KR20190087726A - Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene - Google Patents

Abstract

The present invention relates to a nucleic acid molecule simultaneously inhibiting the expression of mTOR gene and STAT3 gene, and an anticancer pharmaceutical composition comprising the same. More specifically, double-stranded siRNA of the present invention, designed to simultaneously inhibit the expression of cancer-related mTOR gene and STAT3 gene in order to make up shortcomings that siRNA does not achieve high therapeutic effects due to the target specificity thereof, has the effect of promoting the death of cancer cells. In addition, the nucleic acid has the effect of synergistically enhancing the death of cancer cells when used in combination with an anticancer agent, thereby being useful as an anticancer composition or anticancer aid against various carcinomas.

Description

[0002] Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene [

The present invention relates to a nucleic acid molecule which simultaneously inhibits the expression of mTOR gene and STAT3 gene, and a pharmaceutical composition for anticancer comprising the same.

Cancer is one of the most deadly diseases worldwide, and the development of innovative cancer treatments can create high added value while reducing the cost of medical care. According to statistics in 2008, the molecular therapy products that can overcome the existing anticancer drug resistance amounted to $ 17.5 billion in seven major countries (US, Japan, France, Germany, Italy, Spain and UK) It is estimated that the market size of $ 45 billion will grow by 9.5% compared to 2008. The treatment of cancer is divided into surgery, radiotherapy, chemotherapy, and biological treatment. Among them, chemotherapy is a chemical substance that suppresses or kills the cancer cell proliferation. Since the toxicity caused by the anticancer drug appears in the normal cells, , And it is necessary to develop an anticancer agent that selectively acts on cancer cells and does not develop resistance because the anticancer agent exhibits the effect that the effect is lost after a certain period of use even if the anticancer agent is effective (Biowave 2004, 6 (19)). Recently, a new anticancer drug targeting the molecular characteristics of cancer has been developed through the securing of molecular genetic information on cancer, and anticancer drugs aiming at characteristic molecular targets possessed only by cancer cells have been developed, There is also a report that does not occur.

Techniques to inhibit the expression of genes are important tools in the development of therapeutic agents for the treatment of disease and in the target validation. RNA interference (RNAi) has been shown to act on sequence-specific mRNAs in a variety of mammalian cells since its discovery (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773). RNAi is a small interfering RNA (hereinafter abbreviated as 'siRNA') with a small interfering ribonucleic acid double-stranded structure with a size of 21-25 nucleotides that specifically binds to a mRNA transcript having a complementary sequence And the expression of a specific protein is inhibited by decomposing the transcript. Within the cell, the RNA double strand is processed by endonuclease Dicer and converted into siRNA of 21-23 base pairs (bp), and the siRNA is bound to RNA-induced silencing complex (RISC) (Antisense) strand recognizes and degrades the target mRNA, thereby specifically inhibiting the expression of the target gene in a sequence-specific manner (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS, Nature Reviews Drug Discovery 2002. 1, 503 -514). According to the Bertrand researchers, siRNAs against the same target gene are superior to the antisense oligonucleotide (ASO) in inhibiting mRNA expression in vivo / in vitro (in vitro and in vivo) (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). The market for siRNA-based RNAi technology-based therapeutics has been analyzed by the global market size to be more than KRW 12 trillion by 2020, and the number of targets to which the technology can be applied has been dramatically expanded to include existing antibodies and compound-based drugs It is being evaluated as a next-generation gene therapy technology that can treat diseases that are difficult to treat. In addition, since the action mechanism of siRNA is complementary to the target mRNA and regulates the expression of the target gene in a sequence-specific manner, it has been known for a long time until the existing antibody-based drug or small molecule drug is optimized for a specific protein target The development period and the development cost of the protein can be significantly extended and the development period can be shortened so that the optimized lead compound can be developed for all the protein targets including the target substance which can not be medicated (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY 2006 13 (4): 664-670). Recently, the ribonucleic acid-mediated interference phenomenon has been proposed to solve the problems that occur in the development of existing chemical synthetic medicine, and to selectively suppress the expression of a specific protein at the transcript level and to use it in the development of various disease treatments, . In addition, siRNA therapeutic agents have the advantage of being able to predict side effects due to their clear targets, unlike conventional anticancer agents. However, these target specificities are not as effective in treating tumors that are diseases caused by various gene problems, It is also a cause.

