of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene present in the gene sample of the specimen is used as the copy number of the positive standard And quantitatively measuring the presence or absence of saliva in the specimen.

In a method for detecting the presence or absence of saliva in a forensic specimen using real-time PCR according to an embodiment of the present invention,

The probes specifically binding to the methionine aminopeptidase gene include oligonucleotides of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12 and SEQ ID NO: 15 and oligonucleotides complementary to these oligonucleotides One end of at least one probe selected from the group consisting of:

A probe that specifically binds to the species-specific intergenic spacer region includes at least one of oligonucleotides of SEQ ID NO: 18, SEQ ID NO: 21 and SEQ ID NO: 24 and oligonucleotides complementary to these oligonucleotides One end of one probe,

The probes specifically binding to the aspartic acid semialdehyde dehydrogenase gene include oligonucleotides of SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36 and SEQ ID NO: 39 and oligonucleotides complementary to these oligonucleotides , For example, at the 5 'end of at least one probe selected from the group consisting of:

In this regard, it is preferable to simultaneously include three probes labeled with a labeling substance detectable at different wavelengths, and it is preferable to simultaneously use three probes labeled with a labeling substance detectable at different wavelengths, It is more preferable that three target genes of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene can be detected at one time in the tube. In one embodiment of the present invention, three bacteria associated with the presence or absence of saliva in a forensic specimen in one test tube can be detected by a single test.

In a method for detecting presence or absence of saliva in a forensic specimen using real-time PCR according to an embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeling substance is measured to determine whether the methionine aminopeptidase gene, A specific gene spacer region and amplification amount of the aspartic acid semialdehyde dehydrogenase gene can be calculated.

The real-time PCR amplification kit for detecting the presence or absence of saliva in a forensic specimen of an embodiment of the present invention is characterized in that a methionine aminopeptidase gene, which is a target gene for the species identification of Streptococcus salivarius, A primer pair of SEQ ID NOs: 1 and 2, a pair of primers of SEQ ID NOs: 4 and 5, a pair of primers of SEQ ID NOs: 7 and 8, a pair of primers of SEQ ID NOs: 10 and 11, and a pair of primers of SEQ ID NOs: (SEQ ID NOS: 16 and 17) that specifically amplify a species-specific intergenic spacer region that is a target gene for the sibling of Streptococcus sanguinis. A pair of primers of SEQ ID NOs: 19 and 20, and a pair of primers of SEQ ID NOs: 22 and 23, And a pair of primers of SEQ ID NOS: 25 and 26, which specifically amplify the aspartate-semialdehyde dehydrogenase gene, which is a target gene for sibling of Neisseria subflava, A primer pair of SEQ ID NOS: 31 and 32, a pair of primers of SEQ ID NOS: 34 and 35, and a pair of primers of at least one pair of primers of SEQ ID NOS: 37 and 38, and a DNA polymerase, dNTPs and PCR Buffer solution.

A real-time PCR amplification kit for detecting the presence or absence of saliva in a forensic specimen of an embodiment of the present invention further includes a labeling material for detecting a real-time PCR amplification product of the target genes and indicating amplification amount of the target genes, silver,

The real-time PCR amplification kit for detecting the presence or absence of saliva in the forensic specimen of the embodiment of the present invention preferably includes three probes labeled with a labeling substance detectable at different wavelengths at the same time. Thus, when three probes labeled with a labeling substance capable of being detected at different wavelengths are simultaneously contained, it is possible to detect the methionine aminopeptidase gene, the species-specific gene Liver spacer region and the aspartic acid semialdehyde dehydrogenase gene can be detected at a time. Therefore, one embodiment of the present invention is advantageous in that it is possible to detect three kinds of bacteria related to the presence or absence of saliva in a forensic specimen in one test tube by a single test.

In a real-time PCR amplification kit for detecting the presence or absence of saliva in a forensic specimen of an embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeling substance is measured to detect the methionine aminopeptidase gene, -Specific intergenic spacer region and the amplification amount of the aspartic acid semialdehyde dehydrogenase gene can be calculated.

In the present invention, one end of the probe, for example, the 5 'terminus may be selected from Cy5, Cy3, x-Rhodamine, Texas Red, SYBR green, FAM, VIC, JOE, NED, HEX and TET And the other end of the probe, for example, the 3 'end, may be labeled with a mineralsuch as IABkFQ, DABCYL, BHQ (BHQ-1, BHQ-2, BHQ- have. However, it should be understood that the present invention is not limited thereto, and a variety of fluorescent materials and minerals known in the art can be used.

According to the present invention, by using real-time PCR (real-time polymerase chain reaction), it is possible to quantitatively identify three kinds of normal bacteria in the oral cavity or in the upper organ in the forensic specimen, .

Specifically, in accordance with the present invention, the use of real-time PCR assays to detect the presence of Streptococcus salivarius, Streptococcus sanguinis, and Nyseria subflava in oral or topical organs in forensic specimens, (Neisseria subflava), and the presence or absence of saliva in forensic specimens can be detected quickly, accurately, with high specificity and sensitivity depending on the detection of these three normal bacteria.

Particularly, since the forensic sample collected at the crime scene is easily contaminated by various microorganisms or the like or is damaged by environmental factors, it is difficult to determine whether the presence of saliva in the forensic specimen is included only in the fact that Streptococcus salivarius is identified , Confirmation of the presence of Streptococcus sanguinis (Streptococcus sanguinis), a normal bacterium in the oral cavity of a normal person, in a forensic sample, and examination of the presence of a normal bacterium Neisseria subflava, The presence of saliva in forensic specimens can be determined more reliably through presence confirmation.

