KR101863458B1 - Method and kit for detecting bacteria causing salmonella infection using real-time PCR - Google Patents

Abstract

The present invention provides an examining kit and a method for the same. The examining kit is applied with a marker checking not only Salmonella typhimurium serotype but also Salmonella by including Salmonella gallinarum and Salmonella pullorum indicating pathogenicity for birds. So, the examining kit can detect bacteria causing Salmonella infection at the same time. According to the present invention, the examining kit can rapidly and accurately detect not only the Salmonella gallinarum which is the bacteria responsible for fowl typhoid and Salmonella pullorum which is the bacteria which causes pullorum disease but also Salmonella typhimurium which causes food poisoning to persons at high specificity and high sensitivity based on quantification data using a real-time PCR. So, the examining kit helps build effective preventive measures by quickly identifying the bacteria responsible for food poisoning in humans and bird deaths.

Description

[0001] The present invention relates to a method and kit for detecting Salmonella infection causing real-time PCR using real-time PCR,

The present invention relates to kits and methods for detecting Salmonella infectious disease bacteria using real-time PCR (real-time PCR), and more particularly, to a kit and method for detecting Salmonella infection causing bacteria in human poultry, The present invention relates to a kit and a method for testing salmonella infection causing causative bacteria of Salmonella infection using real-time PCR capable of rapidly and accurately detecting the causative bacteria of Salmonella infection.

More specifically, the present invention is to fowl typhoid organisms of Salmonella Galina room (Salmonella gallinarum) and Salmonella typhimurium (Salmonella typhimurium) cause food poisoning to the person as well as chubaekri organisms of Salmonella pool room (Salmonella pullorum) using real-time PCR the And more particularly, to a kit and method for detecting Salmonella infectious disease bacteria using real-time PCR capable of detecting specificity and sensitivity with high speed, accurately, and quantitatively based on data even in Salmonella spp.

In addition, the present invention can simultaneously detect Salmonella spp. At the onset of the onset, including salmonella gallinarum, which causes poultry typhi causing great damage to the poultry industry, and salmonella spp., Which causes food poisoning to humans, as well as Salmonella spp. The present invention relates to a kit and a method for testing salmonella infection causing bacteria in a real-time PCR, which can accurately and quickly establish countermeasures against Salmonella infection.

Salmonella is a type of proteobacteria belonging to the genus Salmonella , which causes food poisoning in humans. In chicken, a certain serotype of Salmonella causes digestive tract infection, infection with nervous system, sepsis.

Poultry Typhus is an acute and chronic epidemic of chicken, caused by Salmonella gallinarum ( Salmonella gallinarum ) and causes high mortality due to sepsis in all ages. Poultry typhus was first reported in Korea in 1992 as a pandemic and epidemic. Since 1994, it has spread nationwide and caused enormous economic losses.

Chungbaek is a gastroenterological disease that causes white diarrhea, and shows high infectivity and mortality like poultry typhus. The mung bean is caused by Salmonella pullorum Biochemical analysis is essential for accurate identification because it has the same serum reaction as Salmonella gallinarum .

The Salmonella Galina Room and Salmonella Pool Room not only cause digestive system transmission but also cause contagion of the nematode, causing a lot of damage and causing a lot of economic losses in the poultry market. Although they are reported to be non-infectious to humans, 458,081 Salmonella isolates from humans in the United States from 1982 to 1992 were analyzed and eight Salmonella gallinarum and 18 There is a case in which Salmonella pullorum is confirmed.

Thus, salmonella not only shows pathogenicity to algae, but also generally causes digestive tract infection in humans. Most of the causes of Salmonella infection in humans occur by ingesting contaminated meat or contaminated eggs. In recent years, 2,000 food poisoning cases have been caused by contaminated eggs in the United States, and the risk is high because these eggs can be used as raw materials for food processing in the form of an egg.

In order to solve these problems collectively, Salmonella in foods that cause gastrointestinal infectious diseases to humans as well as salmonella which causes economic damage to poultry typhus and mulberry trees should be identified. Conventionally, serum analysis and biochemical tests have been performed to identify causative microorganisms of Salmonella infectious disease and to confirm the origin of infection. However, in recent years, a method of detecting a gene that amplifies and examines a specific gene sequence (i.e., a genetic marker) Is being generalized.

However, the existing methods for gene detection for Salmonella infectious diseases were limited to the target strains used for testing purposes, and some of the food poisoning tests that examine causative bacteria causing food poisoning in humans were used to identify Salmonella genus However, in order to prevent collective deaths in the poultry rearing process, Salmonella bacteria showing pathogenicity to birds must be identified separately. Therefore, there is a limit in establishing measures to prevent Salmonella infection.

For example, Korean Patent Laid-Open Publication No. 10-2009-0122554 discloses a molecular biological test method for detecting the serotype of salmonella typhimurium which is fatal to the human body by PCR, and primers and probes used therein. However, It was unsuitable to establish customized anti-bacterial measures by early and accurate detection of Salmonella infection including poultry typhus and prawn mite, which can only be tested for Salmonella typhimurium, which causes human food poisoning.

In addition, the Republic of Korea Patent Application No. 10-2013-0137781 discloses a Salmonella public serum type Salmonella entera ET display (S. Enteritidis) of the three based on the common Salmonella gene (invA), Salmonella choleraesuis could devices (S. Choleraesuis), Salmonella A primer capable of discriminating S. typhimurium has been designed and a multiplex polymerase chain reaction using the primer has been disclosed to diagnose the above three types of Salmonella infection, , It was unsuitable for early detection of the Salmonella infectious diseases including poultry typhus and mongolian poultry, which could cause the poultry industry to be damaged, and to establish customized anti-pandemic measures.