mTOR (mammalian Target of Rapamycin) is a cytokine-stimulated cell proliferation, translation of mRNA for several key proteins that regulate the G1 phase of the cell cycle, and interleukin-2 (IL-2 ) Inducible transcription, which is an important enzyme in various signal transduction pathways. Inhibition of mTOR leads to inhibition of the progression of the cell cycle from G1 to S. Since mTOR inhibitors exhibit immunosuppression, antiproliferative and anticancer activities, mTOR has been targeted for the treatment of these diseases (Current Opinion in Lipidology, 16: 317-323, 2005). In addition, mTOR is an important factor for autophagy control, and it targets mTOR which regulates autophosphorylation pathway to target various diseases such as cancer, neurodegenerative disease, heart disease, aging, Diseases, etc. (Immunology, 7: 767-777; Nature 451: 1069-1075, 2008).

STAT3 (signal transducer and activator of transcription 3) is a transcription factor that promotes transcription by transferring various growth factors and cytokine signals outside the cell to the nucleus. In this state, the tyrosine residue of the transactivation domain is phosphorylated and activated and enters the nucleus (STAT3 inhibitors for cancer therapy: Have all the roads been explored. Jak-Stat. 2013; 1; 2 (1): e22882). The phosphorylated STAT3 (p-STAT3) binds to nuclear DNA to induce the expression of a wide range of target genes related to tumorigenesis such as proliferation and differentiation of cells, (Role of STAT3 in cancer metastasis and translational advances. BioMed research international. 2013; 2013: 421821). However, transcription factors such as STAT3 have been regarded as undruggable in the field of traditional synthetic drug development because they are difficult to find targets that could impair their activity on the tertiary structure of the protein (Transcription Factor STAT3 as a Molecular Target for Cancer Prevention Cancers, 2014; 16; 6 (2): 926-57). Therefore, the market demand for siRNA therapeutic agent and its delivery technology which can inhibit the expression of STAT3 is very high.

In other words, Stat3 and mTOR are major cancer-related genes whose prognosis is determined in lung cancer, prostate cancer, and head and neck cancer according to the degree of expression, and they are targeted for development of anticancer drugs. However, since they are present in cytoplasm, In addition, systemic side effects are expected to be transferred to drugs, and development of new drugs to suppress them is difficult.

In order to overcome the disadvantage that the therapeutic effect due to the target specificity of siRNA is not high, siRNAs which simultaneously inhibit the expression of mTOR gene and STAT3 gene related to cancer were prepared and its anticancer activity and synergistic anticancer activity Which is used as a pharmaceutical composition for preventing or treating cancer.

To achieve the above object, the present invention provides nucleic acid molecules that simultaneously inhibit the expression of mTOR and STAT3 genes.

The present invention also provides a recombinant expression vector comprising the nucleic acid molecule.

The present invention also provides a recombinant microorganism into which the recombinant expression vector is introduced.

In addition, the present invention provides a pharmaceutical composition for anticancer comprising the nucleic acid molecule as an active ingredient.

According to the present invention, the double-stranded siRNA of the present invention inhibits the expression of the mTOR gene and the antisense strand inhibits the expression of the STAT3 gene so that both genes can be inhibited simultaneously without treating each siRNA separately. As a result, it is possible to promote the killing of cancer cells and to synergistically improve cancer cell death in combination with an anticancer agent. Since siRNA is capable of local transmission and is excellent in selectivity, it can be used as an anticancer composition or anticancer adjuvant Can be usefully used.

