KR20130137781A - Multiplex pcr kits and primers of the differentiation and simultaneous detection for 3 serovars of choleraesuis, enteritidis, typhimurium in salmonella - Google Patents

Abstract

The present invention relates to a primer set for detecting salmonella common genes and screening three salmonella serotypes, a multiplex polymerase chain reaction kit including the primer set, and a method for detecting salmonella common genes and screening three salmonella serotypes using the kit, and more particularly, to: (1) a primer set for detecting salmonella common genes comprising a forward primer of sequence number 1 and a reverse primer of sequence number 2; (2) a primer set for detecting S. Typhimurium comprising a forward primer of sequence number 3 and a reverse primer of sequence number 4; (3) a primer set for detecting S. Choleraesuis comprising a forward primer of sequence number 5 and a reverse primer of sequence number 6; (4) a primer set for detecting S. Choleraesuis comprising a forward primer of sequence number 7 and a reverse primer of sequence number 8; a multiplex polymerase chain reaction kit including a primer set from (1) to (4); and a method for detecting salmonella common genes and screening three salmonella serotypes using the kit.

Description

A primer set for detecting Salmonella common gene and three Salmonella serotypes, a multiple polymerase chain reaction kit including the primer set, and Salmonella common gene detection using the kit and three Salmonella serotype diagnosis methods PCR kits and primers of the differentiation and simultaneous detection for 3 serovars of Choleraesuis, Enteritidis, Typhimurium in Salmonella}

The present invention provides a primer set for detecting Salmonella common genes and three Salmonella serotypes, a multiple polymerase chain reaction kit including the primer sets, and Salmonella common gene detection and three Salmonella serotype diagnosis using the kit. More specifically, the method relates to (1) a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and (2) SEQ ID NO: A primer set for detecting S. Typhimurium consisting of a forward primer of 3 and a reverse primer of SEQ ID NO: 4, (3) A primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, (4) S. Enteritidis detection consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8 Primer set, to a multi-PCR kit, and Salmonella and Salmonella serotypes common gene detection method for assessing the three kinds of using the kit comprising the primer set of the primer set to (4) of the above (1).

Salmonella is a Gram-negative, motility anaerobic bacillus that can grow at 7-45 ° C. To date, more than 2,500 serotypes are known, including Salmonella Enteritidis (S. Enteritidis), Salmonella Choleraesuis (S. Choleraesuis), and Salmonella Typhimurium (S. Typhimurium) is known as a major pathogen causing disease in humans and livestock.

Salmonella is one of the most common causes of food poisoning, not only domestically but also worldwide. Salmonella food poisoning caused by Salmonella can be caused by eating contaminated food or by direct contact with an animal infected with Salmonella. In 2006, CDC data from the US showed that S. Typhimurium was the most isolated of Salmonella serotypes in pigs (36%) and S. Choleraesuis (9%). In chickens, S. Enteritidis (34.4%) and S. Typhimurium (10.3%) were isolated.

In Korea, S. Typhimurium was the most identified as a result of identifying Salmonella serotypes isolated from pigs from 2006 to 2010. Meanwhile, Salmonella serotypes isolated from domestic food poisoning patients for 10 years from 1998 S. Enteritidis and S. Typhimurium accounted for the majority.

In Korea, the serotype that causes Salmonella disease in pigs is mainly S. Typhimurium. In addition, it is considered to be very important public health as a cause of common infectious diseases that cause food poisoning in humans through meat. S. Choleraesuis is excreted in pig feces and survives for many years in the soil. In humans, the infection is not very good, but when the infection causes severe sepsis, it is a very deadly pathogen. S. Typhimurium makes up the majority of domestic salmon Salmonella, while S. Choleraesuis, which causes systemic sepsis, is rarely reported in Korea despite the large number of isolates worldwide. However, in consideration of the introduction of food, sows, etc. from abroad, it is necessary to take thorough measures against the causative agents such as Salmonella serotypes.