Therefore, in the technical field of the present invention, there is a need for a new technology capable of detecting not only Salmonella Typhimurium serotypes causing food poisoning in humans including poultry typhus and mung bean germs but also Salmonella spp. Quickly, with high specificity and sensitivity It can be said that it is required.

Korean Patent Publication No. 10-2009-0122554 (2009.12.01) Korean Patent Publication No. 10-2013-0137781 (December 13, 2013)

The present invention provides a kit and a method for testing salmonella infection causing bacteria in real time PCR which can rapidly and accurately detect causative microorganisms of Salmonella infection causing food poisoning in humans as well as causative bacteria of poultry typhus and mulberry It has its purpose.

More specifically, the present invention is to fowl typhoid organisms of Salmonella Galina room (Salmonella gallinarum) and Salmonella typhimurium (Salmonella typhimurium) cause food poisoning to the person as well as chubaekri organisms of Salmonella pool room (Salmonella pullorum) using real-time PCR the It is an object of the present invention to provide a kit and a method for testing salmonella infection causing bacteria in real time, which can detect rapidly, accurately and quantitatively the data even with high specificity and sensitivity.

In addition, the present invention can simultaneously detect Salmonella spp. At the onset of the onset, including salmonella gallinarum, which causes poultry typhi causing great damage to the poultry industry, and salmonella spp., Which causes food poisoning to humans, as well as Salmonella spp. The present invention provides a kit and method for detecting Salmonella infectious disease bacteria using real-time PCR, which can accurately and quickly establish countermeasures against Salmonella infection.

DISCLOSURE OF THE INVENTION As a result of intensive studies to solve the technical problem of the present invention, the inventors of the present invention have found that Salmonella typhimurium serotypes including salmonella gallinarum and Salmonella pneumoniae which are pathogenic to algae, The present inventors have devised a test kit and a method for simultaneously detecting Salmonella infection causing bacteria by applying a marker identifying Salmonella genus.

As used herein, the term "sample" refers to various samples capable of detecting genes of Salmonella infectious pathogen other than feces, various secretions, feces, tissues and cells of suspected infected patients, for example, Toilet, towel, toilet paper, contaminated water, contaminated food, chickens, and eggs.

As used herein, the term "gene sample" is used as a broad concept including DNA, RNA, cDNA generated from RNA by a reverse transcriptase, DNA or cDNA amplified through pre-PCR (preliminary PCR) .

As used herein, the term "real-time PCR" refers to the application of a fluorescent material to a PCR technique, in which the amplification of a target gene existing in a specimen during the reaction, It is a method that can quickly and accurately analyze the presence or absence of amplification of a target gene and its pattern by real-time detection and quantitative analysis. This real-time PCR is divided into two methods, one using SYBR Green and the other using double-labeled probes.

The SYBR green technique combines the SYBR green dye into the DNA amplified during real-time PCR amplification and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescent signal. The fluorescent signal is detected, It is a method that can measure the presence and the amount of amplification product from it. The real-time PCR technique using a dual labeled probe is a method using a double-labeled probe in which a fluorescent substance is labeled at the 5 'end and a quencher is labeled at the 3' end, Through the fluorescence signal from the labeled probe, it is possible to confirm whether or not the double-labeled probe is annealed with the PCR amplification product of the target gene, and the presence or absence of the target gene and the amount of the amplification product generated therefrom can be measured. It goes without saying that real-time PCR known in the art such as a TaqMan probe method and the like are applicable in the present invention.

The present invention provides a real-time PCR primer set used in a method for inspecting salmonella infection causing bacteria by real-time PCR. The primer set for real-time PCR of the present invention comprises a pair of primers of SEQ ID NOS: 1 and 2 that specifically amplify the glgC (glucose-1-phosphate adenylyltransferase) gene of Salmonella Galina Room and a pair of primers of Salmonella Galina Room and Salmonella Poolorum ornithine decarboxylase gene and a pair of primers of SEQ ID NOs: 10 and 11 that specifically amplify the fljB gene among the flagellin protein genes of Salmonella typhimurium .

Preferably, the real-time PCR primer set of the present invention further comprises primer pairs of SEQ ID NOS: 4 and 5 that specifically amplify the Salmonella type III ssaN (type III secretion system ATPase) gene to detect Salmonella spp. do.

The present invention also provides a probe specific for the glgC gene of Salmonella Galina Room, comprising at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 3 and an oligonucleotide complementary to the oligonucleotide, a Salmonella Galina Room, And at least one probe selected from the group consisting of an oligonucleotide complementary to the oligonucleotide of SEQ ID NO: 9 and an oligonucleotide complementary to the oligonucleotide, and a fljB gene of the flagellin protein gene of Salmonella typhimurium And at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 12 and an oligonucleotide complementary to the oligonucleotide, as probes specific for Salmonella infection, It provides a probe composition.

Preferably, the probe composition of the present invention for detecting salmonella infection causing bacteria is a probe specific for Salmonella type III ssaN (type III secretion system ATPase) gene for detecting bacteria of Salmonella genus, and an oligonucleotide of SEQ ID NO: And at least one probe selected from the group consisting of complementary oligonucleotides.

