KR101739749B1

KR101739749B1 - Method and kit for diagnosing vaginitis using real-time PCR

Info

Publication number: KR101739749B1
Application number: KR1020150164791A
Authority: KR
Inventors: 윤현규
Original assignee: 윤현규
Priority date: 2015-11-24
Filing date: 2015-11-24
Publication date: 2017-05-25

Abstract

The present invention relates to a method for detecting vaginitis-causing microorganisms such as guinea nelavaginalis and Candida albicans with high specificity and sensitivity using real-time PCR and detecting the cross-reactivity with vancomycin Lactobacillus crispa sp. And a method for quantitatively analyzing the vaginitis test kit. According to the present invention, it is possible to detect vaginitis-causing microorganisms, such as guineanella vaginalis and Candida albicans, from clinical specimens using real-time PCR, with high specificity and sensitivity based on swift, accurate and quantitative data, Lactobacillus crispa sp. Strains can be assayed quantitatively without cross-reactivity with other microbial species in the vagina.

Description

Technical Field [0001] The present invention relates to a method and kit for detecting vaginitis using real-time PCR,

The present invention relates to kits and methods for vaginitis testing using real-time PCR (real-time polymerase chain reaction). More particularly, the present invention relates to a kit for vaginal examination using real-time PCR The present invention relates to kits and methods for rapidly and accurately examining vaginitis by providing simple, low-cost, and accurate quantitative values of microorganism species.

Specifically, the present invention relates to the use of real-time PCR from clinical specimens to detect vaginitis-causing microorganisms, Gardnerella vaginalis and Candida albicans, rapidly, accurately and quantitatively based on data, And a method and a kit for vaginitis test which can quantitatively analyze Lactobacillus crispatus, which is an indigenous bacterium which can be detected with high sensitivity, without cross-reaction with other microorganism species in the vagina. will be.

The present invention also provides a method for detecting the exact vaginal abundance of vaginal infecting microorganisms and vaginal infecting microorganisms as described above by using real-time PCR from clinical specimens with high specificity and sensitivity, The present invention relates to a technique for rapidly and accurately inspecting vaginitis at a low cost by judging quantitatively and precisely that vaginal infecting microorganisms are increased and vaginal infectious bacteria are reduced as described above.

The lactic acid bacteria microorganism is an indigenous bacterium that resides in the vagina of a woman and plays an important role in maintaining the normal environment of the female genitalia. In the case of healthy women, the abstinence of other opportunistic infections and the infections caused by them are suppressed by continuously producing abortion and maintaining the vagina in an acidic (pH 4.5 to 5.5) environment.

However, due to various causes, vaginal lactobacillus is decreased, pH in the vagina is increased, and various opportunistic infectious bacteria are propagated, causing vaginitis. This phenomenon may be caused by age, stress, hormonal imbalance, menstruation, and the establishment of opportunistic infections due to sexual intercourse. Although vaginitis is a common disease that many women experience, there is a risk of increased risk of pelvic inflammation due to vaginitis after long periods of stay, and increased infection after surgery. Especially in pregnant women, premature rupture of membranes, premature labor, endometritis Can cause a variety of complications.

The major vaginal yeast-inducing microorganisms are Gardnerella vaginalis and Candida albicans, as well as prevotella spp., Anaerobic gram-positive cocci, Mobiluncus spp., Ureaplasma urealyticum, Mycoplasma hominis, and the like. That is, microorganisms causing vaginitis are various and can cause inflammation by existence of one kind or several kinds of microorganisms.

Gram staining has been used in general for the diagnosis of vaginitis, but recent vaginal tests can be easily and quickly diagnosed by introducing non-culture based methods. For example, there is a method of detecting a yeast-causing microorganism by using a PCR (polymerase chain reaction) technique. In the conventional PCR test method, a variety of sexually transmitted diseases related microorganisms as described above are tested by a multiplex method, It is not a method to inspect only vaginitis, it is costly, and it takes about 3 to 5 days to receive test results.

As an alternative to the conventional PCR method, a method of diagnosing vaginitis by detecting the presence of vaginosis-causing microorganisms and vaginal germs by semi-quantitative multiplex PCR has been proposed. However, There is a high possibility of occurrence of error in the result. In other words, diagnosis of vaginitis only by the presence of vaginitis-causing microorganisms is likely to be a diagnostic error. Even if vaginitis is present, vaginal vaginal bacteria may exist. Therefore, the presence of vaginitis- It was not easy and there was a problem of diagnosis error.

In addition, there has been a study of the negative association of Lactobacillus iners with Lactobacillus gasseri and Atopobium vaginae using real-time PCR, Species specific primers can cross-react with other microbial species frequently, and primer dimers may occur depending on the state of the specimen, which has limitations in accurate quantitative measurement.

Therefore, in the technical field of the present invention, it is necessary to provide a simple, low-cost, quick and accurate method for inspecting vaginitis.

Korean Registered Patent No. 10-0819634 (Apr. 4, 2008) Korean Patent Publication No. 10-2013-0142675 (December 30, 2013) Korean Registered Patent No. 10-1528433 (June 20, 2015)

The present invention provides a quantitative value of accurate microorganism species in vivo by using real-time PCR (real-time polymerase chain reaction) without cross-reaction between the vaginosis-causing microorganism to be detected and other microorganism species other than intravaginal And to provide a kit and method for inspecting vaginitis quickly and accurately at a low cost.

Specifically, the present invention relates to the use of real-time PCR from clinical specimens to detect vaginitis-causing microorganisms, Gardnerella vaginalis and Candida albicans, rapidly, accurately and quantitatively based on data, The present invention provides a vaginitis test kit and method capable of quantitatively analyzing Lactobacillus crispatus, which is highly susceptible to vaginal staple bacteria, without cross-reaction with other microorganism species in the vagina It has its purpose.