Among Salmonella serotypes, S. Enteritidis is the serotype of Salmonella food poisoning most frequently isolated in Korea from 1998 to 2007. It was also reported as the world's most identified non-typhoid Salmonella from 2000 to 2002. S. Enteritidis also has a very broad host range that infects not only humans but also poultry and mammals, causing disease. Human S. Enteritidis infectious agents have been investigated with chicken and eggs obtained from chickens.

Salmonella serotype identification to identify Salmonella serotypes is identified by plate aggregation and in vitro aggregation using antisera against cell antigens and flagellan antigens. However, this method is only available in laboratories with expensive antisera, requires a skilled expert in experiments and takes a long time. In addition, about 5 to 8% of isolates have not been accurately identified due to the loss of surface antigens. Therefore, more stable genetic diagnostic methods are used to identify Salmonella serotypes. Currently, polymerase chain reaction (PCR) has been reported as a useful method to replace Salmonella serotype identification using antiserum because it is rapid and simple.

Therefore, the present inventors newly prepared a specific primer capable of discriminating between Salmonella common gene (invA) and three Salmonella serotypes S. Enteritidis, S. Choleraesuis, and S. Typhimurium, and using the primer and a kit including the same. Multiple polymerase chain reaction enables rapid and accurate diagnosis of Salmonella common gene (invA) and three Salmonella serotypes, S. Enteritidis, S. Choleraesuis, and S. Typhimurium, enabling the diagnosis of Salmonella infection. . In addition, the specificity and sensitivity of the Salmonella infection using the kit containing the primers were compared with the Animal Disease Standard Test Method and Standard Technology Utilization Data of the Ministry of Agriculture, Forestry and Fisheries Quarantine Inspection Division, and supplied the reagents required for the reaction in a dry form. The present invention was completed by improving the shelf life while maintaining the diagnostic ability equally.

Meanwhile, as a prior art related to the present invention, Korean Patent Publication No. 2007-0054794 discloses a method for identifying single-phase flagellar Salmonella serotypes using hin gene specific PCR, and a primer set therefor.

In addition, Korean Patent Publication No. 2009-0122554 Salmonella typhimurium (Salmonella typhimurium) primer set for detecting, Salmonella typhimurium detection kit comprising the primer set, Salmonella typhimuri in the sample using the primer set A method for detecting Umm, an oligonucleotide probe for Salmonella typhimurium detection, and a microarray to which the probe is immobilized are shown.

Also, Korean Patent Publication No. 2010-0011563 discloses a primer set capable of detecting Salmonella typhi more quickly, a Salmonella typhi detection kit including the same, and a method for quickly detecting whether Salmonella typhi is infected using the same. It provides to provide.

However, a primer set for detecting Salmonella common gene and three Salmonella serotypes, a multiple polymerase chain reaction kit including the primer set, and Salmonella common gene detection using the kit and three Salmonella serotype diagnosis methods In contrast with the present invention shown, the prior art is an invention in which the technical features of the invention are different from each other and the configuration of the invention is different.

An object of the present invention is to provide a diagnostic primer used for multiple polymerase chain reaction (PCR) to quickly and accurately diagnose Salmonella common gene ( invA ) and three Salmonella serotypes S. Enteritidis, S. Choleraesuis and S. Typhimurium. I would like to.

Another object of the present invention is a kit for simultaneously detecting Salmonella common gene ( invA ) and three Salmonella serotypes S. Enteritidis, S. Choleraesuis, and S. Typhimurium, and all reagents required for PCR reaction are mixed in one test dose. It is intended to provide a PCR kit that can be easily diagnosed three Salmonella serotypes even if the skilled person is dispensed and dried.

Another object of the present invention is to quickly detect salmonella infection from livestock using a kit comprising a Salmonella common gene ( invA ) and a primer for detecting three Salmonella serotypes, S. Enteritidis, S. Choleraesuis, and S. Typhimurium. In this regard, we will provide a diagnostic method that can be known accurately.

The first invention of the present invention (1) a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, (2) SEQ ID NO: 3 A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 4 and a reverse primer of SEQ ID NO: 4, (3) A primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, (4) A primer set for detecting S. Enteritidis consisting of a forward primer of No. 7 and a reverse primer of SEQ ID NO: 8 is provided.