In addition, the present invention quantitatively detects the presence of a combination of three normal bacteria in forensic specimens using real-time PCR assays to determine the presence or absence of saliva in forensic specimens quickly, accurately, and quantitatively And the sensitivity of the conventional saliva test results to false positives or false negatives. In addition, the reliability of the results of scientific investigations can be increased, and the clues to reconstruction of the crime scene can be provided. .

Fig. 1 shows the results of a comparison of primer pairs (primer pairs of SEQ ID NOS: 1 and 2) of SS-map-F1 and SS-map-R1 and SS- As a result of performing real-time PCR on the methionine aminopeptidase gene which is a target gene of Barius, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
Fig. 2 shows the results of PCR amplification using a combination of primer pairs SS-map-F2 and SS-map-R2 (primer pairs of SEQ ID NOS: 4 and 5) As a result of performing real-time PCR on the methionine aminopeptidase gene which is a target gene of Barius, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
FIG. 3 shows the results of a comparison of primer pairs (primer pairs of SEQ ID NOS: 7 and 8) of SS-map-F3 and SS-map-R3 with the SS-map- P3 probe (probe of SEQ ID NO: As a result of performing real-time PCR on the methionine aminopeptidase gene which is a target gene of Barius, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
FIG. 4 shows the results of PCR amplification using a combination of primer pairs SS-map-F4 and SS-map-R4 (primer pairs of SEQ ID NOs: 10 and 11) and SS-map-P4 probe (probe of SEQ ID NO: 12) As a result of performing real-time PCR on the methionine aminopeptidase gene which is a target gene of Barius, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
FIG. 5 shows a comparison of the primer pairs of SS-map-F5 and SS-map-R5 (primer pairs of SEQ ID NOs: 13 and 14) with the SS-map-P5 probe (probe of SEQ ID NO: As a result of performing real-time PCR on the methionine aminopeptidase gene which is a target gene of Barius, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
Fig. 6 is a graph showing the relationship between the target gene of Streptococcus subtilis and the Ssang-P1 probe (SEQ ID NO: 18) using a combination of primer pairs Ssang-F1 and Ssang-R1 (primer pairs of SEQ ID NOs: 16 and 17) As a result of performing real-time PCR on the species-specific intergenic spacer region, real-time PCR was performed using the target gene as a copy number of 10 ⁷ to 10 ¹ .
Fig. 7 is a graph showing the relationship between the target gene of Streptococcus subtilis and the target gene of Streptococcus subtilis, using a combination of primer pairs Ssang-F2 and Ssang-R2 (primer pairs of SEQ ID NOs: 19 and 20) and Ssang- As a result of performing real-time PCR on the species-specific intergenic spacer region, real-time PCR was performed using the target gene as a copy number of 10 ⁷ to 10 ¹ .
Fig. 8 is a graph showing the relationship between the target gene of Streptococcus quinicosus (SEQ ID NO: 22) and the Ssang-P3 probe (SEQ ID NO: 24) using a combination of primer pairs Ssang-F3 and Ssang- As a result of performing real-time PCR on the species-specific intergenic spacer region, real-time PCR was performed using the target gene as a copy number of 10 ⁷ to 10 ¹ .
9 is a graph showing the relationship between the target gene of the Nyseria subflaba and the NSF-P1 probe using the combination of the NSF-F1 and the NSF-R1 primer pair (the primer pairs of SEQ ID Nos. 25 and 26) As a result of performing real-time PCR on the aspartic acid semialdehyde dehydrogenase gene, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
10 is a graph showing the relationship between the target gene of the Nyseria subflaba and the NSF-P2 probe using the combination of the NSF-F2 and NSF-R2 primer pairs (primer pairs of SEQ ID NOS: 28 and 29) As a result of performing real-time PCR on the aspartic acid semialdehyde dehydrogenase gene, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
11 is a graph showing the relationship between the target gene of the Nyseria subflaba and the NSF-P3 probe using the combination of the NSF-F3 and NSF-R3 primer pairs (the primer pairs of SEQ ID NOS: 31 and 32) As a result of performing real-time PCR on the aspartic acid semialdehyde dehydrogenase gene, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
12 is a graph showing the relationship between the target gene of the Nyseria subflaba and the NSF-P4 probe using the combination of the NSF-F4 and NSF-R4 primer pairs (primer pairs of SEQ ID NOS: 34 and 35) As a result of performing real-time PCR on the aspartic acid semialdehyde dehydrogenase gene, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
Fig. 13 is a graph showing the relationship between the target gene of the Nyseria subflaba and the NSF-P5 probe using the combination of the NSF-F5 and NSF-R5 primer pairs (primer pairs of SEQ ID NOs: 37 and 38) As a result of performing real-time PCR on the aspartic acid semialdehyde dehydrogenase gene, real-time PCR was performed using the target gene concentration as a copy number of 10 ⁷ to 10 ¹ .
FIG. 14 is a graph showing a comparison between a primer pair and a probe (FAM-BHQ-1 label) for detection of Streptococcus salivarius according to an embodiment of the present invention, a combination of a primer pair and a probe (JOE-EBQ label) for detection of streptococcus- Using a real-time PCR composition including all combinations of primer pair and probes (TEXASRED-EBQ label) for detection and combination and Nisseria subsplafer detection for each of the target genes of the three species of bacteria PCR. &Lt; / RTI >
FIG. 15 is a graph showing a comparison between a primer pair and a probe (FAM-BHQ-1 label) for detection of Streptococcus salivarius according to an embodiment of the present invention, a primer pair and a probe (JOE-EBQ label) for detecting streptococcus- Using real-time PCR compositions, including both combinations and primer pairs for detection of Nyseria subplaars and a combination of probes (TEXASRED-EBQ markers), all of the target genes of the three species of bacteria were subjected to multiplex real- PCR. &Lt; / RTI >
16 is a graph showing the relationship between a combination of a primer pair and a probe (FAM-BHQ-1 label) for detection of Streptococcus salivarius in one embodiment of the present invention against 32 kinds of microorganisms including Streptococcus salivarius and Streptococcus supernatant. , A combination of a primer pair for detection of Streptococcus quinneus and a probe (JOE-EBQ label), and a combination of a primer pair and a probe (TEXASRED-EBQ label) for Nyseria subflare detection Lt; / RTI > is a graph of the results obtained by performing multiple real-time PCR using the time PCR composition.
FIG. 17 is a graph showing a comparison between a combination of a primer pair and a probe (FAM-BHQ-1 label) for detection of Streptococcus salivarius in a human saliva sample, a primer pair for detecting Streptococcus- Time PCR using a real-time PCR composition including both a combination of a primer pair (JOE-EBQ label) and a combination of a primer pair for Nyserya subplaar detection and a probe (TEXASRED-EBQ label) The obtained result is a graph.