The present invention also provides a method for detecting the exact vaginal abundance of vaginal infecting microorganisms and vaginal infecting microorganisms as described above by using real-time PCR from clinical specimens with high specificity and sensitivity, It is an object of the present invention to provide a technique capable of quickly and accurately inspecting vaginitis at a low cost by quantitatively and accurately judging that vaginal infecting microorganisms increase and vaginal infectious bacteria decrease as described above.

As a result of intensive studies in order to solve the technical problem of the invention described above, the present inventors have found that, using real-time PCR, the present inventors have found that typical yeast-causing microorganisms such as Gardnerella vaginalis and Candida We have come up with a method of detecting vaginitis by detecting specificity and sensitivity of Candida albicans and quantitatively analyzing the vaginal lactobacillus Lactobacillus crispatus without any cross reactivity with other microorganism species in the vagina.

That is, the present invention provides a technique for quantifying accurate microorganism species in the vagina using real-time PCR, and it is an object of the present invention to provide a method of detecting vaginitis-induced microorganisms and vaginal epithelial bacteria by detecting specific vaginalities and sensitivities, The present invention provides a technique for rapidly and accurately inspecting vaginitis easily and inexpensively by quantitatively and accurately judging that the vaginal infant microorganism as described above increases and vaginal infectious microorganisms as described above are reduced as described above.

As used herein, the term " vaginal yeast-inducing microorganism "refers not only to bacteria but also to fungi including fungi, viruses and the like. As used herein, the term "sample" is intended to encompass a sample containing a vaginal yeast-inducing microorganism and / or vaginal supernatant or a gene thereof, which is safe without causing any harm to the human body, Vaginal secretions collected with tools that are not harmful at all, vaginal wall extracts, vaginal secretions collected using specimen tools, such as swabs, vaginal epithelium, and the like.

As used herein, the term "gene sample" is used as a broad concept including RNA, DNA, cDNA generated from RNA by a reverse transcriptase, DNA or cDNA amplified through pre-PCR (preliminary PCR) .

As used herein, the term "real-time PCR" refers to the application of a fluorescent material to a PCR technique, in which the amplification of a target gene existing in a specimen during the reaction, It is a method that can quickly and accurately analyze the presence or absence of amplification of a target gene and its pattern by real-time detection and quantitative analysis. This real-time PCR is divided into two methods, one using SYBR Green and the other using double-labeled probes.

The SYBR green technique combines the SYBR green dye into the DNA amplified during real-time PCR amplification and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescent signal. The fluorescent signal is detected, It is a method that can measure the presence and the amount of amplification product from it. The real-time PCR technique using a dual labeled probe is a method using a double-labeled probe in which a fluorescent substance is labeled at the 5 'end and a quencher is labeled at the 3' end, Through the fluorescence signal from the labeled probe, it is possible to confirm whether or not the double-labeled probe is annealed with the PCR amplification product of the target gene, and the presence or absence of the target gene and the amount of the amplification product generated therefrom can be measured. It goes without saying that real-time PCR known in the art such as a TaqMan probe method and the like are applicable in the present invention.

The present invention relates to a primer pair for real-time PCR amplification, which is used in a vaginitis test method using real-time PCR, and is characterized in that the target gene cpn60 (60 kDa chaperonin) for the detection of the vaginosis-causing microorganism Gardnerella vaginalis 1 and 2 and at least one primer pair of the primer pairs of SEQ ID NOS: 4 and 5 and a primer pair of ITS (target gene for detection of Candida albicans), which is a vaginosis-causing microorganism, 7 and 8, which specifically amplify the internal transcribed spacer gene, and a pair of primer pairs, slpA (surface layer), which is a target gene for the detection of Lactobacillus crispatus, the primer pair of SEQ ID NOS: 10 and 11, the primer pair of SEQ ID NOS: 13 and 14, the primer pair of SEQ ID NOS: 16 and 17, , A primer pair of SEQ ID NOs: 19 and 20, a pair of primers of SEQ ID NOs: 22 and 23, a pair of primers of SEQ ID NOs: 25 and 26, and a pair of primers of at least one pair of primers of SEQ ID NOs: 28 and 29, And a primer set for vaginal suppository bases target gene amplification.

In addition, the present invention relates to oligonucleotides of SEQ ID NO: 3 and SEQ ID NO: 6 as specific probes for the gene for cpn60 (60 kDa chaperonin) which is a target gene for detection of Gardnerella vaginalis, a yeast-causing microorganism, At least one probe selected from the group consisting of oligonucleotides complementary to oligonucleotides, and a probe specific for an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans as a vaginosis-causing microorganism At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 9 and an oligonucleotide complementary to the oligonucleotide, and a slpA (surface layer) target gene for the detection of Lactobacillus crispatus, protein A) gene-specific probe An oligonucleotide selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27 and SEQ ID NO: 30 and oligonucleotides complementary to these oligonucleotides A probe composition for vaginitis testing comprising one probe is provided.

In addition, the vaginitis test kit using the real-time PCR of one embodiment of the present invention,

1 and 2, which specifically amplify the gene for cpn60 (60 kDa chaperonin), which is a target gene for the detection of Gardnerella vaginalis, a yeast-causing microorganism, and primers of SEQ ID NOS: 4 and 5 At least one pair of primers,

A pair of primers of SEQ ID NOS: 7 and 8 for specifically amplifying an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans, a yeast-causing microorganism,

The primer pair of SEQ ID NOS: 10 and 11, the pair of primers of SEQ ID NOS: 13 and 14, which specifically amplify the slpA (surface layer protein A) gene, which is a target gene for detection of vaginal intracellular Lactobacillus crispatus, A primer pair of SEQ ID NOs: 16 and 17, a pair of primers of SEQ ID NOs: 19 and 20, a pair of primers of SEQ ID NOs: 22 and 23, a pair of primers of SEQ ID NOs: 25 and 26, and a pair of primers of SEQ ID NOs: 28 and 29 A pair of primers,

The probes specifically binding to the amplification product of the cpn60 (60 kDa chaperonin) gene, which is a target gene for the detection of Gardnerella vaginalis, a yeast-causing microorganism, include oligonucleotides of SEQ ID NOS: 3 and 6 At least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides,

A probe specifically binding to an amplified product of an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans, a yeast-causing microorganism, and an oligonucleotide complementary to the oligonucleotide of SEQ ID NO: At least one probe selected from the group consisting of:

SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 18, and SEQ ID NO: 18, which specifically bind to an amplification product of a slpA (surface layer protein A) gene, which is a target gene for detection of vaginal staple bacteria, Lactobacillus crispatus. SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27 and SEQ ID NO: 30 and oligonucleotides complementary to such oligonucleotides.