In addition, the present invention provides a kit for testing Salmonella infection-causing bacteria using real-time PCR. The kit for detecting Salmonella infectious disease bacteria using the real-time PCR of the present invention comprises a pair of primers of SEQ ID NOS: 1 and 2, which specifically amplify the glgC (glucose-1-phosphate adenylyltransferase) gene as a target gene for detection of Salmonella Galina Room , The Salmonella Galina Room and the primer pairs of SEQ ID NOS: 7 and 8 which specifically amplify the speC (ornithine decarboxylase) gene, which is a target gene for detection of Salmonella pneumoniae, and the fljB gene, which is a target gene for the detection of Salmonella typhimurium 10 and 11, which specifically amplify the oligonucleotide of SEQ ID NO: 3 as a probe specific to the glgC gene, which is a target gene for detection of Salmonella Galina Room, and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 9 and an oligonucleotide complementary to the oligonucleotide as a probe specific to the speC gene, which is a target gene for detection of a room in the Nella Galina room and Salmonella pool, A probe specific for the fljB gene, which is a target gene for the detection of human urine, and at least one probe selected from the group consisting of oligonucleotides complementary to these oligonucleotides.

Preferably, the kit for detecting Salmonella infectious disease bacteria using the real-time PCR of the present invention is a kit for detecting a Salmonella type III ssaN (type III secretion system ATPase) gene, which is a target gene for detecting Salmonella spp. And 5, and a probe specific for a Salmonella type III ssaN gene (a type III secretion system ATPase) gene, which is a target gene for detecting bacteria in Salmonella genus, as an oligonucleotide of SEQ ID NO: 6 and an oligonucleotide complementary to such oligonucleotide And at least one probe selected from the group consisting of

The kit for detecting Salmonella infectious disease bacteria using real-time PCR in one embodiment of the present invention further comprises DNA polymerase, dNTPs, PCR buffer solution, and markers of PCR amplification products.

In a kit for detecting Salmonella infectious disease bacteria using real-time PCR according to an embodiment of the present invention, the labeling substance comprises a probe having a specific end that specifically binds to the amplification product of the glgC gene and a probe that specifically binds to the amplification product of the speC gene One end of a probe that specifically binds to an amplification product of the fljB gene and one end of a probe that specifically binds to an amplification product of the ssaN gene, for example, a 5 ' May be labeled at the end.

It is preferable that the kit for detecting Salmonella infectious disease bacteria using real-time PCR according to an embodiment of the present invention simultaneously includes four probes labeled with a labeling substance detectable at different wavelengths. The presence of the glgC gene, the speC gene, the fljB gene, and the ssaN gene can be simultaneously detected when four probes labeled with a labeling substance detectable at different wavelengths are simultaneously contained .

In a kit for detecting Salmonella infectious disease bacteria using real-time PCR in one embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeling substance is measured to determine the presence of the glgC gene, the speC gene, The amount of amplification of the ssaN gene can be calculated.

A method for inspecting a salmonella infection pathogen using real-time PCR according to an embodiment of the present invention comprises the steps of preparing a gene sample from a specimen and using the kit for detecting a salmonella infection causing bacteria using real-time PCR as described above, Real-time PCR, and detecting the Salmonella infection causing bacteria in the sample based on the real-time PCR result.

For example, when the speC gene of the Salmonella Galina Room and Salmonella glomerosa is detected in the specimen and the glgC gene of the Salmonella Galina Room is detected as a result of the real-time PCR, the specimen is determined to have been infected by the Salmonella Galina Room , The speC gene of the Salmonella Galina Room and Salmonella glomerosa can be detected in the specimen, but when the glgC gene of the Salmonella Galina Room is not detected, the specimen can be determined to have been infected by Salmonella poolorum.

The method of testing Salmonella infection causing bacteria according to an embodiment of the present invention using real-

Before the amplification, a positive standard, which is a gene sample whose copy number of each target gene is known, is used for a Salmonella Infectious Disease Investigation Kit using real-time PCR as described above and a labeling substance indicating the amplification amount of each target gene Amplifying the amplified cDNA by real-time PCR,

Measuring a change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;

Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in fluorescence intensity of the labeling substance;

The change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of each target gene present in the gene sample of the specimen is measured and the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity is analyzed Step,

Quantitatively measuring the Cp value or the Ct value obtained by PCR amplification of each of the target genes present in the gene sample of the specimen in association with the number of copies of the positive standard, thereby determining whether or not the specimen is infected with Salmonella infection causing bacteria do.

In the method for detecting Salmonella infectious pathogens using real-time PCR according to an embodiment of the present invention, the labeling substance may be selected from the group consisting of one end of a probe specifically binding to the amplification product of the glgC gene, One end of a probe that specifically binds to an amplification product of the fljB gene and one end of a probe that specifically binds to an amplification product of the ssaN gene, for example, a 5 ' May be labeled at the end.

In this regard, it is preferable to simultaneously use four probes labeled with a labeling substance detectable at different wavelengths. When four probes labeled with a labeling substance capable of detecting at different wavelengths are used at the same time, it is possible to simultaneously detect the presence of the glgC gene, the speC gene, the fljB gene, and the ssaN gene .

In a method for inspecting a salmonella infection causing bacteria according to an embodiment of the present invention, the labeling substance is a fluorescent substance, and the intensity of fluorescence from the labeling substance is measured to determine whether the glgC gene, the speC gene, the fljB gene, The amount of amplification of the ssaN gene can be calculated.

In the present invention, one end of the probe, for example, the 5 'terminus is Cy5, Cy3, x-rhodamine, Texas red, SYBR green, FAM, VIC, JOE, NED, HEX, TET and TAMRA Such as IABkFQ, DABCYL, BHQ (BHQ-1, BHQ-2, etc.), EBQ, ZEN-IBFQ, etc. The other end of the probe, for example, . However, it should be understood that the present invention is not limited thereto, and a variety of fluorescent materials and minerals known in the art can be used.

According to the present invention, not only causative bacteria of poultry typhus and mulberry, which cause great damage to the poultry industry, but also salmonella infectious agents causing food poisoning can be simultaneously and rapidly detected.