FIG. 1 is a graph showing the effect of the double-stranded siRNA of the present invention to suppress mTOR or STAT3 gene expression.
FIG. 2 is a graph showing the cell survival rate of human lung cancer cell line A549 cells when mTOR and STAT3 were simultaneously inhibited by the double target siRNA of the present invention. FIG.
FIG. 3 is a graph showing the cell survival rate of human lung cancer cell line A549 cells when mTOR and STAT3 were simultaneously inhibited by the double target siRNA of the present invention after cisplatin treatment. FIG.
FIG. 4 is a graph showing the cell survival rate of human lung cancer cell line A549 cells when mTOR and STAT3 were simultaneously inhibited by the double target siRNA of the present invention after treatment with paclitaxel.
FIG. 5 is a graph showing the cell survival rate of human lung cancer cell line A549 cells when mTOR and STAT3 were simultaneously inhibited by the double-target siRNA of the present invention after 5-FU (5-fluorouracil) treatment.

The present invention provides nucleic acid molecules that simultaneously inhibit the expression of mTOR and STAT3 genes.

Wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOS: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; SEQ ID NOS: 15 and 16; Or the nucleotide sequences of SEQ ID NOs: 17 and 18;

In one embodiment, the nucleotide sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15 and 17 inhibit mTOR gene expression by RNA interference, 6, 8, 10, 12, 14, 16, and 18 can inhibit the expression of the STAT3 gene by RNA interference, and the nucleic acid molecule of the present invention simultaneously inhibits the expression of the mTOR gene and the STAT3 gene can do.

In one embodiment, SEQ ID NO. 1 is SEQ ID NO. 2, SEQ ID NO. 3 is SEQ ID NO. 4, SEQ ID NO. 5 is SEQ ID NO. 6, SEQ ID NO. 7 is SEQ ID NO. 8, SEQ ID NO. , SEQ ID NO: 11 is SEQ ID NO: 12, SEQ ID NO: 13 is SEQ ID NO: 14, SEQ ID NO: 15 is SEQ ID NO: 16, SEQ ID NO: 17 is double strand ) siRNA, and it was confirmed that the double-stranded siRNAs targeted the mTOR and STAT3 genes, respectively, thereby suppressing the expression, thereby establishing the dual target siRNA set.

In the present invention, the siRNA targeting mTOR or STAT3 has 100% complementary sequence with the mTOR gene of human ( Homo sapiens ) or a portion of the STAT3 gene, and is capable of degrading mRNA of mTOR gene or STAT3 gene, have.

As used herein, the term "inhibiting the expression" means inducing expression or translation of a target gene, and preferably means that the target gene expression is undetectable or present at an insignificant level.

As used herein, the term "siRNA (small interfering RNA) " refers to short double-stranded RNA capable of inducing RNAi (RNA interference) phenomenon through cleavage of a specific mRNA. Generally, the siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a complementary sequence. In the double-stranded siRNA of the present invention, the sense RNA strand consists of SEQ ID NOS: 1, 3, (Antisense strand to the mTOR gene) represented by the nucleotide sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, (Antisense strand to the STAT3 gene) composed of the nucleotide sequence of SEQ ID NO: 18 and 18, the double-stranded siRNA can inhibit the expression of the mTOR and the STAT3 gene at the same time, so that they can be efficiently used as a gene knock- It is provided as a method of gene therapy.

In one embodiment, the siRNA of SEQ ID NOS: 1 and 2 of Set 1 is 17mer of 21mer, the siRNA of SEQ ID NOS: 3 and 4 of Set 2 is 16mer of 20mer, the siRNA of SEQ ID NOS: 5 and 6 of Set 3 is 19mer SiRNAs of SEQ ID NOS: 7 and 8 of SEQ ID NO: 7 and 14 of 18 mers of Set 4, and siRNA of SEQ ID NO: 9 and 10 of Set 5 complementarily bind to 16mer of 17mer. The siRNA of SEQ ID NOs: 11 and 12 of Set 6 had 17 mer of 20 mer, the siRNA of SEQ ID NOs: 13 and 14 of Set 7 had 16 mer of 19 mer, the siRNA of SEQ ID NOs: 15 and 16 of Set 8 had 15 mer of 18 mer, SiRNA of SEQ ID NOs: 17 and 18 of Set 9 are complementarily bound to 15mer of 17mer.