The second invention of the present invention is to provide a multiple polymerase chain reaction kit that can be confirmed whether the Salmonella infection by including the primer set of (1) to the primer set of (4).

The third invention of the present invention is the Salmonella common gene (invA) detection using the multiple polymerase chain reaction kit comprising the primer set of (1) to the primer set of (4) and three Salmonella serotypes of S. Typhimurium, S. Choleraesuis and S. Enteritidis are diagnosed to provide a rapid and accurate diagnosis of Salmonella infection.

The present invention can easily detect the presence or absence of Salmonella infection from livestock using the kit containing the primers, the primers for detecting Salmonella common gene and three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis. At the same time, three Salmonella serotypes, S. Typhimurium, S. Choleraesuis and S. Enteritidis, were able to be discriminated without antiserum aggregation.

In addition, according to the present invention, the presence or absence of Salmonella infection on livestock within 2 hours can be confirmed quickly and simply, and even a small number of Salmonella existing in livestock can be detected.

1 is a result of multiplex polymerase chain reaction using DNAs of three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis to compare the reaction mode of the liquid mixture and the dry kit of the present invention (Lane M). : 100bp DNA ladder, 1: liquid mixture, 2: dry kit of the present invention, N: negative control.
Figure 2 is a result of measuring the sensitivity through the multiple polymerase chain reaction of the present invention (Lane M: 100bp DNA ladder, 1 to 7: Salmonella serotypes of S. Typhimurium, S. Choleraesuis and S. Enteritidis 1 Decimal step dilution, N: negative control) for each lane from × 10 ^{8 to} 1 × 10 ² CFU / mL.
Figure 3 is the sensitivity measurement results of the multiplex polymerase chain reaction according to the standard technology utilization data currently used by the Ministry of Agriculture, Forestry and Fisheries Quarantine Inspection Division to distinguish between S. Typhimurium and S. Enteritidis, which are the most important food poisoning bacteria in humans and the main pathogens in livestock (Lane M, 100bp DNA ladder; 1-7: 3 Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis each lane up to 1 × 10 ⁸ -1 × 10 ² CFU / mL Decimal step dilution, N: negative control.

The first invention of the present invention shows a set of primers for detecting Salmonella consensus genes and differentiating three Salmonella serotypes.

The first invention of the present invention represents a primer set for detecting Salmonella common gene (invA) and selectively discriminating or simultaneously discriminating three Salmonella serotypes, S. Typhimurium, S. Choleraesuis and S. Enteritidis.

The present invention represents a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO. 1 and a reverse primer of SEQ ID NO.

The present invention shows a primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4.

The present invention shows a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6.

The present invention shows a primer set for detecting S. Enteritidis consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8.

The present invention provides a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, Selective detection of Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis by including a primer set for detecting S. Enteritidis consisting of a forward primer and a reverse primer of SEQ ID NO: 8 A primer set that can be detected simultaneously or simultaneously is shown.

Salmonella common gene (InvA; GenBank accession No. EU348369.1), S. Enteritidis gene (GenBank accession No. AF370716.1), S. Choleraesuis gene (GenBank accession No. AE017220.1), S Among the base sequences of Typhimurium gene (GenBank accession No. AE006468.1), base sequences were arbitrarily selected such that the length was 22 bp and the Tm value was 60-65 ° C., which was used as a forward primer and a reverse primer. Tm values were checked using the MP primer program (see Table 1).

Salmonella common gene and three serotype gene primers Item Base sequence Remarks Salmonella common gene (inVA) F: TCTCCCCCTCTTCATGCGTTAC SEQ ID NO: 1 R: CCTTTGACGGTGCGATGAAGTT SEQ ID NO: 2 S.T F: CCGCTGACCCAAAAGCTGGGTT SEQ ID NO: 3 R: ACCTCAATGGCGGAACCATGCC SEQ ID NO: 4 S.C F: AGCTGCGTCAGGAAGATCGTAT SEQ ID NO: 5 R: ATCTAAGCTAGCCTCTGGCGTC SEQ ID NO: 6 S.E F: GCGTGCCGGGGATGAGCATAAA SEQ ID NO: 7 R: TTGCAGAGCTCCGCCAGCTTTC SEQ ID NO: 8

* In Table 1, F of the base sequence represents a forward primer, and R represents a reverse primer.