The vaginitis test kit using real-time PCR in one embodiment of the present invention further comprises DNA polymerase, dNTPs, PCR buffer solution, and labeling substance of PCR amplification product.

In a vaginitis test kit using a real-time PCR according to an embodiment of the present invention, the labeling substance may comprise a probe that specifically binds to the amplification product of the cpn60 gene and a probe that specifically binds to the amplification product of the ITS gene Can be labeled at one end of a probe that binds and at one end of the probe that specifically binds to the amplification product of the slpA gene, for example, at the 5 'end.

In this regard, a probe specifically binding to the amplification product of the cpn60 gene, a probe specifically binding to the amplification product of the ITS gene, and a probe specifically binding to the amplification product of the slpA gene, The above probes are preferably labeled with a labeling substance that can be detected at different wavelengths. When two or more probes among the above-mentioned probes are labeled with a labeling substance capable of detecting at different wavelengths, the vaginitis-causing microorganisms and / or vaginal infecting microorganisms associated with vaginitis are detected at one time in one test tube There is an advantage to be able to do.

In a vaginitis test kit using real-time PCR according to an embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeled substance is measured to determine the amplification amount of the cpn60 gene, the amplification amount of the ITS gene, The amplification amount of the gene can be calculated.

A method for testing vaginitis using real-time PCR in an embodiment of the present invention includes:

Preparing a gene sample from a specimen,

Using the prepared gene sample as a template and using a vaginitis test kit using real-time PCR as described above, the cpn60 gene, which is a target gene for detection of the guard neenalazine nitrile, the target for detection of the Candida albicans Amplifying a slpA gene, which is a target gene for detection of the Lactobacillus crispa sp., By real-time PCR;

After the amplification of the target gene, real-time PCR results were confirmed, and the presence or absence and presence of Gardnerella vaginalis and Candida albicans in the specimen and the presence and amount of Lactobacillus crispa sp. Quantitatively measuring,

Determining the presence or absence of vaginitis based on the presence and abundance of the quantitatively measured Gardnerella vaginalis and Candida albicans and the presence and amount of Lactobacillus crisparis.

In the method for testing vaginitis using real-time PCR according to an embodiment of the present invention, in the presence of vaginitis, the amount of vaginosis-causing microorganisms, such as guinea nelavaginalis and Candida albicans, is increased and the amount of Lactobacillus crisparis Is reduced.

A primer pair that amplifies the cpn60 gene, the ITS gene, and the slpA gene, and a primer pair that amplifies the cpn60 gene, the ITS gene, and the slpA gene, Amplifying the ITS gene and the slpA gene using real-time PCR using a labeling substance indicating amplification amount of the gene in association with the ITS gene and the slpA gene;

Measuring a change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;

Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in fluorescence intensity of the labeling substance;

The change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of each of the cpn60 gene, the ITS gene and the slpA gene in the gene sample of the specimen is measured, and the PCR reaction count Cp Value or a Ct value)

A Cp value or a Ct value obtained by PCR amplification of each of the cpn60 gene, the ITS gene and the slpA gene present in the gene sample of the specimen is made to correspond to the copy number of the positive standard, And Candida albicans, and the presence and amount of Lactobacillus crispa sp. In the specimen.

In the vaginitis screening method using real-time PCR according to an embodiment of the present invention, the labeling substance is a probe that specifically binds to an amplification product of the cpn60 gene and a probe that specifically binds to the amplification product of the ITS gene Can be labeled at one end of a probe that binds and at one end of the probe that specifically binds to the amplification product of the slpA gene, for example, at the 5 'end.

In the vaginal examination method using real-time PCR according to an embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeled substance is measured to determine the amplification amount of the cpn60 gene, the amplification amount of the ITS gene, The amplification amount of the gene can be calculated.

In the present invention, one end of the probe, for example, the 5 'terminus is Cy5, Cy3, x-rhodamine, Texas red, SYBR green, FAM, VIC, JOE, NED, HEX, TET and TAMRA Such as IABkFQ, DABCYL, BHQ (BHQ-1, BHQ-2, etc.), EBQ, ZEN-IBFQ, etc. The other end of the probe, for example, . However, it should be understood that the present invention is not limited thereto, and a variety of fluorescent materials and minerals known in the art can be used.

According to the present invention, there is no cross-reaction between the vaginosis-causing microorganisms to be detected and other microorganism species other than the vaginal epithelial bacteria using real-time PCR (real-time PCR) and the accurate quantification of microorganism species in the vagina is provided This makes it possible to inspect vaginitis quickly and accurately at low cost and in a simple manner.

Specifically, the present invention relates to the use of real-time PCR from clinical specimens to detect vaginitis-causing microorganisms, Gardnerella vaginalis and Candida albicans, rapidly, accurately and quantitatively based on data, And sensitivity can be detected, and it is possible to quantitatively analyze Lactobacillus crispatus, which is an indigenous bacterium, without crossing reaction with other microorganism species in the vagina.

The present invention also provides a method for detecting the exact vaginal abundance of vaginal infecting microorganisms and vaginal infecting microorganisms as described above by using real-time PCR from clinical specimens with high specificity and sensitivity, The vaginitis-induced microorganisms are increased, and vice versa, as described above, is quantitatively and precisely judged to be reduced, so that vaginitis can be quickly, accurately and simply tested at low cost.