Hereinafter, the present invention will be described in more detail based on the embodiments of the present invention. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Example

Example 1: Selection of target genes for the identification of three species of normal bacteria in the oral cavity or upper gastrointestinal tract and the design of specific primers and probes therefor

The combination of certain normal bacteria used to detect the presence of saliva in forensic specimens includes Streptococcus salivarius, Streptococcus spp., Streptococcus salivarius, Streptococcus spp. sanguinis) and Neisseria subflava were used.

For identification of the three species of bacteria, the preceding literature and the GenBank gene sequence were referred to. As a result, a methionine aminopeptidase gene was selected as a target gene for the species identification of Streptococcus salivarius, a species-specific gene spacer region was selected as a target gene for the species identification of Streptococcus quinneus, The aspartate semialdehyde dehydrogenase gene was selected as the target gene for the identification of the subflaba species. Primers and probes were designed based on homology analysis of selected target genes.

A primer that specifically amplifies the methionine aminopeptidase gene for siblings of Streptococcus salivarius with reference to the gene sequence of AY152397.1 in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) , And a fluorescently labeled probe capable of confirming the result of the amplification reaction was designed. The Tm value of the primer was designed to be around 55 캜, and the Tm value of the specific probe was set around 60 캜.

In addition, the GC content and Tm values of the base sequences selected for primer and probe design were analyzed using IDT's OligoAnalyzer 3.1 (http://sg.idtdna.com/calc/analyzer), and the selected sequence was BLAST //blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm homology.

The primers and probes (5 combinations in total) for real-time PCR for isolating Streptococcus salivarius species are shown in Table 1 below. These primers and probes were synthesized with reference to Bioneer (Daejeon, Republic of Korea). On the other hand, in the names of the following Table 1, F denotes a forward primer, R denotes a reverse primer, and P denotes a probe, and the last number denotes each combination of the primer pair and the probe.

Primers and probes for Streptococcus salivarius species identification SEQ ID NO: designation The base sequence (5 '- > 3') location Amplification product SEQ ID NO: 1 SS-map-F1 TGAACAAGCRGTWGTCGGTAAC 694-715 108 SEQ ID NO: 2 SS-map-R1 ACTCCGTGTCCAACCAAATC 801-782 SEQ ID NO: 3 SS-map-P1 AGTCGTGGTTACGGTGTTGTTCGT 758-781 SEQ ID NO: 4 SS-map-F2 GGAAGTAACACGTGAGGCTATG 661-682 106 SEQ ID NO: 5 SS-map-R2 ACCACGACTTTCAGCGTATTC 766-746 SEQ ID NO: 6 SS-map-P2 AGCRGTWGTCGGTAACCGTATCGGT 700-724 SEQ ID NO: 7 SS-map-F3 TGAGGCTATGTAYCTTGGTATTG 673-695 102 SEQ ID NO: 8 SS-map-R3 ACACCGTAACCACGACTTTC 774-755 SEQ ID NO: 9 SS-map-P3 AGCGTATTCTTGGATAGCYGCMC 754-732 SEQ ID NO: 10 SS-map-F4 GCTGACTCATGTTGGGCTTAT 602-622 115 SEQ ID NO: 11 SS-map-R4 GGTTACCGACWACYGCTTGTTC 716-695 SEQ ID NO: 12 SS-map-P4 CGATTGGAACGCCRTCTGAYGAAGT 648-624 SEQ ID NO: 13 SS-map-F5 TGTRCGTCGTCGTTGTAAAGAA 328-349 94 SEQ ID NO: 14 SS-map-R5 GCCACAGCATGTYGCATAAG 421-402 SEQ ID NO: 15 SS-map-P5 CCTTCAGATTGGWGTTGAGGGAAGA 389-364

Further, referring to the gene sequence of AY277586.1 in GenBank, a primer and a probe specific for the species-specific gene spacer region for the species identification of Streptococcus quinneis were designed in the same manner as Streptococcus salivarius, and GenBank , Primers and probes specific for the aspartic acid semialdehyde dehydrogenase gene for the identification of Nyseria subflaba were also designed in the same manner as Streptococcus salivarius.