More specifically, the present invention is to fowl typhoid organisms of Salmonella Galina room (Salmonella gallinarum) and Salmonella typhimurium (Salmonella typhimurium) cause food poisoning to the person as well as chubaekri organisms of Salmonella pool room (Salmonella pullorum) using real-time PCR the Including Salmonella spp., Can be detected rapidly, accurately and with high sensitivity and specificity based on quantified data.

In addition, the present invention can simultaneously detect Salmonella spp. At the onset of the onset, including salmonella gallinarum, which causes poultry typhi causing great damage to the poultry industry, and salmonella spp., Which causes food poisoning to humans, as well as Salmonella spp. By providing this technology, it is possible to accurately and quickly establish countermeasures against SARS caused by Salmonella infection.

Particularly, the present invention can detect only Salmonella spp. Without cross-reaction with other microorganisms even when chicken, egg, food, etc. are contaminated by various microorganisms and it is difficult to identify a microorganism causing food poisoning or algae mass death It is useful for establishing customized anti-virus measures.

FIG. 1 is a graph showing the results obtained by real-time PCR using the synthetic genes (glgC, speC, fljB and ssaN synthetic genes) prepared in Example 1 as a template and combinations of primer pairs and probes shown in Table 5.
FIG. 2 shows the result obtained by real-time PCR using 1 ng of gDNA extracted from the microorganism of Table 8 as a template and combinations of primer pairs and probes in Table 5 for the evaluation of the specificity of the method for detecting Salmonella infection causing bacteria of the present invention Graph.

Hereinafter, the present invention will be described in more detail based on the embodiments of the present invention. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Example

Example 1 Synthesis of Target Gene for Salmonella Infectious Pathogens

(Glucose-1-phosphate adenylyltransferase) gene (pseudogene) of Salmonella Galina Room and Salmonella Galina Room and salmonella pool room speC (Salmonella galactosyltransferase) in order to detect Salmonella glomerulone, a causative organism of poultry typhus, (ornithine decarboxylase) pseudogene was selected as the target gene.

In order to detect the Salmonella enterica Typhimurium strain, the fljB gene of the flagellin protein gene of the Salmonella entericarpimurium strain was selected as a target gene. In addition, a Salmonella type III ssaN (type III secretion system ATPase) gene was selected as a target gene in order to detect Salmonella spp., And the synthetic gene sequence was referred to the genome sequence of Salmonella entericitabimurium strain.

Each target gene synthesis was carried out using AccuGeneBlock Service of Bioneer (Daejeon, Republic of Korea), and the sequence information of each synthesized gene was described in detail in Tables 1 to 4 below Respectively.

Synthetic gene sequence (SEQ ID NO: 13) for the glucose-1-phosphate adenylyltransferase (GGC) pseudogene in Salmonella Galina Room glgC gene (143 bp), accession number registered in NCBI of GenBank. CP034047 GGTGACCCAGAACCTGGATATTATTCGTCGCTATAAAGCGGAATATGTCGTCATCCTGGCAGGCGATCATATCTACAAGCAGGACTACTCGCGTATGTTTTGAAAAGGGCGCGCGTTGCACGGTGGCCTGTATGCCGGTGCCG

Synthetic gene sequence (SEQ ID NO: 14) for the speC (ornithine decarboxylase) pseudogene in the Salmonella Galina Room and Salmonella puromycin Room speC gene (184 bp), accession number registered in NCBI of GenBank. CP012347 ACGGCTTGCCGTCAACCACCAGTGGGATAAAGGGCTGAAGCAGTTTGCAACGGGCGAGAATGGCTTTGCGTCAATGCCCAGCGCAACGCACTCCGCCCACAGGCGGCGACCGCTCTCCCCTTCGTGGATTTTGGCATTGACATCCAGCGCCGCAAACAGCGGGTAGAACAGACTGGTTGAAGCA

Synthetic gene sequence for Salmonella type III ssaN (type III secretion system ATPase) gene (SEQ ID NO: 15) ssaN gene (120 bp), accession number registered in NCBI of GenBank. CP017728 CATCGCCAGAAGCGTGCTTTTCCCCACGCCAGGAGCAGAAAAAACCACTCGTTGCCCTTCGCCACAGGTCGCAACGCTATCAATAGCGCGAATCCCCGTCATTAATGGTTGAGTGAT

Synthetic gene sequence (SEQ ID NO: 16) for the fljB gene of Salmonella entericitabimurium strain the fljB gene (180 bp), the accession number registered in NCBI of GenBank. CP017728 CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGCGCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCTAACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTG

Example 2: Preparation of primers and probes for detecting causative bacteria of Salmonella infection

The inventors of the present invention have conducted intensive studies based on gene sequence information of Salmonella infection causing bacteria as described in Tables 1 to 4 of Example 1. As a result, it was found that Salmonella galina room, Salmonella pool room and Salmonella typhimurium were detected And a fluorescently labeled probe capable of specifically identifying the amplification reaction product were designed. In addition, primer pairs and probes capable of detecting Salmonella genus were also designed. Table 5 shows the primer and probe sequences that can specifically detect simultaneously Salmonella spp., Including salmonella typhimurium, which causes food poisoning in humans as well as salmonella pool room, which is a causative organism of poultry typhus, and Salmonella spp. .

GC and Tm values of primer and probe sequences were analyzed using oligoanalyzer 3.1, a web-based program provided by IDT (INTEGRATED DNA TECHNOLOGIES).