FIG. 1 is a graph showing the results obtained by performing real-time PCR on the genomic DNA of a standard microorganism strain using a primer pair and a probe of an embodiment of the present invention for detecting Lactobacillus crispa sp. , The genomic DNA of the other strains used in the specificity experiment is not cross-reacted, and only Lactobacillus crispus is detected.
FIG. 2 is a graph showing the results of real-time PCR on clinical specimens using a pair of primers and a probe of the present invention, which detects the specificity and sensitivity of Gardnerella vaginalis as a vaginosis-causing microorganism, The specimen indicates that it is positive for Gardnerella vaginalis.
FIG. 3 is a graph showing the results obtained by performing real-time PCR on clinical samples using primer pairs and probes according to an embodiment of the present invention which detect Candida albicans as a vaginosis-causing microorganism with high specificity and sensitivity, Indicating that they are albumin-positive.

Hereinafter, the present invention will be described in more detail based on the embodiments of the present invention. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Example 1: Design of primers and probes for real-time PCR for the detection of yeast-causing microorganisms

Target genes capable of detecting the specificity and sensitivity of Gardnerella vaginalis and Candida albicans, which are yeast-causing microorganisms, were selected based on the prior art and GenBank gene sequence. As a target gene capable of specifically detecting these yeast-causing microorganisms, Gardnerella vaginalis was selected as a target gene of cpn60 (60 kDa chaperonin), and Candida albicans was selected as a target gene for ITS (Internal Transcribed Spacer) Gene.

A primer that specifically amplifies the target gene of Gardnerella vaginalis through sequence homology analysis with reference to the sequence of GenBank AY123673.1 and a primer that specifically identifies the result of the amplification reaction The probe was designed. In addition, through a sequence homology analysis referring to the sequence of GenBank KT876577.1, a primer that specifically amplifies a target gene of Candida albicans, and a probe that can specifically identify the result of amplification reaction Respectively.

The positional information of each primer and probe was confirmed with reference to the standard nucleotide sequence (the sequence of AY123673.1 and the sequence of KT876577.1), and the% GC and Tm values were obtained from INTEGRATED DNA TECHNOLOGIES (USA, Iowa) (OligoAnalyzer 3.1) web-based program. Real-time PCR primers and probes specific for the cpn60 (60 kDa chaperonin) gene for the detection of guinea nelavaginalis, and real-time PCR specific for ITS (internal transcribed spacer) gene for the detection of Candida albicans The primers and probes were as shown in Table 1 below. These primers and probes were synthesized by Bioneer (Daejeon, Republic of Korea). On the other hand, in the names of the following Table 1, F denotes a forward primer, R denotes a reverse primer, and P denotes a probe, and the last number denotes each combination of the primer pair and the probe.

A combination of primer pairs and probes specific to the yeast-causing microorganisms, Guard Nenavaginalis and Candida albicans, respectively SEQ ID NO: designation The base sequence (5 '- > 3') Tm (占 폚) location Amplification product SEQ ID NO: 1 GV-Cpn60-F1 ATCGCTCTTCGTCGCGGA 59.2 67-84 120 SEQ ID NO: 2 GV-Cpn60-R1 TGCTGCAGAAATAGTTGCAGTAGCT 58.8 162-186 SEQ ID NO: 3 GV-Cpn60-P1 AGCAATTGTTAAGGAACTTCTCGCATCTGCTA 61.2 102-133 SEQ ID NO: 4 GV-Cpn60-F2 CGCATCTGCTAAGGATGTTG 53.8 123-142 91 SEQ ID NO: 5 GV-Cpn60-R2 CAGCAATCTTTTCGCCAACT 54 214-195 SEQ ID NO: 6 GV-Cpn60-P2 TGCAACTATTTCTGCAGCAGATCC 57.6 168-191 SEQ ID NO: 7 CA-ITS-F TCGCTTTGACAATGGCTTAGGTCTAAC 58.9 360-386 89 SEQ ID NO: 8 CA-ITS-R GATTTGAGGTCAAAGTTTGAAGATATACG 54.4 448-420 SEQ ID NO: 9 CA-ITS-P ACATTGYTTGCGGCGGTAACGTCCA 64.3 392-416

Example 2: Design of primers and probes for real-time PCR for detection of vaginal stains

Target genes capable of detecting the specificity and sensitivity of Lactobacillus crispatus, a vaginal endosperm bacterium, were selected based on the prior art and the GenBank gene sequence. The surface layer protein A (slpA) gene was selected as a target gene sequence capable of specifically detecting Lactobacillus crispa sp.

A primer that specifically amplifies the target gene of Lactobacillus crispospus through sequence homology analysis referring to the sequence of GenBank HQ716719 in the same manner as described in Example 1 and a fluorescent label which can specifically identify the amplification reaction product The probe was designed. The real-time PCR primers and probes specific for the slpA (surface layer protein A) gene for detection of Lactobacillus crispus are shown in Table 2 below. These primers and probes are available from Bioneer Inc. (Daejeon, Republic of Korea) And synthesized. On the other hand, in the following Table 2, F denotes a forward primer, R denotes a reverse primer, P denotes a probe, and the last number denotes each combination of primer pair and probe.