The real-time PCR primers and probes (total of 3 combinations) for the identification of Streptococcus species upper quinine are shown in Table 2 below. Primers and probes for real-time PCR for the identification of species of Nyseria sub- 5 combinations) are shown in Table 3 below. These primers and probes were also synthesized by Biona (Daejeon, Republic of Korea). In the following tables 2 and 3, F denotes a forward primer, R denotes a reverse primer, P denotes a probe, and the last number denotes each combination of a primer pair and a probe.

Primers and probes for Streptococcus species quinne species identification SEQ ID NO: designation The base sequence (5 '- > 3') location Amplification product SEQ ID NO: 16 Ssang-F1 GGTTAATGCCGATAATGCGATG 272-294 108 SEQ ID NO: 17 Ssang-R1 CGGCTCATATCGTAAATTCCAATG 356-380 SEQ ID NO: 18 Ssang-P1 TGCCTTGGGCTATTTAGTCAGCCT 326-350 SEQ ID NO: 19 Ssang-F2 CTTTGCCTTTCATCTGCTGTC 224-242 115 SEQ ID NO: 20 Ssang-R2 GCCCAAGGCAATGCTAAAC 317-336 SEQ ID NO: 21 Ssang-P2 ACGGTTGTTGAGTGGGAGAGATTT 243-267 SEQ ID NO: 22 Ssang-F3 GGTTGTTGAGTGGGAGAGATT 245-266 138 SEQ ID NO: 23 Ssang-R3 GCCCGGCTCATATCGTAAAT 363-383 SEQ ID NO: 24 Ssang-P3 TGCCTTGGGCTATTTAGTCAGCCT 326-350

Primers and probes for identification of Nyseria subflava species SEQ ID NO: designation The base sequence (5 '- > 3') location Amplification product SEQ ID NO: 25 NSF-F1 TGATGCAGCGTATGAAAGAAGA 28-50 76 SEQ ID NO: 26 NSF-R1 CCGACATTGGAAGTGGTAAAGA 82-104 SEQ ID NO: 27 NSF-P1 AAACGACTTCGCCCACATTCCCG 50-73 SEQ ID NO: 28 NSF-F2 CCAACGATGTTGCCGAATTG 151-171 79 SEQ ID NO: 29 NSF-R2 TGGAAGACGGATTTGGTGTAAT 208-230 SEQ ID NO: 30 NSF-P2 TTATCGTTACCTGTCAGGGTGGCG 184-208 SEQ ID NO: 31 NSF-F3 CTGTCAGGGTGGCGATTAC 194-213 98 SEQ ID NO: 32 NSF-R3 TCATGCGCAGGGAAGAAG 274-292 SEQ ID NO: 33 NSF-P3 TGGAACGGCTACTGGGTTGACG 249-271 SEQ ID NO: 34 NSF-F4 AACGACTTCGCCCACATT 51-69 83 SEQ ID NO: 35 NSF-R4 GCTGCCTGACCGAAATCA 82-107 SEQ ID NO: 36 NSF-P4 TCTTTACCACTTCCAATGTCGGCGG 116-134 SEQ ID NO: 37 NSF-F5 ATTACACCAAATCCGTCTTCCA 208-230 130 SEQ ID NO: 38 NSF-R5 ATGACGTTGCGGTTGACA 320-338 SEQ ID NO: 39 NSF-P5 CCTGCGCATGAAAGATGATGCCAT 281-305

Example 2: Verification of performance of the primer and probe designed in Example 1

In order to confirm the performance of each combination of primer pairs and probes designed in Example 1, each gene reference sequence for the methionine aminopeptidase gene, the species-specific intergene spacer region, and the aspartic acid semialdehyde dehydrogenase gene ) Bioneer (Daejeon, Republic of Korea), and then diluted in TE buffer at a concentration of 10 ⁷ copies to 10 ¹ copies. The prepared synthetic genes were refrigerated until the experiment.

Using the synthetic genes prepared above, the performance of each combination of primer pairs and probes of Example 1 corresponding to each of the above-mentioned target genes was evaluated. Real-time PCR amplification experiments were performed using a PikoReal 96 real-time PCR instrument (Life Technologies, USA) for single tests (i. E., Individual target gene performance evaluation) for each of the three species of normal bacteria in the oral cavity or in the upper respiratory tract Respectively. Real-time PCR compositions such as a real-time PCR master mix were performed as shown in Table 4 below and real-time PCR was performed under the real-time PCR amplification conditions shown in Table 5 below. As a real-time PCR master mix, 2X real-time PCR master mix (manufactured by JEES Biotech, Gyeonggi-do, Korea) was used.

Real-time PCR composition Composition component Addition amount (volume) 2X Real Time PCR Master Mix 10 μL Square primer (10 [mu] M) 0.1 μL Reverse primer (10 [mu] M) 0.1 μL Specific probe (10 [mu] M) 0.05 μL DNA template (10 ⁷ to 10 ¹ copies / reaction) 1 μL Nuclease Free Water (Nuclease Free Water) 8.75 μL Sum 20 μL

Real-time PCR conditions Temperature time cycle 95 ℃ 7 minutes 1 cycle 95 ℃ 5 seconds 40 cycles 60 ° C 30 seconds Fluorescence scan FAM 25 ℃ 1 minute 1 cycle

In order to quantitatively analyze the result of real-time PCR amplification reaction, the probe is double-labeled with a fluorescent substance and a small mineral substance. In this embodiment, the probe 5 is synthesized using the synthesis service of Bioneer (Daejeon, Republic of Korea) Was labeled with a fluorescent substance, FAM (maximum absorption wavelength: 495 nm, maximum emission wavelength: 520 nm), and a small mineral BHQ-1 was labeled at the 3 'end. Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

The real-time PCR method is applied to the PCR technique using such a fluorescent substance and a small-molecule substance. It amplifies the target gene present in the sample during the reaction and detects the emission level of the fluorescent substance in real time, Thereby enabling the rapid and accurate analysis of the amplification of the target gene and its aspects. The basic principle of real-time PCR lies in the detection and quantification of fluorescence, which is performed in real time every PCR cycle by the principle of polymerase and fluorescence resonance energy transfer (FRET).