** In Table 1, ST means S. Typhimurium, SC means S. Choleraesuis, and SE means S. Enteritidis.

The second invention of the present invention represents a multiple polymerase chain reaction kit comprising the primer set of the first invention.

A second invention of the present invention represents a multiple polymerase chain reaction kit comprising a set of primers for detecting Salmonella common genes and discriminating three Salmonella serotypes.

The second invention of the present invention comprises a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, forward primer with the sequence number to to include S. Enteritidis detection primer set for the reverse primer consisting of Salmonella common gene (invA) and the type of the 8 Salmonella sera of the three S. Typhimurium, S. Choleraesuis and S. Represents a multiple polymerase chain reaction kit comprising a set of primers that can selectively detect or simultaneously detect Enteritidis.

The second polymerase chain reaction kit of the second invention can determine whether Salmonella is infected with a sample using a livestock sample, wherein the livestock may be pig, cow, chicken, duck, goat or sheep.

The third invention of the present invention shows a Salmonella common gene detection and three Salmonella serotype diagnosis method using a multiple polymerase chain reaction kit comprising the primer set.

The third invention of the present invention comprises a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, Selective detection of Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis by including a primer set for detecting S. Enteritidis consisting of a forward primer and a reverse primer of SEQ ID NO: 8 Salmonella common gene detection and three Salmonella serotype diagnosis methods which can be detected simultaneously or simultaneously are shown.

Said third invention is capable of selectively or simultaneously detecting Salmonella common gene (invA) and three Salmonella serotypes, S. Typhimurium, S. Choleraesuis and S. Enteritidis, from livestock as samples. Salmonella infection of the can be confirmed, wherein the livestock may be pigs, cattle, chickens, ducks, goats or sheep.

Common Salmonella common gene detection and primer set for discriminating the three Salmonella serotypes, multiple polymerase chain reaction kit comprising the primer set and Salmonella common gene detection using the kit and three Salmonella serotype diagnosis In order to achieve the object of the present invention, the method was performed under various conditions of the method, and a primer set for detecting Salmonella common genes and three Salmonella serotypes under the conditions mentioned above, and a multiple polymerization including the primer set It is desirable to provide an enzyme chain reaction kit and Salmonella common gene detection and three Salmonella serotype diagnostic methods using the kit.

Hereinafter, the content of the present invention will be described in detail through examples. It should be understood, however, that these examples are provided for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1 Template DNA Preparation

Template DNA was first extracted in order to perform multiple polymerase chain reaction. The strains used were ATCC 13076 ( S. Enteritidis), ATCC 7001 ( S. Choleraesuis), and ATCC 14028 ( S. Typhimurium) strains from the American Type Culture Collection (ATCC), and used for blood medium (Sheep blood agar plate, Asan Pharmaceutical). Co., Ltd.) was inoculated with 100 μl of the strain suspension and incubated at 37 ° C. for 16 hours.

Thereafter, colonies were taken and DNA was extracted using a DNeasy Blood & Tissue kit (Qiagen, USA). After measuring the concentration and purity with a UV spectrophotometer, the DNA was confirmed to have a purity of 1.8 to 2.0, and then used as a template DNA in a multiple polymerase chain reaction.

The template DNA was diluted to 10ng / μl using 1 × TE buffer (10mM Tris-HCl pH 8.0, 0.1mM EDTA) for easy use in multiplex polymerase reaction and stored at -70 ° C until the next use.

Example 2 Primer Design

Salmonella common gene (InvA; GenBank accession No. EU348369.1) and three serotypes S. Enteritidis gene (GenBank accession No. AF370716.1), S. Choleraesuis gene (GenBank accession No. AE017220.1), S. Between the base sequences of Typhimurium gene (GenBank accession No. AE006468.1), the base sequence was selected such that the length was 22 bp and the Tm value was 60-65 ° C., thereby making it a forward primer and a reverse primer. Tm values were checked using the MP primer program (see Table 2).