A combination of primer pairs and probes specific for Lactobacillus crispa sp. SEQ ID NO: designation The base sequence (5 '- > 3') Tm (占 폚) location Amplification product SEQ ID NO: 10 LC-F1 ATGAAGAAAAATTTAAGAATTGT 45.2 1-23 64 SEQ ID NO: 11 LC-R1 CRACAGGAGCAACAGCT 53.9 64-48 SEQ ID NO: 12 LC-P1 AGCGCTGCTGCTGCTGCT 638 25-42 SEQ ID NO: 13 LC-F2 CTTACACATTCAAGAACG 45.5 1241-1258 73 SEQ ID NO: 14 LC-R2 GAAGCCTTTACGTAAGTCT 49.1 1313-1295 SEQ ID NO: 15 LC-P2 AGCAATACTACAAGATCGGTAACAACAC 56.9 1262-1289 SEQ ID NO: 16 LC-F3 TCGTTGCACCTAAGTCATTCA 54.2 821-842 102 SEQ ID NO: 17 LC-R3 CCTTGCCGTTTGGTACATTAAC 54.4 923-901 SEQ ID NO: 18 LC-P3 CTGCTAACAACAACGATGCTTCACGC 60.6 860-886 SEQ ID NO: 19 LC-F4 AAAGGCTGCTGGTGTTGA 54.8 786-804 99 SEQ ID NO: 20 LC-R4 CGTGAAGCATCGTTGTTGTTAG 54.5 885-863 SEQ ID NO: 21 LC-P4 TGGTTCGTTGCACCTAAGTCATTCACT 60.2 817-844 SEQ ID NO: 22 LC-F5 TCACGCACTTTAGCTGTAACT 54.1 880-901 112 SEQ ID NO: 23 LC-R5 GCTTAGCGTTCTTGTCGTAGTA 54.4 992-970 SEQ ID NO: 24 LC-P5 ACGGCAAGGACATGACTGTACCAA 60.5 914-938 SEQ ID NO: 25 LC-F6 GTTAATGTACCAAACGGCAAGG 54.4 901-923 106 SEQ ID NO: 26 LC-R6 TGTCAGTACCAACACGCTTAG 54.6 1007-986 SEQ ID NO: 27 LC-P6 TGACTGTACCAAGCCAAAGCAAGACT 60.4 926-952 SEQ ID NO: 28 LC-F7 GAGTTGTTTGCAGGTTCAGATG 54.4 637-659 86 SEQ ID NO: 29 LC-R7 TAGTTGCTTGCGTGGTACTT 54.3 723-703 SEQ ID NO: 30 LC-P7 ACGTTGCTCAAGTTGTTTCAGCTGC 60.5 671-696

Example 3: Real-time PCR using a genomic DNA of a standard microorganism strain

Genomic DNA was extracted from a standard microorganism strain distributed in a microorganism resource center (Daejeon, Republic of Korea) in order to evaluate the specificity of primers and probes for real-time PCR designed in the above-mentioned examples. As a template. The standard microorganism strain information used in the specificity experiment of this example is shown in Table 3 below.

Standard microbial strain information used in specificity experiments Strain number Strain name Strain number Strain name 15240 Atofovium pants
(Atopobium vaginae) 1508 Bacillus Turinjiensis
(Bacillus thuringiensis) 3515 Lactobacillus trousers
(Lactobacillus vaginalis) 5194 Lactobacillus janseni
(Lactobacillus jensenii) 5054 Lactobacillus crispatus
(Lactobacillus crispatus) 3178 Lactobacillus crispatus
(Lactobacillus crispatus) 2510 Protess Mirabellis
(Proteus mirabilis) 3173 Lactobacillus gasseri
(Lactobacillus gasseri)

Genomic DNA extraction of the standard microorganism strain shown in Table 3 was carried out using a WizPrep gDNA Mini Kit from Wiz Bio Solution (Seongnam, Gyeonggi-do, Korea), and genomic DNA was extracted from a standard microorganism strain. Real-time PCR was performed using a real-time PCR instrument (Thermo Scientific, Mass., USA). Real-time PCR conditions were specifically established to detect vaginal streaks without cross-reacting with other microbial strains, and the best conditions of the established real-time PCR amplification conditions were applied to this example.

1 ng of a genomic DNA (template) of a standard microorganism strain extracted using the aforementioned DNA extraction kit, 1 mu l of a primer of 100 pmol (a primer pair of one embodiment of the present invention specifically amplifying a target gene of Lactobacillus crispus, For example, primer pairs of SEQ ID NOS: 13 and 14), and 0.5 pmole of a 100 pmol probe (probe of one embodiment of the present invention specifically detecting the target gene of Lactobacillus crisparis, for example, a probe of SEQ ID NO: 15 ) Was added to the PCR reaction solution. To the PCR reaction solution, add 10 μl of 2 × real-time qPCR master mixture (ADVITE, Nonsan City, Chungcheongnam-do) and add 3 rd distilled water until the PCR reaction solution becomes 20 μl Respectively.

Then, denaturation was performed at 95 ° C for 7 minutes using a PicoReal 96 real-time PCR instrument, and the experiment was repeated by repeating the conditions of 95 ° C for 5 seconds and 60 ° C for 30 seconds in 40 cycles.

Meanwhile, in order to confirm real-time PCR amplification reaction results and quantitatively analyze the probe, the probe is double-labeled with a fluorescent substance and a small mineral substance. In this embodiment, FAM (maximum absorption wavelength: 495 nm, maximum emission Wavelength: 520 nm), and a small mineral BHQ-1 was labeled at the 3 'end. Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

The real-time PCR method is applied to the PCR technique using such a fluorescent substance and a small-molecule substance. It amplifies the target gene present in the sample during the reaction and detects the emission level of the fluorescent substance in real time, Thereby enabling the rapid and accurate analysis of the amplification of the target gene and its aspects. The basic principle of real-time PCR lies in the detection and quantification of fluorescence, which is performed in real time every PCR cycle by the principle of polymerase and fluorescence resonance energy transfer (FRET).

Quantification in real-time PCR is a method of measuring the amplification product in real time within the exponential phase by monitoring the progress of each cycle during PCR. In this case, important concept is Ct (threshold cycle) or Cp point. This value is the number of cycles at which the intensity of fluorescence caused by the above-mentioned double-labeled probe increases markedly beyond the baseline level, which is the initial period of the target gene (in the case of this embodiment The number of copies of the slpA gene, which is the target gene of Lactobacillus crispa sp.). Therefore, PCR amplification of a sample containing the slpA gene of Lactobacillus crispa sp. To determine the change in fluorescence intensity of the fluorescent substance over the entire PCR amplification period, and the number of PCR reactions (Cp value or Ct value) And a standard curve of fluorescence intensity is obtained. Then, it is possible to quantitatively analyze whether or not the slpA gene of Lactobacillus crispus is present and the initial amount of the slpA gene contained in the sample.