Sequence information of primers and probes for the specific detection of Salmonella infectious disease bacteria SEQ ID NO: Oligomer type The base sequence (5 '- > 3') Length GC% Tm (占 폚) Amplification product One glgC Forward
primer AGAACCTGGATATTATTCGTCGCTA 25 40 55.4 105 bp 2 glgC Reverse
primer CGCGCCCTTTTCAAAACAT 19 47.4 54.7 3 glgC probe ATGTCGTCATCCTGGCAGGCGA 22 59.1 63.1 4 ssaN Forward
primer CGCCAGAAGCGTGCTTTT 18 55.6 56.8 56 bp 5 ssaN reverse direction
primer GGGCAACGAGTGGGTATTTT 20 50 55.6 6 ssaN probe CCCACGCCAGGAGCAGA 17 70.6 60.6 7 speC Forward
primer GTCAACCACCAGTGGGATA 19 52.6 54.1 71 bp 8 speC reverse direction
primer CTGGGCATTGACGCAAA 17 52.9 53.7 9 speC probe AGCAGTTTGCAACGGGCGA 19 57.9 60.8 10 fljB Forward
primer GTAACGCTAACGACGGTATCTC 22 50 54.9 113 bp 11 fljB reverse direction
primer GGTGCTGTTAGCAGACTGAA 20 50 54.9 12 The fljB probe TGCAGCGTGTGCGTGAACTG 20 60 61.3

As for the primers and probes shown in Table 5, Salmonella Galina Room, which is a causative organism of poultry typhus, can be detected by combining the primers of SEQ ID NOs: 1 and 2 and the probes of SEQ ID NO: 3 (the target gene is Salmonella Galina Room glgC gene), Salmonella galactosyltransferase, Salmonella galactosyltransferase, Salmonella galactosyltransferase, Salmonella galactosyltransferase gene, and Salmonella glucanosyltransferase can be detected by a combination of the primers of SEQ ID NOS: 7 and 8 and the probe of SEQ ID NO: 9 (the target gene is Salmonella Galina Room, Of the speC gene).

Using the above-described combinations of primers and probes, it is possible to specifically detect Salmonella Galina room and Salmonella pool room, which are causative microorganisms of poultry typhus. That is, the results of real-time PCR amplification using the primers of SEQ ID NOs: 1 and 2 and the probe of SEQ ID NO: 3, and the results of real-time PCR amplification using the primers of SEQ ID NOs: 7 and 8 and the probe of SEQ ID NO: When the results are shown, it can be judged that Salmonella galina room exists in the specimen. On the other hand, if only the results of the real-time PCR amplification tests using the primers of SEQ ID NOs: 7 and 8 and the probe of SEQ ID NO: 9 under the same conditions show positive results, it can be judged that the sample exists in Salmonella pool.

In addition, the Salmonella enterica Typhimurium strain, which is a causative organism for food poisoning in humans, can be detected by combining the primers of SEQ ID NOs: 10 and 11 and the probe of SEQ ID NO: 12 (the target gene is Salmonella enterica Typhimurium strain Bacteria of the genus Salmonella, including Salmonella gallinarum, Salmonella pylorum and Salmonella entericarpimorumum can be detected by combining the primers of SEQ ID NOs: 4 and 5 and the probe of SEQ ID NO: 6 The gene is Salmonella type III ssaN gene).

On the other hand, the probe of SEQ ID NO: 3 (probe specific to the glgC gene of Salmonella Galina Room) labeled FAM fluorescent substance at the 5 'end and the probe of SEQ ID NO: 6 (probe specific to Salmonella type III ssaN gene) JOE fluorescent substance was labeled at the terminal. In addition, the probe of SEQ ID NO: 9 (a probe specific to the speC gene of Salmonella Galley Room and Salmonella glomerosa) was labeled with a TAMRA fluorescent substance at the 5 'end, and the probe of SEQ ID NO: 12 (specific to the fljB gene of Salmonella typhimurium Probe) labeled Cy5 fluorescent material at the 5 'end. In addition, EBQ (Excellent Bioneer Quencher), which is a small mineral, was labeled at the 3 'end of the four probes.

The primer pairs and probes of Table 5 were synthesized using oligo synthesis service of Bioneer Co., Ltd. (Daejeon, Republic of Korea) and prepared by adding sterilized distilled water to a final concentration of 100 μM. .

Example 3 Detection of Salmonella Infectious Pathogens Using Synthetic Gene (Positive Control DNA)

Real-time PCR was performed using the combination of the synthetic genes (glgC, speC, fljB and ssaN synthetic genes) prepared in Example 1 and primer pairs and probes for each target gene prepared in Example 2. Amplification experiments were carried out using an ABI 7500 fast real-time PCR instrument, and a real-time PCR reaction formulation as described in Table 6 was prepared and used. 1 μL of the prepared synthetic gene (template) was added to the reaction composition to a concentration of 10 ⁵ copies / μL per reaction. The 2X real-time PCR Master Mix was made using a product of JEES Biotech (Gyeonggi-do, Korea).