Variants of the above base sequences are included within the scope of the present invention. Nucleic acid molecules that simultaneously inhibit the mTOR and STAT3 gene expression of the present invention may be used for the deletion, substitution, or insertion of a functional equivalent of a nucleic acid molecule constituting the nucleic acid molecule, for example, But includes variants that can function in a functionally similar manner to a nucleic acid molecule. Specifically, the gene has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% sequence homology with the nucleotide sequence of SEQ ID NOS: 1 to 18 Sequence. Quot; percent sequence identity "for a nucleic acid molecule is determined by comparing the two optimized sequences with the comparison region, and some of the nucleic acid molecule sequences in the comparison region are referenced to the optimal sequence of the two sequences (I. E., A gap) relative to the < / RTI >

The present invention also provides a recombinant expression vector comprising the nucleic acid molecule.

In order to appropriately transcribe double-stranded siRNAs targeting mTOR and STAT3 in the present invention, shRNAs containing the same, particularly shRNAs having a partial sequence of SEQ ID NOS: 1 to 18, are operably incorporated into at least the promoter It is preferable to be connected. The promoter may be any promoter capable of functioning in eukaryotic cells. Additional regulatory sequences, including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences and transcription termination factors, as needed for efficient transcription of double-stranded siRNA or shRNAs targeting mTOR and STAT3 .

The term "shRNA (short hairpin RNA)" of the present invention refers to a hairpin RNA having a double-stranded structure in the 3'-region and a hairpin-like structure in the 3'- Refers to RNA that can be cleaved by dicer, which is one type of RNase present in the cell, to be converted into siRNA. The length of the double stranded structure is not particularly limited, but is preferably 10 nucleotides or more, Is at least 20 nucleotides. In the present invention, the shRNA may be included in a vector.

As used herein, the term "vector" refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Phagemid vector; Cosmeptide vector; And viral vectors such as bacteriophage vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors.

According to a preferred embodiment of the present invention, the gene in the vector of the present invention is operatively linked to a promoter.

For purposes of the present invention, the term "operably linked" refers to a functional association between a gene expression control sequence (e.g., an array of promoter, signal sequence, or transcription factor binding site) and another gene sequence, The regulatory sequence regulates the transcription and / or translation of the different gene sequences.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this are disclosed in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, This document is incorporated herein by reference.

The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (such as a tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL 貫 promoter, pR 貫 promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter), a ribosome binding site for initiation of detoxification, and a transcription / translation termination sequence. The promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158: 1018-8), when E. coli (e.g. HB101, BL21, 1024) and the left promoter of phage lambda (pL? Promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14: 399-445).

The vectors that can be used in the present invention include plasmids such as pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, , pGEX series, pET series and pUC19, etc.), phagemid (e.g. pComb3X), phage or virus (e.g. SV40 etc.).

On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from a genome of a mammalian cell (for example, a metallothionein promoter) or a mammalian virus Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV promoter) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be fused with other sequences as necessary in order to facilitate purification of the protein. Examples of the fusion sequence include glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA ), FLAG (IBI, USA), and 6x His (hexahistidine; Quiagen, USA). In addition, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker. Examples of the expression vector include ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, , Neomycin, and tetracycline.

The present invention also provides a recombinant microorganism into which the recombinant expression vector is introduced.