As shown in FIG. 1, real-time PCR experiments on standard microorganism strains showed positive results only in strain numbers 5054 and 3178, and it was confirmed that they did not react with other microorganisms.

That is, real-time PCR of genomic DNA of a standard microorganism strain using a primer pair and a probe of an embodiment of the present invention revealed that there was no cross reaction with genomic DNA of another strain used in the specificity experiment, It was found that only Lactobacillus crispus was detected specifically.

Therefore, the vaginitis detection method using the real-time PCR of the present invention can quantitatively analyze Lactobacillus crispa sp. Strains, vaginal supernatant, without any cross-reaction with other microorganism species in the vagina. Based on the quantified data, The sensitivity was high and it was confirmed that it is suitable for testing vaginitis.

Example 4: Detection of Gardnerella vaginalis and Candida albicans, which are vaginosis-causing microorganisms in clinical specimens

A real-time PCR experiment was carried out on the presence or absence of guinea-nella vaginalis and / or Candida albicans as a vaginal yeast-inducing microorganism in a clinical sample using a clinical sample obtained from Yutubio Co., Ltd. (Songpa-gu, Seoul, Korea) [IRB reception number -2015-S01-005, approval number IRB-2015-005, proceeded through expedited review (classified as very low-risk study)].

The obtained sample is a swab sample (vaginal epithelium and / or secretion), which is confirmed to be positive by a diagnostic method conducted by Yutubio Co., Ltd. DNA was extracted from the obtained sample using a Qiaamp DNA mini kit from Qiagen, and 2 μl of the extracted DNA was used as a template for real-time PCR. Real-time PCR was carried out in the same manner as in Example 3 using the PCR instrument, PCR composition and PCR amplification conditions, and quantitative detection of the vaginosis-causing microorganisms, Gardnerella vaginalis and / or Candida albicans, with high specificity and sensitivity Real-time PCR conditions were established, and the best conditions of the established real-time PCR amplification conditions were applied to this example.

First, a pair of primers (for example, the primer pairs of SEQ ID NOS: 4 and 5) and a probe (for example, a primer pair of SEQ ID NOS: 4 and 5) of the present invention for detecting a specificity and a high sensitivity of a guinea nelavaginalis, The probe of SEQ ID NO: 6) was used to perform real-time PCR on clinical samples. In order to confirm real-time PCR amplification reaction results and quantitatively analyze them, the probe is double-labeled with a fluorescent substance and a small mineral substance. In this embodiment, FAM (maximum absorption wavelength: 495 nm, maximum emission wavelength: 520 nm), and BHQ-1, a small mineral, was labeled at the 3 'end. Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

FIG. 2 shows a real-time PCR result for a clinical sample. The curve of the fluorescence signal from the FAM was effectively observed, and as a result of the pre-test of Yu Bu Bio Co., Ltd. which provided the clinical sample, Positive results.

(For example, primer pairs of SEQ ID NOs: 7 and 8) and probes (for example, SEQ ID NOs: 7 and 8) of the present invention for detecting Candida albicans as a vaginosis-causing microorganism with high specificity and sensitivity, ) Were used to perform real-time PCR on clinical samples. In order to confirm real-time PCR amplification reaction results and quantitatively analyze them, the probe is double-labeled with a fluorescent substance and a small mineral substance. In this embodiment, FAM (maximum absorption wavelength: 495 nm, maximum emission wavelength: 520 nm), and BHQ-1, a small mineral, was labeled at the 3 'end. Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

FIG. 3 shows a real-time PCR result for a clinical sample. As a result of the preliminary test result of Yutubio Co., Ltd., which provides a clinical sample, that is, a clinical sample has a Candida albicans-positive result It was confirmed that there was a match.

These results indicate that the method of testing vaginitis using real-time PCR according to the present invention can be used to detect vaginitis-causing microorganisms such as guineanella vaginalis and Candida albicans from clinical specimens such as vaginal discharge or epithelium, And the sensitivity can be detected at a high level. Therefore, it can be confirmed that the method is suitable for simple and low-cost rapid and accurate inspection of vaginitis. That is, the present invention provides a method for quantitatively determining the amount of a nitrate-causing microorganism from a sample that can be safely collected, such as a vaginal discharge or an epithelium, without any inconvenient medical procedure such as culturing the vaginosis-causing microorganism separately, It is possible to perform the vaginitis test which the female patients are reluctant to easily and quickly.

On the other hand, in Examples 3 and 4 of the present invention, probes specific for the target gene of Lactobacillus crisparis, probes specific for the target gene of Guard Nenavaginalis, and probes specific for the target gene of Candida albicans (Ie, BHQ-1) as the same fluorescent material (ie, FAM), but the present invention is not limited thereto. Two or more probes of these probes may be detected at different wavelengths It may be labeled with a labeling substance. When two or more probes among the probes specific to Lactobacillus crisparis, Gardnerella bajinalis and Candida albicans are labeled with a labeling substance capable of detecting them at different wavelengths, There is an advantage that two or more microorganisms out of Guard Nenra Bajinalis, Candida albicans and Lactobacillus crisparis can be detected at a time. For example, one probe may be labeled with FAM at the 5 'terminus, the JOE at the 5' terminus with the other probe, and the TEXAS RED at the 5 'terminus with another probe . In addition, as the fluorescent substance and the small-molecule substance for labeling the probe, various fluorescent substances and small-minerals known in the art can be used.