Real-time PCR reaction amount Composition Additive amount 2X Real Time PCR Master Mix 10 μL Forward primer (100 [mu] M)
(SEQ ID NOS: 1, 4, 7, 10) Each 0.1 μL Reverse primer (100 [mu] M)
(SEQ ID NOS: 2, 5, 8, 11) Each 0.1 μL The probe (100 [mu] M)
(SEQ ID NOS: 3, 6, 9, 12) 0.05 μL each DNA template (10 ⁵ copies / μL) 1 μL Water without nuclease 8 μL Total volume 20 μL

In order to confirm the results of the real-time PCR amplification reactions and quantitatively analyze them, each probe is double-labeled with a fluorescent substance and a small mineral substance. The probe for the glgC gene (SEQ ID NO: 3) (SEQ ID NO: 6) was labeled with JOE (maximum absorption wavelength: 520 nm, maximum emission wavelength: 548 nm) at the 5 'end, and a probe for Salmonella type III ssaN gene The probe for the gene (SEQ ID NO: 9) was labeled with TAMRA (maximum absorption wavelength: 555 nm, maximum emission wavelength: 585 nm) at the 5'end and probe CY5 Absorption wavelength: 650 nm, maximum emission wavelength: 670 nm). At the 3 'end of these probes, EBQ (Excellent Bioneer Quencher), a small mineral, was labeled. Meanwhile, the fluorescent substance and the small-molecule substance for labeling the probe are not limited to the above-mentioned examples, and it goes without saying that various fluorescent substances and small-molecule substances known in the art may be used.

The real-time PCR method is applied to the PCR technique using such a fluorescent substance and a small-molecule substance. It amplifies the target gene present in the sample during the reaction and detects the emission level of the fluorescent substance in real time, Thereby enabling the rapid and accurate analysis of the amplification of the target gene and its aspects. The basic principle of real-time PCR lies in the detection and quantification of fluorescence, which is performed in real time every PCR cycle by the principle of polymerase and fluorescence resonance energy transfer (FRET).

Quantification in real-time PCR is a method of measuring the amplification product in real time within the exponential phase by monitoring the progress of each cycle during PCR. In this case, important concept is Ct (threshold cycle) or Cp point. This value is the number of cycles at which the intensity of fluorescence generated by the double-labeled probe described above increases markedly beyond the baseline level, indicating the initial amount of the target gene (in the case of the present invention the number of copies of the glgC gene, speC gene, fljB gene and Salmonella type III ssaN gene). Thus, PCR amplification of a sample containing glgC gene, speC gene, fljB gene and Salmonella type III ssaN gene was performed to measure the change in fluorescence intensity of the fluorescent substance over the entire PCR amplification period and to determine the number of PCR reactions Cp value or Ct value), and a standard curve of fluorescence intensity was obtained. Then, whether or not the glgC gene, the speC gene, the fljB gene and the Salmonella type III ssaN gene were present and the initial amount of these genes contained in the sample were quantitatively Can be analyzed.

In this example, the synthetic genes (glgC, speC, fljB and ssaN synthetic genes) prepared in Example 1 were subjected to real-time PCR reaction conditions shown in Table 7 below under the composition of a real- (GlgC gene, speC gene, fljB gene and Salmonella type III ssaN gene) were determined based on the Ct value.

Real-time PCR reaction conditions Denaturation 95 ° C, 5 minutes 40 cycles Denaturation 95 ° C, 10 seconds Annealing and extension (data collection) 60 ° C, 45 seconds

Real-time PCR was performed on the synthetic genes prepared in Example 1, and fluorescence intensity was measured for each reaction cycle by measuring the fluorescence value each time the real-time PCR amplification reaction was repeated. For example, the fluorescence value was measured at the FAM wavelength of the glgC gene of Salmonella Galina room, the fluorescence value was measured at the JOE wavelength of Salmonella type III ssaN gene, and the fluorescent value was measured at the Cy5 wavelength of fluorescence of Salmonella typhimurium fljB gene. And the fluorescence value was measured at the TAMRA wavelength in the case of the speC gene of Salmonella Galina Room and Salmonella puromoleum. The results are shown in Fig.

As can be seen in Figure 1, each combination of primer pairs and probes in Table 5 designed for use in real-time PCR amplification of the glgC gene, Salmonella type III ssaN gene, fljB gene and speC gene, respectively, The target gene was effectively amplified and the fluorescence intensity curve for the amplification cycle was also suitable for the determination of the presence of each target gene and for quantitative analysis. In other words, it was possible to clearly distinguish four reactants having their own emission wavelengths (four emission wavelengths can be identified), and it was confirmed that the four reactants were not false or negative.

Therefore, when multiple real-time PCR is performed using the combination of the primer pair and the probe set forth in Table 5 designed in Example 2, the presence of the glgC gene and the speC gene in the specimen causes the poultry typhus causing bacteria Salmonella enterica species, which is a cause of food poisoning in humans due to the presence of the fljB gene of Salmonella typhimurium in the specimen, can be detected not only in Salmonella Galina room, Can also be detected at the same time, and the presence of the Salmonella type III ssaN gene in the sample can detect Salmonella spp. Including Salmonella infection causing bacteria.

On the other hand, when the speC gene of the Salmonella Galina Room and Salmonella glomerosa is detected in the specimen and the glgC gene of the Salmonella Galina Room is detected as a result of the multiple real-time PCR, the specimen can be determined to be infected with Salmonella Galina Room, The speC gene of the Salmonella Galina Room and Salmonella glomerum can be detected in the specimen, but when the glgC gene of the Salmonella Galina Room is not detected, the specimen can be determined to have been infected by Salmonella poolorum.

Example 4: Salmonella specificity evaluation test of the method for detecting Salmonella infection causing causative bacteria of the present invention

In order to evaluate the specificity of the simultaneous detection method of Salmonella infectious agents as described above, the microorganisms were distributed from the BRC and the National Institute of Pathogenic Resources as shown in Table 8 below. A real-time PCR amplification reaction was performed using the nucleic acid extracted from the pre-isolated microorganism as a template and the combination of the primer pair and the probe in Table 5 to confirm the cross-reaction. Real-time PCR amplification experiments were conducted with the compositions and conditions as described in Table 6 and Table 7.