Quantification in real-time PCR is a method of measuring the amplification product in real time within the exponential phase by monitoring the progress of each cycle during PCR. In this case, important concept is Ct (threshold cycle) or Cp point. This value is the number of cycles at which the intensity of fluorescence generated by the double-labeled probe described above increases markedly beyond the baseline level, indicating the initial amount of the target gene (in the case of the present invention The copy number of the methionine aminopeptidase gene, the copy number of the species-specific intergene spacer region, and the copy number of the aspartic acid semialdehyde dehydrogenase gene). Therefore, a sample containing methionine aminopeptidase gene, species-specific gene spacer region, and aspartic acid semialdehyde dehydrogenase gene was PCR-amplified to measure the change in fluorescence intensity of the fluorescent substance over the entire PCR amplification period, After analyzing the number of PCR reactions (Cp value or Ct value) reaching the intensity and obtaining a standard curve of fluorescence intensity, a methionine aminopeptidase gene, a species-specific intergene spacer region, and an aspartic acid semialdehyde dehydrogenase gene are present And quantify the initial amount of these genes in the sample.

In this example, using the synthetic gene plasmid of each of methionine aminopeptidase gene, species-specific intergenic spacer region, and aspartic acid semialdehyde dehydrogenase gene as a DNA template, under the real time PCR amplification composition of Table 4, Real-time PCR was repeated with 5 real-time PCR amplification conditions. Each time the real-time PCR amplification reaction was repeated, the fluorescence value was measured at the FAM wavelength, and the fluorescence intensity for the reaction cycle was analyzed using PikoReal Software 2.1 (Life Technologies, USA). The results are shown in Figs.

As shown in Figs. 1 to 13, the gene of methionine aminopeptidase gene which is a target gene of Streptococcus salivarius, the species-specific gene-to-gene spacer region which is a target gene of Streptococcus supernaturalis, Each combination of primer pairs and probes of Tables 1, 2 and 3 designed to perform real-time PCR on each of the aspartic acid semialdehyde dehydrogenase genes, which are genes, effectively amplifies and amplifies each corresponding target gene The curve of fluorescence intensity for the cycle was also confirmed to be suitable for quantitative analysis and determination of the presence of each target gene. As a result of performing real-time PCR using each combination of primer pairs and probes shown in Tables 1, 2 and 3, sensitivity of 10 ⁷ copies to 10 ¹ copies / reaction was confirmed for all three target genes (However, as shown in Fig. 7, in the case of the combination of the primers of SEQ ID NOs: 19 and 20 and the probe of SEQ ID NO: 21, the sensitivity of 10 ⁷ copies to 10 ² copies / reaction was confirmed).

Thus, each combination of primer pairs and probes set forth in Table 1, Table 2, and Table 3 designed in Example 1 can be used to identify three normal bacteria used for judging the presence or absence of saliva in forensic specimens: Streptococcus salivarius, It is possible to detect the target genes for the identification of the species of Quince and Nyseria subflaba with a high sensitivity, and it was confirmed that these three species are suitable for the detection of normal bacteria and the analysis of saliva inclusion.

Example 3: Performing multiple real-time PCR for simultaneous detection of three bacteria in the oral cavity or in the upper respiratory tract

Example 3-1: Sensitivity evaluation for combination of primer pairs and probes for simultaneous detection of three species of bacteria

In this example, multiple real-time PCR conditions were established to simultaneously detect the target genes of three bacteria in the oral cavity or in the upper organ in a single reaction tube. Real-time PCR reaction was carried out in substantially the same manner as in Example 2, but the most favorable results of the real-time PCR amplification conditions for the target genes of the three species of bacteria were applied. For example, in order to simultaneously detect three bacteria in the oral cavity or in the upper organ, the combination of primer pairs and probes for detection of Streptococcus salivarius may include a combination of "SS-map-F1 and SS-map-R1 primers (Combination of primer pairs of SEQ ID NOS: 1 and 2) and SS-map-P1 probe (probe of SEQ ID NO: 3) ", combinations of primer pairs and probes for detection of streptococcal upper quinine include" Ssang- A combination of primer pairs (primer pairs of SEQ ID NOS: 16 and 17) and Ssang-P1 probes (probes of SEQ ID NO: 18) of Ssang-R1, Combination of primer pairs (primer pairs of SEQ ID NOS: 28 and 29) and NSF-P2 probe (probe of SEQ ID NO: 30) -F2 and NSF-R2 was selected and applied to the experiment.