A host cell capable of continuously cloning and expressing the vector of the present invention in a stable manner can be any host cell known in the art, and examples thereof include Escherichia coli, Bacillus subtilis, and Bacillus thuringiensis Streptomyces, Pseudomonas (for example Pseudomonas putida), Proteus mirabilis or Staphylococcus (for example, Pseudomonas putida), Staphylococcus But are not limited to, prokaryotic host cells such as Staphylococcus carnosus. The host cell is preferably E. coli and more preferably E. coli ER2537, E. coli ER2738, E. coli XL-1 Blue, E. coli BL21 (DE3), E. coli JM109, E. coli DH Series, E. coli TOP10, E. coli TG1, and E. coli HB101.

The method of delivering the vector of the present invention into a host cell can be carried out using a CaCl ₂ method (Cohen, SN et al. (1973), Proc. Natl. Acac. Sci. USA, 9: 2110-2114) (1983), J. MoI. Biol., 166: 557-580) and electroporation method (see, for example, SN et al., 1973, Proc. Natl. Acac. Sci. USA, 9: 2110-2114 and Hanahan, (Dower, WJ et al. (1988), Nucleic Acids Res., 16: 6127-6145).

The present invention also provides a pharmaceutical composition for anticancer therapy comprising the nucleic acid molecule as an active ingredient.

The nucleic acid molecule may further comprise an anticancer agent and may be selected from the group consisting of, for example, asibaiicin, aclarubicin, acordazole, acornisine, adozelesin, alanosin, aldosterucine, allopurinol sodium, But are not limited to, thymine, aminoglutethimide, amonafide, ampholgene, amsacrine, androgens, angiidine, ampicillin glycinate, asalay, asparaginase, 5-azacytidine, BWA 773U82, BW 502 U83 / HCl, BWA 773U82, BW 502 U83 / HCl, BWAU8 / HCl, BW 7U85 mesylate, cerasemide, carbethimer, carboplatin, carmustine, chlorambucil, chloroquinoxaline-sulphonamide, chlorochomotin, chromomycin A3, cisplatin, cladribine, corticosteroid , Corinella bacterium parvum, CPT-11, Krisna , Cyclocytidine, cyclophosphamide, cytarabine, cytemvena, dabis maleate, decarbazine, dactinomycin, daunorubicin HCl, diabyridine, dexlazonic acid, dianhydrogalactitol, Dihydrodithiocarbamate, diclcic aldehyde, dihydro-5-azacytin, doxorubicin, echinomycin, dodestrecite, edeloxine, eplorinine Estradiol, erythromycin, erythromycin, erythromycin, erythromycin, erythromycin, erythromycin, erythromycin, erythromycin, erythromycin, Such as fenaric acid, fenasteride, flavanetic acid, phloxuridine, fludarabine phosphate, 5'-fluorouracil, Fluosol ™, flutamide, gallium nitrate, gemcitabine, gossyrelin acetate, Hydroquinone hydrochloride, diclofenac HCl, Iphospamide, 4-Ipomethanol, isofluratine, isotretinoin, leucovorin calcium Liposomes, doxorubicin, liposomal doxorubicin, romerstine, ronidamine, mytansine, mechlorethamine hydrochloride, melphalan, menogaril, merbarone, 6-mercaptopurine, methamphetamine, Methotrexate, N-methylformamide, mifepristone, mitoguazone, mitomycin C, mitotan, mitoxanthrone hydrochloride, monocyte / macrophage colony-stimulating factor , Nevallone, napoxidine, neocarzinostatin, octreotide acetate, ormaflatatin, oxaliplatin, paclitaxel, pala, pento But are not limited to, statins such as statin, piperazin dione, pivobroman, pyruvicin, pyrimethoxycarbonyl, pyriproxyfen, pyroxanthrone hydrochloride, PIXY-321, plicamycin, , Tamoxifen, tamoxifen, terephthalamidine, terephthalamid, terephthalamid, terephthaloyl, terephthaloyl, terephthaloyl, terephthaloyl, A tumor necrosis factor (TNF), a uracil mustard, a tumor necrosis factor (TNF), a tumor necrosis factor (TNF), a tumor necrosis factor (TNF), a tumor necrosis factor , Vinblastine sulfate, vincristine sulfate, vindesine, vinorelbine, binzolidine, Yoshi 864, zorubicin, cytosine arabinoside, etoposide, melphalan, taxol and the like It may comprise a mixture. Preferably, the compound is selected from the group consisting of cisplatin, paclitaxel, 5-fluorouracil, methotrexate, doxorubicin, daunorubicin, cytosine arabinoside, etoposide, melphalan, chlorambucil, cyclophosphamide, 5-FU (5-fluorouracil) or cisplatin, 5-fluorouracil, or a nucleic acid molecule of the present invention may be used for the purpose of exhibiting a synergistic effect on the anticancer effect But is not limited thereto.