Salmonella common gene and three serotype gene primers Item Base sequence Remarks Salmonella common gene (inVA) F: TCTCCCCCTCTTCATGCGTTAC SEQ ID NO: 1 R: CCTTTGACGGTGCGATGAAGTT SEQ ID NO: 2 S.T F: CCGCTGACCCAAAAGCTGGGTT SEQ ID NO: 3 R: ACCTCAATGGCGGAACCATGCC SEQ ID NO: 4 S.C F: AGCTGCGTCAGGAAGATCGTAT SEQ ID NO: 5 R: ATCTAAGCTAGCCTCTGGCGTC SEQ ID NO: 6 S.E F: GCGTGCCGGGGATGAGCATAAA SEQ ID NO: 7 R: TTGCAGAGCTCCGCCAGCTTTC SEQ ID NO: 8

* In Table 2, F of the base sequence represents a forward primer, and R represents a reverse primer.

** In Table 2, ST means S. Typhimurium, SC means S. Choleraesuis, and SE means S. Enteritidis.

Example 3 Standard Template Polymerase Chain Reaction

The primer sets consisting of the respective forward and reverse primers for Salmonella common gene and three serotypes S. Typhimurium, S. Choleraesuis, and S. Enteritidis mentioned in Table 2 of Example 2 were combined Using a primer set, the Gene ^Amp® PCR system 9700 (manufactured by Applied Biosystem, USA) was subjected to multiple polymerase chain reaction.

Using the Salmonella DNA extracted in Example 1 as a template, each of the forward primers for Salmonella common gene and three serotypes S. Typhimurium, S. Choleraesuis, and S. Enteritidis mentioned in Table 2 of Example 2, and After combining the primer set consisting of the reverse primer, the DNA of Salmonella extracted in Example 1 was added to the template, and then subjected to multiple polymerase chain reaction using Gene Amp ^ㄾ PCR system 9700 (Applied Biosystem, USA). At this time, the polymerase chain reaction conditions were denatured at 95 ° C. for 5 minutes, followed by 30 cycles at 95 ° C. and 1 minute 30 seconds at 65 ° C. for 30 cycles and 72 ° C. for 5 minutes.

Example 4 Multiple Polymerase Chain Reaction Using Lyophilized PCR Composition

PCR mixtures of the same composition as in Example 2 and Example 3 were prepared, lyophilized and then subjected to multiple polymerase chain reaction. This is to confirm that PCR performance is not affected by the lyophilization conditions of the reagents, and to provide Salmonella common genes and three serotype diagnostic kits with improved ease of use and reproducibility.

Reagents required for PCR were mixed with a ^AccuPower® Gold Multiplex PCR Premix ( ^Bionase , Korea) and a set of Salmonella common genes detected in Example 3 and a set of three serotype primers, and then aliquoted into 96 well plates. SuperCentra2 Freeze-dried (vacuum degree: -76 cmHg) for 50 minutes using (Bionia Co., Ltd., Korea) to obtain a PCR composition. The salmonella DNA extracted in Example 1 was added to the lyophilized PCR composition as a template, and the lyophilized product was mixed so that the total volume was 20 µl with sterile distilled water and completely dissolved. Gene ^Amp® PCR system 9700 (Applied Biosystem, USA) was used to perform multiple polymerase chain reaction under the same reaction conditions mentioned in Example 3.

As shown in FIG. 1, the result of comparing multiple polymerase chain reactions using the kit with respect to the liquid PCR mixed solution of Example 3 and the dry PCR composition of Example 4 showed an equivalent result (Lane M: 100bp DNA ladder, 1 : Liquid mixture, 2: lyophilized kit of the present invention, N: negative control).

Example 5 Sensitivity of Salmonella Diagnosis of the Present Invention

Agriculture, forestry and fisheries quarantine by the methods of Example 3 and 4 using ATCC 13076 ( S. Enteritidis), ATCC 7001 ( S. Choleraesuis), and ATCC 14028 ( S. Typhimurium) strains from the American Type Culture Collection (ATCC) Sensitivity and isolation of Salmonella cholera suis from the Standard Technology Utilization Data of the Inspection Center (2010) were compared and their sensitivity is shown in FIGS. 2 and 3.