The probe for the methionine aminopeptidase gene for the identification of Streptococcus salivarius species was labeled at the 5 'end with FAM and the minerals BHQ-1, which quenches the FAM phosphor, was labeled at the 3' end. In addition, the probe for the species-specific intergenic spacer region for the species identification of Streptococcus quinneis was labeled with JOE (maximum absorption wavelength: 520 nm, maximum emission wavelength: 548 nm) at the 5 ' The extinguishing minerals EBQ (Excellent Bioneer Quencher) [Bioneer (Daejeon, Republic of Korea)] was labeled at the 3 'end. Next, the probe for the aspartic acid semialdehyde dehydrogenase gene for the identification of the Nisseria subflaba was labeled with TEXASRED (maximum absorption wavelength: 586 nm, maximum emission wavelength: 605 nm) at the 5 'end, Mineral EBQ (Excellent Bioneer Quencher), which quenches a Texas red fluorescent substance, was labeled at the 3 'end. For reference, synthesis of oligomers, labeling of fluorescent materials and minerals were carried out using the synthesis service of Bioneer (Daejeon, Republic of Korea). Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

Since the wavelengths of the fluorescence signals detected from the target gene amplification products of the three kinds of bacteria are different from each other by the label of the probes specific to the above three kinds of bacteria, when the real time PCR is performed, The presence or absence of the target genes of the three kinds of bacteria and the presence of the saliva in the forensic examination sample can be detected at once.

The real-time PCR amplification experiment was carried out in the same manner as the real-time PCR composition of Table 4 and the real-time PCR amplification conditions of Table 5, except that a pair of primers for simultaneously detecting three kinds of bacteria in the oral cavity or the superior organs and As the combination of probes (all three combinations) was added, the amount of nuclease free water was adjusted so that the volume of the final reaction solution was 20 μL. The target genes of the three bacterial strains were added at a concentration of 10 ⁷ , 10 ⁵ , and 10 ³ copies / reaction, and the experiment was repeated four times for each concentration. Real-time PCR amplification was performed using a CFX96 real-time PCR instrument (Bio-rad, USA). A resultant graph obtained by performing individual real-time PCR on each of the target genes of the three species of bacteria is shown in Fig. As shown in Figure 14, the PCR real-time results, it was confirmed a positive value in all conditions, linearity is confirmed 0.99 hwakbodoem by quantitative high sensitivity to 10 ³ copy number region detected by the quantitative curve analysis is possible Respectively.

That is, according to this example, real-time PCR was performed on each of the target genes of the three species of bacteria using the real-time PCR composition including the combination of the three kinds of bacteria-detecting primer pairs and the probes (all three combinations) , It was confirmed that each of the target genes can be detected with high sensitivity. Thus, it was confirmed that the combination of the primer pair and the probe for detecting three kinds of bacteria according to the present invention is suitable for the detection of three bacteria and the analysis of the presence of saliva.

Example 3-2: Simultaneous detection test of three kinds of bacteria

The three kinds of positive control substances (three kinds) synthesized in order to confirm the detection range of the three kinds of bacteria by the real-time PCR amplification conditions including the combination of the three kinds of bacterium detection primer and the combination of the probes Three synthetic target genes for bacterial identification) were used to prepare a 10-fold diluted template from 10 ⁷ to 10 ² (number of copies / reaction). Experiments were carried out in substantially the same manner as in Example 2 using a template having such a concentration range.

As a result, as shown in FIG. 15, the positive values were confirmed in all the intervals. Based on this, the detection method of the present invention detects three kinds of bacteria in the oral cavity or the upper organs at high sensitivity up to 100 copies Respectively. Therefore, according to the detection method of the present invention, it can be understood that when all of the three bacteria are present in the forensic specimen, it is possible to reliably determine that the saliva is contained in the forensic specimen.

Example 4: Evaluation of the specificity of simultaneous detection of three species of bacteria

In order to evaluate the specificity of the simultaneous detection method of three kinds of bacteria as described above, 32 kinds of protozoa, bacteria, fungi, viruses (hereinafter referred to as " viruses ") purchased from a standard substance distributor (Zeptometrix (See Table 6). &Lt; tb > < TABLE > Real-time PCR experiments were carried out in substantially the same manner as in Example 2.

As a result, as shown in Fig. 16, it was confirmed that no positive reaction could be confirmed except for two kinds of positive microorganisms (Streptococcus salivarius and Streptococcus quinicus), and no cross-reaction was observed. Namely, the detection method of the present invention can detect only three kinds of microorganisms related to saliva detection without causing cross-reaction even when the microorganisms other than the three bacteria related to the saliva detection are included in the forensic sample collected at the crime scene . Therefore, even when the forensic specimen collected at a crime scene is contaminated by various microorganisms and the like, it is difficult to determine whether or not the saliva is contained in the forensic specimen, the target three kinds of bacteria are specifically detected without cross- It can be very effectively used for determining whether or not saliva is contained in the sample.

Example 5: Evaluation of applicability of simultaneous detection of oral microorganisms

Real-time PCR amplification conditions including the combination of three kinds of primer pairs for detecting bacterium as described in Examples 3-1 and 3-2 (combination of all three types) and three kinds of probes And the detection of bacteria was confirmed. Experiments were carried out in substantially the same manner as described in Examples 2 to 4 except that the template to be amplified in the real-time PCR was a mixture of the target gene and the microorganism mixed sample, (GE Healthcare Life Science, USA) 2 μL of the mixture obtained by adding 200 μL sterilized distilled water to the perforations was directly applied as a template without further extraction. As a result, as shown in Fig. 17, three kinds of bacteria, i.e., Streptococcus salivarius, Streptococcus quinneus and Nyseria subflabras, were identified in saliva samples of all volunteers.

The present invention can quickly and accurately detect the presence of three kinds of bacteria in the forensic specimen using the real-time PCR analysis, and can detect the saliva in the forensic specimen The presence or absence of inclusion can be determined more reliably.