The cancer is selected from the group consisting of colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, Renal cell carcinoma, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma, pancreatic cancer, endometrial carcinoma, endometrial carcinoma, endometrial carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, (CNS) tumors, primary CNS lymphoma, spinal cord tumors, polymorphic glioblastoma, and pituitary gland tumors, including, but not limited to, endometrial carcinomas, endometrial carcinomas, endometrioid carcinomas, Adenoma < / RTI >

The pharmaceutical composition of the present invention may further comprise an adjuvant in addition to the single domain antibody. Such adjuvants can be used without limitation as long as they are known in the art, but can include, for example, Freund's complete adjuvant or incomplete adjuvant to increase its effectiveness.

The pharmaceutical composition according to the present invention can be prepared by incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers for use in the pharmaceutical compositions of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, Calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols or the like, oral preparations, suppositories or sterilized injection solutions according to a conventional method .

In the case of formulation, it can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations may contain at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin And the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweetening agents, fragrances and preservatives . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories. Propellants, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used. As the base of suppositories, witepsol, tween 61, cacao paper, laurin, and glycerogelatin can be used.

The pharmaceutical composition according to the present invention can be administered to the individual by various routes. All modes of administration may be expected, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, physical condition, etc. of the individual. It is obvious that the concentration of the single domain antibody contained in the pharmaceutical composition may be variously selected depending on the subject, and it is preferably contained in the pharmaceutical composition at a concentration of 0.01 to 5,000 占 퐂 / ml. If the concentration is less than 0.01 μg / ml, the pharmaceutical activity may not be exhibited. If the concentration is more than 5,000 μg / ml, it may be toxic to the human body.

The pharmaceutical composition of the present invention can be used for preventing or treating cancer and its complications, and can also be used as an anti-cancer adjuvant.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Example  1. Dual target siRNA  making

A double-stranded siRNA (double strand) capable of simultaneously inhibiting STAT3 (signal transducer and activator of transcription 3) and mTOR (mammalian target of rapamycin) was prepared from the sequence shown in Table 1 (Bioneer, Daejeon, Korea).

set siRNA order Length Complementary bonding SEQ ID NO: One antisense_mTOR (5 '- > 3') gactgtggcatccccctgcat 21
17
One antisense_STAT3 (3 '- > 5') ctgactccgcggatggacgta 2 2 antisense_mTOR (5 '- > 3') gactgtggcatcccacctgca 20
16
3 antisense_STAT3 (3 '- > 5') ctgactccgcggatggacgt 4 3 antisense_mTOR (5 '- > 3') gactgtggcatcccacctgc 19
15
5 antisense_STAT3 (3 '- > 5') ctgactccgcggatggacg 6 4 antisense_mTOR (5 '- > 3') gactgtggcatccccctg 18
14
7 antisense_STAT3 (3 '- > 5') ctgactccgcggatggac 8 5 antisense_mTOR (5 '- > 3') caagctgctgtggctga 17
16
9 antisense_STAT3 (3 '- > 5') gttcgacgacatcgact 10 6 antisense_mTOR (5 '- > 3') tgctgggccgcatgcgctgc 20
17
11 antisense_STAT3 (3 '- > 5') acgacccggcgtcaccgacg 12 7 antisense_mTOR (5 '- > 3') gctgggccgcatgcgctgc 19
16
13 antisense_STAT3 (3 '- > 5') cgacccggcgtcaccgacg 14 8 antisense_mTOR (5 '- > 3') ctgggccgcatgcgctgc 18
15
15 antisense_STAT3 (3 '- > 5') gacccggcgtcaccgacg 16 9 antisense_mTOR (5 '- > 3') tgggccgcatgcgctgc 17
14
17 antisense_STAT3 (3 '- > 5') acccggcgtcaccgacg 18