In summary, the results of Examples 3 and 4 demonstrate that the vaginitis detection method using the real-time PCR of the present invention can be applied to a clinical sample such as vaginal discharge or epithelium, The kans can be detected with high specificity and sensitivity based on the quantified data and it is possible to quantitatively analyze Lactobacillus crispa sp., Which is an intramolecular lectin, without any cross reaction with other microorganism species in the vagina. Thus, simple, low-cost, It can be said that there is an advantage that it can check the vaginitis accurately.

Therefore, the present invention relates to a method and apparatus for detecting vaginitis-causing microorganisms such as guineanella vaginalis and Candida albicans and vaginal supernatant, Lactobacillus crisparis, using real-time PCR from clinical specimens, on a fast, accurate and quantitative basis Can be detected with high sensitivity and sensitivity, and Lactobacillus crispa sp., An intramolecular inoculum, can be quantitatively analyzed without cross reaction with other microorganism species in the vagina. In particular, the present invention detects the exact vaginal abundance of vaginosis-causing microorganisms and vaginal infections from clinical specimens with high specificity and sensitivity, and as the degree of progression of vaginitis increases, the aforementioned vaginitis-causing microorganisms increase, By quantitatively and precisely determining the reduction of vaginal suppository bacterium such as barley, vaginitis can be tested quickly and accurately at low cost.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> YOON, HYUN KYU <120> Method and kit for diagnosing vaginitis using real-time PCR <130> P15-0033KR <160> 30 <170> Kopatentin 1.71 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-F1 forward primer <400> 1 atcgctcttc gtcgcgga 18 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-R1 reverse primer <400> 2 tgctgcagaa atagttgcag tagct 25 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-P1 probe <400> 3 agcaattgtt aaggaacttc tcgcatctgc ta 32 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-F2 forward primer <400> 4 cgcatctgct aaggatgttg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-R2 reverse primer <400> 5 cagcaatctt ttcgccaact 20 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GV-Cpn60-P2 probe <400> 6 tgcaactatt tctgcagcag atcc 24 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CA-ITS-F forward primer <400> 7 tcgctttgac aatggcttag gtctaac 27 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CA-ITS-R reverse primer <400> 8 gatttgaggt caaagtttga agatatacg 29 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CA-ITS-P probe <400> 9 acattgyttg cggcggtaac gtcca 25 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LC-F1 forward primer <400> 10 atgaagaaaa atttaagaat tgt 23 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> LC-R1 reverse primer <400> 11 cracaggagc aacagct 17 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LC-P1 probe <400> 12 agcgctgctg ctgctgct 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LC-F2 forward primer <400> 13 cttacacatt caagaacg 18 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> LC-R2 reverse primer <400> 14 gaagccttta cgtaagtct 19 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> LC-P2 probe <400> 15 agcaatacta caagatcggt aacaacac 28 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> LC-F3 forward primer <400> 16 tcgttgcacc taagtcattc a 21 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> LC-R3 reverse primer <400> 17 ccttgccgtt tggtacatta ac 22 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> LC-P3 probe <400> 18 ctgctaacaa caacgatgct tcacgc 26 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LC-F4 forward primer <400> 19 aaaggctgct ggtgttga 18 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> LC-R4 reverse primer <400> 20 cgtgaagcat cgttgttgtt ag 22 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> LC-P4 probe <400> 21 tggttcgttg cacctaagtc attcact 27 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LC-F5 forward primer <400> 22 tcacgcactt tagctgtaac t 21 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> LC-R5 reverse primer <400> 23 gcttagcgtt cttgtcgtag ta 22 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LC-P5 probe <400> 24 acggcaagga catgactgta ccaa 24 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LC-F6 forward primer <400> 25 gttaatgtac caaacggcaa gg 22 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LC-R6 reverse primer <400> 26 tgtcagtacc aacacgctta g 21 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> LC-P6 probe <400> 27 tgactgtacc aagccaaagc aagact 26 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LC-F7 forward primer <400> 28 gagttgtttg caggttcaga tg 22 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LC-R7 reverse primer <400> 29 tagttgcttg cgtggtactt 20 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> LC-P7 probe <400> 30 acgttgctca agttgtttca gctgc 25

Claims

As a vaginitis test kit using real-time PCR,
1 and 2, which specifically amplify the gene for cpn60 (60 kDa chaperonin), which is a target gene for the detection of Gardnerella vaginalis, a yeast-causing microorganism, and primers of SEQ ID NOS: 4 and 5 At least one pair of primers,
A pair of primers of SEQ ID NOS: 7 and 8 for specifically amplifying an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans, a yeast-causing microorganism,
A primer pair of SEQ ID NOs: 10 and 11 that specifically amplifies the slpA (surface layer protein A) gene, which is a target gene for detection of Lactobacillus crispatus, which is a vaginal staple bacteria, SEQ ID NO: 13 The primer pair of SEQ ID NOs: 16 and 17, the primer pair of SEQ ID NOs: 19 and 20, the primer pair of SEQ ID NOs: 22 and 23, the primer pair of SEQ ID NOs: 25 and 26, and the primer pair of SEQ ID NOs: At least one pair of primers,
The probes specifically binding to the amplification product of the cpn60 (60 kDa chaperonin) gene, which is a target gene for the detection of Gardnerella vaginalis, a yeast-causing microorganism, include oligonucleotides of SEQ ID NOS: 3 and 6 At least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides,
A probe specifically binding to an amplified product of an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans, a yeast-causing microorganism, and an oligonucleotide complementary to the oligonucleotide of SEQ ID NO: At least one probe selected from the group consisting of:
SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 18, and SEQ ID NO: 18, which specifically bind to an amplification product of a slpA (surface layer protein A) gene, which is a target gene for detection of vaginal staple bacteria, Lactobacillus crispatus. A method for screening for a viral infection by real-time PCR comprising at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27 and SEQ ID NO: 30 and oligonucleotides complementary to these oligonucleotides Inspection kit.

The method according to claim 1,
PCR kit for real time PCR, further comprising DNA polymerase, dNTPs, PCR buffer solution and labeling substance of PCR amplification product.