Accordingly, the present invention provides a method for detecting the presence or absence of saliva in a forensic specimen using a real-time PCR method, by detecting the specificity and sensitivity with high accuracy, accurately and quantitatively based on the data, To improve the reliability of the results of scientific investigation and to provide clues to the reconstruction of the crime scene.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> Republic of Korea (National Forensic Service Director Ministry of Public Administration and Security) <120> Method and kit for detecting that human saliva is present in a forensic sample using real-time PCR <130> P15-0017KR <160> 39 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SS-map-F1 primer <400> 1 tgaacaagcr gtwgtcggta ac 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SS-map-R1 primer <400> 2 actccgtgtc caaccaaatc 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SS-map-P1 probe <400> 3 agtcgtggtt acggtgttgt tcgt 24 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SS-map-F2 primer <400> 4 ggaagtaaca cgtgaggcta tg 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SS-map-R2 primer <400> 5 accacgactt tcagcgtatt c 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SS-map-P2 probe <400> 6 agcrgtwgtc ggtaaccgta tcggt 25 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SS-map-F3 primer <400> 7 tgaggctatg taycttggta ttg 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SS-map-R3 primer <400> 8 acaccgtaac cacgactttc 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SS-map-P3 probe <400> 9 agcgtattct tggatagcyg cmc 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SS-map-F4 primer <400> 10 gctgactcat gttgggctta t 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SS-map-R4 primer <400> 11 ggttaccgac wacygcttgt tc 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SS-map-P4 probe <400> 12 cgattggaac gccrtctgay gaagt 25 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SS-map-F5 primer <400> 13 tgtrcgtcgt cgttgtaaag aa 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SS-map-R5 primer <400> 14 gccacagcat gtygcataag 20 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SS-map-P5 probe <400> 15 ccttcagatt ggwgttgagg gaagya 26 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ssang-F1 primer <400> 16 ggttaatgcc gataatgcga tg 22 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ssang-R1 primer <400> 17 cggctcatat cgtaaattcc aatg 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ssang-P1 probe <400> 18 tgccttgggc tatttagtca gcct 24 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ssang-F2 primer <400> 19 ctttgccttt catctgctgt c 21 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ssang-R2 primer <400> 20 gcccaaggca atgctaaac 19 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ssang-P2 probe <400> 21 acggttgttg agtgggagag attt 24 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ssang-F3 primer <400> 22 ggttgttgag tgggagagat t 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ssang-R3 primer <400> 23 gcccggctca tatcgtaaat 20 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ssang-P3 probe <400> 24 tgccttgggc tatttagtca gcct 24 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NSF-F1 primer <400> 25 tgatgcagcg tatgaaagaa ga 22 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NSF-R1 primer <400> 26 ccgacattgg aagtggtaaa ga 22 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NSF-P1 probe <400> 27 aaacgacttc gcccacattc ccg 23 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NSF-F2 primer <400> 28 ccaacgatgt tgccgaattg 20 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NSF-R2 primer <400> 29 tggaagacgg atttggtgta at 22 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NSF-P2 probe <400> 30 ttatcgttac ctgtcagggt ggcg 24 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NSF-F3 primer <400> 31 ctgtcagggt ggcgattac 19 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NSF-R3 primer <400> 32 tcatgcgcag ggaagaag 18 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NSF-P3 probe <400> 33 tggaacggct actgggttga cg 22 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NSF-F4 primer <400> 34 aacgacttcg cccacatt 18 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NSF-R4 primer <400> 35 gctgcctgac cgaaatca 18 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> NSF-P4 probe <400> 36 tctttaccac ttccaatgtc ggcgg 25 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NSF-F5 primer <400> 37 attacaccaa atccgtcttc ca 22 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NSF-R5 primer <400> 38 atgacgttgc ggttgaca 18 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NSF-P5 probe <400> 39 cctgcgcatg aaagatgatg ccat 24

Claims

Preparing a gene sample from a specimen,
Using the prepared gene sample as a template, primer pairs of SEQ ID NOS: 1 and 2, which specifically amplify the methionine aminopeptidase gene, which is a target gene for the identification of Streptococcus salivarius, At least one pair of primers of SEQ ID NOS: 4 and 5, a pair of primers of SEQ ID NOS: 7 and 8, a pair of primers of SEQ ID NOS: 10 and 11, and a pair of primers of SEQ ID NOS: 13 and 14 and a pair of primers of Streptococcus a pair of primers of SEQ ID NOS: 16 and 17, a pair of primers of SEQ ID NOS: 19 and 20, specifically amplifying a species-specific intergenic spacer region, which is a target gene for saddle- And at least one primer pair of the primer pairs of SEQ ID NOS: 22 and 23, and a pair of primers of Neisseria subflava a pair of primers of SEQ ID NOS: 25 and 26, a pair of primers of SEQ ID NOS: 28 and 29, and a pair of primers of SEQ ID NO: 31 and 31, respectively, which specifically amplify the aspartate-semialdehyde dehydrogenase gene, And primer pairs of SEQ ID NOS: 34 and 35 and at least one primer pair of primer pairs of SEQ ID NOS: 37 and 38 are used to amplify the methionine aminopeptidase gene, the species-specific Amplifying the aspartic acid semialdehyde dehydrogenase gene by a real-time PCR;
Time PCR results after amplification of the methionine aminopeptidase gene, the species-specific intergenic spacer region, and the aspartic acid semialdehyde dehydrogenase gene to determine the presence of Streptococcus salivarius, Streptococcus superquinis, and age Determining whether a combination of three species of ceria subsplafer is present,
And determining whether or not a saliva is contained in the specimen in accordance with the presence or absence of a combination of the three kinds of bacteria in the specimen.