The Salmonella diagnostic method of the present invention using the kit including the primer set of Table 2 (see FIG. 2) and the Salmonella test method (see FIG. 3) of standard technology utilization data detect the Salmonella template DNA to 1 × 10 ⁴ CFU / ml. 2, 3, lane M: 100 bp DNA ladder, 1-7: Salmonella template DNA 1 × 10 ^8-1 × 10 ² CFU / ml, N: negative control. Therefore, the Salmonella diagnosis method according to the present invention and the test method using the existing standard technology utilization data confirmed that the sensitivity for Salmonella measurement is equivalent.

However, the Salmonella diagnosis method of the present invention using the kit including the primer set of Table 2 (FIG. 2) is possible to discriminate between S. Enteritidis and S. Typhimurium, which are the major serotypes of Salmonella infection, while the Standard Technology of the Ministry of Agriculture, Forestry and Fisheries Quarantine and Inspection Center As a measurement method using the utilization data (Fig. 3), it is difficult to distinguish between the two types of S. Enteritidis and S. Typhimurium.

Example 6 Specificity of Salmonella Diagnosis of the Present Invention

Salmonella diagnosis of the present invention using a kit comprising the primer set of Table 2 using 40 strains of Salmonella standard strain (see Table 3) and 16 strains of bacteria other than Salmonella (see Table 4) stored in the Agriculture, Forestry and Fisheries Quarantine and Inspection Center The specificity of the method was investigated.

As shown in Table 3 below, all Salmonella standard strains tested have the invA gene, which is a Salmonella common gene, and S. Enteritidis, S. Choleraesuis, and S. Typhimurium, which are the main serotypes of the present invention, are invA, which is a common Salmonella gene, and Specific amplification products were formed.

In addition, as shown in Table 4, all bacteria except 16 Salmonella showed a negative reaction.

Therefore, the Salmonella diagnostic method of the present invention using the kit including the primer set of Table 2 was confirmed that the presence of Salmonella and at the same time can be discriminated against the main serotypes.

Investigation of specificity of the present invention using Salmonella standard strain Target genes
Or serotype Positive serotype invA
Salmonella
Common genes) Aberdeen, Anatum, Bareilly, Berta, Bradeney, Chester, Choleraesuis, Choleraesuis serovar kunzendorf, Daressalaam, Derby, Dublin, Enteritidis, Essen, Gallinarum, Glostrup, Grumpensis, Hvittingfoss, Illinois, Javiana, Lilleanilondon, Moscow Paratyphi A, Paratyphi B, Pullorum, Reading, Rostock, Rubislaw, Sandiego, Senftenberg, Tallahassee, Tennessee, Thompson, Typhimurium, Typhimurium var. copenhagen, Uganda, Virchow, Virginia Typhimurium Typhimurium, Typhimurium var. copenhagen Choleraesuis Choleraesuis, Choleraesuis serovar kunzendorf Enteritidis Enteritidis

Investigation of specificity of the present invention using bacteria other than Salmonella Examination fungus In the present invention
Reaction result Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter lwoffii, Burkholderia cepacia, Citrobacter freundii, Clostridium perfrigens, Comamonas testosteroni, Enterobacter cloacae, Enterococcus faecalis, Escherichia coli, Klebsiella pneumonia, Mirabilis pactum anus puri All voice

Example 7 Comparison of Diagnostic Efficiency of Salmonella Diagnosis of the Present Invention Using Isolated Strains and Existing Test Methods

The primer sets of Table 2 were selected from 111 strains of Salmonella isolates (36 strains of S. Typhimurium, 6 strains of S. Choleraesuis, 29 strains of S. Enteritidis, and 40 strains of serotypes) isolated from the Ministry of Agriculture, Forestry and Fisheries Quarantine and Quarantine Service. The diagnostic efficiency of Salmonella infection between the Salmonella diagnosis method of the present invention and the existing test method using the kit including the kit was compared.