Real-time PCR using combinations of primer pairs and probes shown in Table 5 was performed on the nucleic acids extracted from the microorganisms of Table 8 without Salmonella microorganisms. As a result, the positive values were not confirmed and no cross-reaction was observed with other microorganisms (Fig. 2). That is, it can be seen that the simultaneous detection method of the Salmonella infection causing bacteria of the present invention can specifically detect Salmonella causative microorganisms associated with Salmonella infection even if various microorganisms are included in the specimen in addition to the Salmonella genus.

Therefore, even when the microorganisms causing food poisoning or algae pollution are difficult to be determined by contamination of meat, eggs, food, etc. with various microorganisms, the present invention can specifically detect only Salmonella spp. Without crossing reaction with other microorganisms It is useful for establishing customized anti-virus measures.

Applicable microorganisms for the evaluation of specificity Sales number Microbial species Sales number Microbial species KCTC * 1038 Cellulomonas flavigena KCTC 17121 Candida tropicalis KCTC 11508 Bacillus thuringiensis KCTC 17144 Pichia guilliermondii KCTC 12510 Proteus mirabilis KCTC 17214 Candida parapsilosis KCTC 12834 Sphingomonas paucimobilis KCTC 17219 Candida glabrata KCTC 13002 Bacillus amyloliquefaciens KCTC 17277 Issatchenkia orientalis KCTC 13173 Lactobacillus crispatus NCCP ** 10668 Bacillus subtilis KCTC 13178 Lactobacillus gasseri KCTC 13410 Lactobacillus crispatus NCCP 14038 Escherichia coli (EPEC) KCTC 13515 Lactobacillus vaginalis NCCP 14039 Escherichia coli (EAEC) KCTC 15054 Lactobacillus crispatus NCCP 14043 Bacillus cereus KCTC 15194 Lactobacillus jensenii NCCP 14541 Escherichia coli O157 KCTC 16143 Aspergillus flavus NCCP 14796 Bacillus cereus KCTC 16596 Aspergillus oryzae KCTC 15240 Atopobium vaginae KCTC 16983 Aspergillus oryzae KCTC 16682 Aspergillus flavus KCTC 16984 Aspergillus flavus KCTC 17427 Candida dubliniensis

* KCTC: Korean Collection for Type Culture

** NCCP: National Institute of Pathology

Taken together, the present invention provides a method for rapid and accurate detection of salmonella, including salmonella typhimurium, which causes food poisoning in humans, as well as Salmonella gallinarum and Salmonella spp. It is possible to detect specificity and sensitivity based on the quantified data, and it is possible to identify the causative bacteria of food poisoning or avian influenza virus early, and to contribute to establishment of efficient and customized anti-virus measures.

In particular, the effect of the detection method of Salmonella infection causing bacteria of the present invention, which can specifically detect Salmonella species bacteria without cross-reacting with other microorganisms, can be effectively used for preventing food poisoning and algae It is very technical in view of the fact that it is difficult to identify the causative microorganisms, and the delayed establishment of the microbiological cause is delayed and the establishment of the preventive measures is delayed.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> National Institute of Environmental Research          SNC Co., LTD.          YOON, Hyun Kyu <120> Method and kit for detecting bacteria causing salmonella          infection using real-time PCR <130> N-P16-0002KR <160> 16 <170> KoPatentin 3.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> glgC forward primer <400> 1 agaacctgga tattattcgt cgcta 25 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> glgC reverse primer <400> 2 cgcgcccttt tcaaaacat 19 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> glgC probe <400> 3 atgtcgtcat cctggcaggc ga 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ssaN forward primer <400> 4 cgccagaagc gtgctttt 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ssaN reverse primer <400> 5 gggcaacgag tgggtatttt 20 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> ssaN probe <400> 6 cccacgccag gagcaga 17 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> speC forward primer <400> 7 gtcaaccacc agtgggata 19 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> speC reverse primer <400> 8 ctgggcattg acgcaaa 17 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> speC probe <400> 9 agcagtttgc aacgggcga 19 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> FljB forward primer <400> 10 gtaacgctaa cgacggtatc tc 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FlJB reverse primer <400> 11 ggtgctgtta gcagactgaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > fljB probe <400> 12 tgcagcgtgt gcgtgaactg 20 <210> 13 <211> 143 <212> DNA <213> Artificial Sequence <220> <223> S. gallinarum glucose-1-phosphate adenylyltransferase (glgC)          pseudogene synthetic gene <400> 13 ggtgacccag aacctggata ttattcgtcg ctataaagcg gaatatgtcg tcatcctggc 60 aggcgatcat atctacaagc aggactactc gcgtatgttt tgaaaagggc gcgcgttgca 120 cggtggcctg tatgccggtg ccg 143 <210> 14 <211> 184 <212> DNA <213> Artificial Sequence <220> <223> S. gallinarum, S. pullorum ornithine decarboxylase (speC)          pseudogene synthetic gene <400> 14 acggcttgcc gtcaaccacc agtgggataa agggctgaag cagtttgcaa cgggcgagaa 60 tggctttgcg tcaatgccca gcgcaacgca ctccgcccac aggcggcgac cgctctcccc 120 ttcgtggatt ttggcattga catccagcgc cgcaaacagc gggtagaaca gactggttga 180 agca 184 <210> 15 <211> 120 <212> DNA <213> Artificial Sequence <220> <223> Salmonella type III secretion system ATPase (ssaN) synthetic gene <400> 15 catcgccaga agcgtgcttt tccccacgcc aggagcagaa aaaataccca ctcgttgccc 60 ttcgccacag gtcgcaacgc tatcaatagc gcgaatcccc gtcattaatg gttgagtgat 120                                                                          120 <210> 16 <211> 180 <212> DNA <213> Artificial Sequence <220> <223> S. enterica Typhimurium strain flagellin (fljB) synthetic gene <400> 16 ctgactcagg cttcccgtaa cgctaacgac ggtatctcca ttgcgcagac cactgaaggc 60 gcgctgaacg aaatcaacaa caacctgcag cgtgtgcgtg aactggcggt tcagtctgct 120 aacagcacca actcccagtc tgacctcgac tccatccagg ctgaaatcac ccagcgcctg 180                                                                          180