3. The method of claim 2,
The labeling substance may be,
One end of a probe specifically binding to the amplification product of the cpn60 gene,
One end of a probe that specifically binds to an amplification product of the ITS gene,
Wherein the PCR product is labeled at one end of a probe that specifically binds to the amplification product of the slpA gene.

The method of claim 3,
A probe that specifically binds to the amplification product of the cpn60 gene, a probe that specifically binds to the amplification product of the ITS gene, and a probe that specifically binds to the amplification product of the slpA gene, Characterized in that the label is labeled with a labeling substance detectable at different wavelengths.

5. The method of claim 4,
When two or more probes are labeled with a labeling substance that can be detected at different wavelengths, two or more microorganisms out of guinea nelavaginalis, Candida albicans and Lactobacillus crisparis associated with vaginitis in one test tube Is detected at one time by using real-time PCR.

1. An in vitro test method for providing information for determining the presence or absence of vaginitis using real-time PCR,
Preparing a gene sample from a specimen,
Using the prepared gene sample as a template and using a vaginitis test kit as defined in any one of claims 1 to 5 using a real-time PCR kit, the target gene for detection of the Guard Nenra vaginalis amplifying the cpn60 gene, the ITS gene, which is a target gene for the detection of Candida albicans, and the slpA gene, which is a target gene for detection of the Lactobacillus crisparis, by real-time PCR,
After the amplification of the target gene, real-time PCR results were confirmed, and the presence or absence and presence of Gardnerella vaginalis and Candida albicans in the specimen and the presence and amount of Lactobacillus crispa sp. Quantitatively measuring,
Providing information to determine the presence or absence of vaginitis based on the presence and abundance of the quantitatively measured Gardnerella vaginalis and Candida albicans and the presence and abundance of Lactobacillus crispa sp. , An in vitro test method for providing information to determine the presence of vaginitis using real-time PCR.

The method according to claim 6,
A primer pair that amplifies the cpn60 gene, the ITS gene, and the slpA gene, and a primer pair that amplifies the cpn60 gene, the ITS gene, and the slpA gene, Amplifying the ITS gene and the slpA gene using real-time PCR using a labeling substance indicating amplification amount of the gene in association with the ITS gene and the slpA gene;
Measuring a change in the fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the PCR reaction count through the Cp value or the Ct value;
Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in fluorescence intensity of the labeling substance;
The change in the fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of each of the cpn60 gene, the ITS gene and the slpA gene in the gene sample of the specimen was measured and the number of PCR reactions through the Cp value or the Ct value Analyzing,
A Cp value or a Ct value obtained by PCR amplification of each of the cpn60 gene, the ITS gene and the slpA gene present in the gene sample of the specimen is made to correspond to the copy number of the positive standard, And determining the presence or absence of Candida albicans and quantifying the presence and amount of Lactobacillus crispa sp. In the sample using real-time PCR. An in vitro test method to provide.

8. The method of claim 7,
The labeling substance may be,
One end of a probe specifically binding to the amplification product of the cpn60 gene,
One end of a probe that specifically binds to an amplification product of the ITS gene,
Wherein the probe is labeled at one end of a probe that specifically binds to the amplification product of the slpA gene.

9. The method of claim 8,
A probe that specifically binds to the amplification product of the cpn60 gene, a probe that specifically binds to the amplification product of the ITS gene, and a probe that specifically binds to the amplification product of the slpA gene, Characterized in that it is labeled with a labeling substance which can be detected at different wavelengths, in order to provide information for determining the vaginosis using real-time PCR.

10. The method of claim 9,
When two or more probes are labeled with a labeling substance that can be detected at different wavelengths, two or more microorganisms out of guinea nelavaginalis, Candida albicans and Lactobacillus crisparis associated with vaginitis in one test tube Wherein the method comprises the steps of: detecting the presence or absence of vaginitis in a test sample;

As a pair of primers for real-time PCR amplification used in a vaginitis test method using real-time PCR, a sequence that specifically amplifies the cpn60 (60 kDa chaperonin) gene, which is a target gene for the detection of a vaccine-causing microorganism, Gardnerella vaginalis A primer pair of SEQ ID NOS: 1 and 2, and a pair of primers of SEQ ID NOS: 4 and 5, and an internal transcribed spacer gene, which is a target gene for the detection of Candida albicans as a vaginosis-causing microorganism, , Primer pairs of SEQ ID NOS: 7 and 8, and primer pairs of SEQ ID NOS: 10 and 11 that specifically amplify the slpA (surface layer protein A) gene, which is a target gene for detection of Lactobacillus crispus thaliana, The primer pair of SEQ ID NOS: 13 and 14, the primer pair of SEQ ID NOS: 16 and 17, the primer pair of SEQ ID NOS: 19 and 20, the primer pair of SEQ ID NOS: 22 and 23, A primer set of SEQ ID NOS: 25 and 26, and a primer pair of at least one of primer pairs of SEQ ID NOS: 28 and 29. A primer set for amplifying a vaginitis-causing microorganism and an endoplasmic reticulum target gene.

As probes specific to the cpn60 (60 kDa chaperonin) gene, which is a target gene for the detection of the vaginosis-causing microorganism, Gardnerella vaginalis, oligonucleotides of SEQ ID NOs: 3 and 6 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of oligonucleotides,
A probe specific for an internal transcribed spacer (ITS) gene, which is a target gene for the detection of Candida albicans as a vaginosis-causing microorganism, is selected from the group consisting of oligonucleotides of SEQ ID NO: 9 and oligonucleotides complementary to these oligonucleotides At least one probe,
SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 21, and SEQ ID NO: 21 are used as probes specific for the slpA (surface layer protein A) gene, which is a target gene for detection of vaginal intracellular Lactobacillus crispatus. 24, SEQ ID NO: 27 and SEQ ID NO: 30, and oligonucleotides complementary to such oligonucleotides.