As shown in Table 5, the existing test method for Salmonella detection was only capable of detecting Salmonella common gene (invA) and S. Choleraesuis, but the present invention is a Salmonella common gene (invA) and three Salmonella serotypes of S. Enteritidis, S. Choleraesuis and S. Typhimurium can be discriminated from each other to confirm that the diagnostic efficiency of Salmonella infection is significantly improved compared to the existing test method.

Comparison of diagnostic efficiency between Salmonella diagnosis of the present invention and conventional test methods Salmonella serotype
(Detection target) Invention Conventional inspection method positivity voice positivity voice S. Typhimurium
(invA + Typhimurium) 36 75 Indistinguishable from Enteritidis S. Choleraesuis
(invA + Choleraesuis) 6 105 6 105 S. Enteritidis
(invA + Enteritidis) 29 82 Indistinguishable from Typhimurium Other serotypes
(invA) 40 0 40 0

Although the preferred embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the invention as disclosed in the accompanying claims. It will be understood that the present invention can be changed.

The present invention can easily detect the presence or absence of Salmonella infection from livestock using the kit containing the primers, the primers for detecting Salmonella common gene and three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis. In addition, three Salmonella serotypes, S. Typhimurium, S. Choleraesuis, and S. Enteritidis, can be discriminated without antisera aggregation.

In addition, according to the present invention, the presence or absence of Salmonella infection to livestock as a sample within 2 hours can be quickly and simply confirmed, and the sensitivity is high, so that even a small number of Salmonella present in the sample can be used industrially.

<110> REPUBLIC OF KOREA (Management: Ministry for Food, Agriculture, Forestry and Fisheries.Animal, Plant and Fisheries Quarantine and Inspection Agency (QIA))          BIONEER CORPORATION <120> Multiplex PCR kits and primers of the differentiation and          simultaneous detection for 3 serovars of Choleraesuis,          Enteritidis, Typhimurium in Salmonella <130> 8810 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella InvA Forward primer <400> 1 tctccccctc ttcatgcgtt ac 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella InvA Reverse primer <400> 2 cctttgacgg tgcgatgaag tt 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella Typhimurium Forward primer <400> 3 ccgctgaccc aaaagctggg tt 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> Salmonella Typhimurium Reverse primer <400> 4 acctcaatgg cggaaccatg cc 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella Choleraesuis Forward primer <400> 5 agctgcgtca ggaagatcgt at 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> Salmonella Choleraesuis Reverse primer <400> 6 atctaagcta gcctctggcg tc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella Enteritidis Forward primer <400> 7 gcgtgccggg gatgagcata aa 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella Enteritidis Reverse primer <400> 8 ttgcagagct ccgccagctt tc 22

Claims (10)

A primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2. A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4. A primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6. A primer set for detecting S. Enteritidis consisting of a forward primer of SEQ ID NO. 7 and a reverse primer of SEQ ID NO. A primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, Selective detection of Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis, and S. Enteritidis by including a primer set for detecting S. Enteritidis consisting of a forward primer and a reverse primer of SEQ ID NO: 8 A set of primers that can be detected simultaneously or simultaneously. In the multiple polymerase chain reaction kit comprising a primer,
The primer is a primer set for detecting Salmonella common gene (invA) consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2;
A primer set for detecting S. Typhimurium consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, a primer set for detecting S. Choleraesuis consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6, S. Enteritidis, consisting of a forward primer and a reverse primer of SEQ ID NO: 8, includes a primer set for detection to selectively select Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis, and S. Enteritidis. Kits that can be detected or detected simultaneously. The method according to claim 6,
The kit is a kit for detecting or simultaneously detecting Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis and S. Enteritidis in livestock. The method of claim 7, wherein
Kits, characterized in that the livestock is pig, cow, chicken, duck, goat or sheep. A method of selectively or simultaneously diagnosing Salmonella common gene (invA) and three Salmonella serotypes S. Typhimurium, S. Choleraesuis, S. Enteritidis from livestock using the kit of claim 6. 10. The method of claim 9,
The livestock is a pig, cow, chicken, duck, goat or sheep.

Images