The method according to claim 1,
Detecting a real-time PCR amplification product of the target genes, and using a labeling substance indicating the amplification amount of the target genes.

3. The method of claim 2,
A positive standard, which is a gene sample known to be known in advance of amplification, of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the copy number of the aspartic acid semialdehyde dehydrogenase gene, is mixed with the methionine aminopeptidase gene, A primer pair corresponding to the target gene spacer region and the aspartic acid semialdehyde dehydrogenase gene, and a primer pair corresponding to the methionine aminopeptidase gene, the species-specific gene spacer region and the aspartic acid semialdehyde dehydrogenase gene Amplifying the amplified product by real-time PCR using a labeling substance indicating the amount of gene amplification,
Measuring a change in signal intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant signal intensity;
Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in signal intensity of the labeling substance;
The change in the signal intensity of the marker substance with respect to the entire PCR amplification period of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene present in the gene sample of the specimen is measured Analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant signal intensity,
The Cp value or Ct value obtained by PCR amplification of each of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene present in the gene sample of the specimen is used as the copy number of the positive standard And detecting quantitatively the presence or absence of saliva in the specimen by real-time PCR.

The method according to claim 2 or 3,
The labeling substance may be,
The probes specifically binding to the methionine aminopeptidase gene include oligonucleotides of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12 and SEQ ID NO: 15 and oligonucleotides complementary to these oligonucleotides One end of at least one probe selected from the group consisting of:
A probe that specifically binds to the species-specific intergenic spacer region includes at least one of oligonucleotides of SEQ ID NO: 18, SEQ ID NO: 21 and SEQ ID NO: 24 and oligonucleotides complementary to these oligonucleotides One end of one probe,
The probes specifically binding to the aspartic acid semialdehyde dehydrogenase gene include oligonucleotides of SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36 and SEQ ID NO: 39 and oligonucleotides complementary to these oligonucleotides And detecting the presence or absence of saliva in a forensic specimen using real-time PCR, wherein the at least one probe is labeled at one end of the probe.

5. The method of claim 4,
A method for detecting the presence or absence of saliva in a forensic specimen using real-time PCR, wherein three probes labeled with a labeling substance detectable at different wavelengths are simultaneously used.

6. The method of claim 5,
Using the three probes labeled with the labeling substance detectable at different wavelengths, the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene are detected in one test tube And detecting the presence or absence of saliva in a forensic specimen using real-time PCR.

The method according to claim 2 or 3,
Wherein the labeling substance is a fluorescent substance and the intensity of fluorescence from the labeling substance is measured to calculate the amplification amount of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene A method for detecting presence or absence of saliva in a forensic specimen using real-time PCR.

A pair of primers of SEQ ID NOS: 1 and 2, a pair of primers of SEQ ID NOS: 4 and 5, a primer pair of SEQ ID NOS: 4 and 5, which specifically amplify methionine aminopeptidase gene which is a target gene for siblings of Streptococcus salivarius, 7, and 8, a pair of primers of SEQ ID NOS: 10 and 11, and a pair of primers of at least one of the primer pairs of SEQ ID NOS: 13 and 14, and a primer pair of a primer pair of Streptococcus sanguinis A pair of primers of SEQ ID NOs: 16 and 17, a pair of primers of SEQ ID NOs: 19 and 20, and a pair of primers of SEQ ID NOs: 22 and 23, which specifically amplify the species-specific intergenic spacer region, At least one primer pair and aspartate, a target gene for sibling of Neisseria subflava, The primer pair of SEQ ID Nos. 25 and 26, the pair of primers of SEQ ID Nos. 28 and 29, the pair of primers of SEQ ID Nos. 31 and 32, the primer pair of SEQ ID Nos. 34 and 35 which specifically amplify the aspartate-semialdehyde dehydrogenase gene Time PCR amplification kit for detecting the presence or absence of saliva in a forensic specimen, comprising a pair of primers and at least one primer pair of primer pairs of SEQ ID NOS: 37 and 38, and DNA polymerase, dNTPs and PCR buffer solution.

9. The method of claim 8,
Further comprising a labeling substance detecting a real-time PCR amplification product of the target genes and indicating amplification amount of the target genes,
The probes specifically binding to the methionine aminopeptidase gene include oligonucleotides of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12 and SEQ ID NO: 15 and oligonucleotides complementary to these oligonucleotides One end of at least one probe selected from the group consisting of:
A probe that specifically binds to the species-specific intergenic spacer region includes at least one of oligonucleotides of SEQ ID NO: 18, SEQ ID NO: 21 and SEQ ID NO: 24 and oligonucleotides complementary to these oligonucleotides One end of one probe,
The probes specifically binding to the aspartic acid semialdehyde dehydrogenase gene include oligonucleotides of SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36 and SEQ ID NO: 39 and oligonucleotides complementary to these oligonucleotides Wherein the probe is labeled at one end of at least one probe selected from the group consisting of: < RTI ID = 0.0 > SEQ ID < / RTI >

10. The method of claim 9,
A real-time PCR amplification kit for detecting the presence or absence of saliva in a forensic specimen, which comprises three probes labeled with a labeling substance detectable at different wavelengths.

11. The method according to claim 9 or 10,
Wherein the labeling substance is a fluorescent substance and the intensity of fluorescence from the labeling substance is measured to calculate the amplification amount of the methionine aminopeptidase gene, the species-specific intergenic spacer region and the aspartic acid semialdehyde dehydrogenase gene A real-time PCR amplification kit for detecting the presence or absence of saliva in a specimen.