Claims (12)

As a test kit for Salmonella infectious disease using multiple real-time PCR (PCR)
A combination of primers and probes for specifically detecting the glgC (glucose-1-phosphate adenylyltransferase) gene in the Salmonella Galina Room comprises a primer pair of SEQ ID NOs: 1 and 2, an oligonucleotide of SEQ ID NO: 3 or a complementary oligonucleotide A first combination with a probe,
A combination of a primer and a probe for specifically detecting a speC (ornithine decarboxylase) gene in a Salmonella Galina room and a Salmonella pool, a pair of primers of SEQ ID NOs: 7 and 8, and an oligonucleotide of SEQ ID NO: 9 or a complementary oligonucleotide A second combination with the probe,
As a combination of primers and probes for specifically detecting the fljB gene of Salmonella typhimurium, a third combination of the primer pairs of SEQ ID NOs: 10 and 11 and an oligonucleotide of SEQ ID NO: 12 or a complementary oligonucleotide probe thereof ,
A combination of primers and probes for specifically detecting the Salmonella type III ssaN (type III secretion system ATPase) gene of Salmonella genus includes a pair of primers of SEQ ID NOS: 4 and 5, and an oligonucleotide of SEQ ID NO: 6 or a complementary oligonucleotide A fourth combination with a probe,
Each probe constituting the combination of the primer and the probe is labeled with a labeling substance detectable at different wavelengths,
Wherein one reaction vessel is provided for performing multiple real-time PCR including all combinations of said primer and said probe,
As a result of the multiple real-time PCR, the combination of the primers and probes can be carried out without cross-reacting with the glgC gene of the Salmonella Galina Room, the speC gene of Salmonella Galina Room and Salmonella glomerosa, the fljB gene of Salmonella typhimurium, A kit for detecting salmonella infection causing bacteria in a spermatozoon using multiple real-time PCR, characterized in that Salmonella type III ssaN gene is specifically detected. delete The method according to claim 1,
A kit for detecting Salmonella infectious disease bacteria using multiple real-time PCR, further comprising DNA polymerase, dNTPs and PCR buffer solution. The method according to claim 1,
Wherein the labeling substance is labeled at one end of a probe constituting each combination of the primer and the probe. Preparing a gene sample from a specimen,
Amplifying the gene sample by multiple real-time PCR using the kit for detecting Salmonella infectious disease bacteria using the multiple real-time PCR according to any one of claims 1, 3, and 4; Wow,
Detecting the Salmonella infection causing bacteria in the sample based on the multiple real-time PCR results,
As a result of the multiple real-time PCR, the combination of the primers and probes can be carried out without cross-reacting with the glgC gene of the Salmonella Galina Room, the speC gene of Salmonella Galina Room and Salmonella glomerosa, the fljB gene of Salmonella typhimurium, A method for detecting Salmonella infectious agent bacteria using multiple real-time PCR, characterized in that Salmonella type III ssaN gene is specifically detected. 6. The method of claim 5,
When the speC gene of Salmonella Galina Room and Salmonella glomerosa is detected in the specimen as a result of multiple real-time PCR and the glgC gene of Salmonella Galina Room is detected, the specimen is determined to be infected with Salmonella Galina Room,
Wherein said specimen is determined to have been infected by Salmonella glomerum when the speC gene of said Salmonella Galina Room and Salmonella glomerosa is detected in said specimen but the glgC gene of said Salmonella Galina Room is not detected. Methods for the detection of Salmonella infectious pathogens using time PCR. The method according to claim 6,
Before amplification, a gene sample known to have the number of copies of the glgC gene of the Salmonella Galina Room, the speC gene of the Salmonella Galina Room and Salmonella glomerosa, the fljB gene of Salmonella typhimurium, and the Salmonella Type III ssaN gene of the Salmonella genus The positive standard is a kit for detecting Salmonella infectious disease bacteria using the multiple real-time PCR described in any one of claims 1, 3, or 4, a glgC gene of the Salmonella galina room to be amplified, a Salmonella Galina room, Amplification by multiplex real-time PCR using a marker substance indicating the amount of gene amplification in relation to the speC gene of salmonella pool room, the fljB gene of Salmonella typhimurium, and Salmonella type III ssaN gene of Salmonella genus Wow,
Measuring a change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;
Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in fluorescence intensity of the labeling substance;
The whole PCR of the glgC gene of the Salmonella galina room, the speC gene of Salmonella Galina room and Salmonella gloruma room, the fljB gene of Salmonella typhimurium, and Salmonella type III ssaN gene of the Salmonella genus, which are present in the gene sample of the specimen, Measuring the change in fluorescence intensity of the labeling substance with respect to the amplification period and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;
The glgC gene of the Salmonella Galina Room, the Salmonella Galina Room and the speC gene of Salmonella puromylum, the fljB gene of Salmonella typhimurium, and the Salmonella type III ssaN gene of Salmonella typhimurium present in the sample of the specimen were subjected to PCR amplification And quantitatively measuring the Cp value or the Ct value obtained by the method according to the number of copies of the positive standard in the sample to determine whether the infection is caused by Salmonella infection causing bacteria. delete delete delete delete delete

Images