SiRNAs of SEQ ID NOS: 1 and 2 of the set 1, 17 mers of 21 mers, siRNAs of SEQ ID NOS: 3 and 4 of the set 2, 16 mers of 20 mers, siRNA of SEQ ID NOS: 5 and 6 of the set 3, The siRNAs of SEQ ID NOS: 7 and 8 of SEQ ID NO: 7 and the siRNA of SEQ ID NO: 9 and 10 of Set 5 complementarily bind to the 16mer of the 17mer. The siRNA of SEQ ID NOs: 11 and 12 of Set 6 had 17 mer of 20 mer, the siRNA of SEQ ID NOs: 13 and 14 of Set 7 had 16 mer of 19 mer, the siRNA of SEQ ID NOs: 15 and 16 of Set 8 had 15 mer of 18 mer, SiRNA of SEQ ID NOs: 17 and 18 of Set 9 are complementarily bound to 15mer of 17mer.

Specifically, after each set of two sequences enters the cell in the form of a double strand, the siRNA of each set of antisense_mTOR is mTOR mRNA (gi | 20 | | NM_004958.3 | Homo sapiens mechanistic target of rapamycin (serine / threonine kinase) (MTOR), mRNA) complementary to the target site.

In addition, the siRNA of each set of antisense_STAT3 was used as a target of STAT mRNA (gi | 47080104 | ref | NM_139276.2 | Homo sapiens signal transducer and activator of transcription 3 (STAT3), transcript variant 1, mRNA) Lt; RTI ID = 0.0 > mTOR < / RTI > and STAT3 gene expression.

Experimental Example  1. Dual target siRNA mTOR  And STAT3  Confirming gene expression inhibitory effect

Hela cells were placed in a 12-well plate and cultured in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) at 37 ° C and 5% CO ₂ until the cell confluent reached 50%. Then, the cells were transfected with the double-target siRNA prepared in Example 1 with lipofectamine 3000 (Invitrogen, Carlsbad, Calif., USA) to reduce Bcl1, BI1, AR, mTOR and STAT3 simultaneously. After 48 hours of transfection, cells were disrupted and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). The reverse transcription was performed with RevoScriptTM RT PreMix (iNtRON BIOTECHNOLOGY) using the extracted total RNA as a template. MTOR (Hs00234522_m1), STAT3 (Hs01047580_m1) and GAPDH (Hs02758991_g1) were amplified with 20 μl of a sample containing 25 to 200 ng of the reverse transcribed cDNA using AmpONE taq DNA polymerase (GeneAll) and TaqMan Gene Expression assays (Applied Biosystems) PRISM 7700 Sequence Detection System and QS3 Real-time PCR (Biosystems). The real-time PCR reaction conditions were [40 ° C for two minutes at 50 ° C, 10 minutes at 95 ° C, and 15 seconds at 95 ° C and 60 seconds at 60 ° C]. All reactions were repeated three times and the mean value of these was obtained. The results were normalized to the mRNA values of the housekeeping gene GAPDH.

As a result, mTOR and STAT3 were found to be about 20-40% residual expression compared to the control by double-targeted siRNAs of sets 1-9, and it was found that the dual target siRNA inhibited expression of both genes simultaneously (Fig. 1).

Experimental Example  2. Dual target To siRNA  Confirmation of cancer cell death by

In order to confirm the killing effect of the double-target siRNA on the cancer cells by the set 1-9 of Table 1 of the present invention, human lung cancer cell line A549 cells were divided into a 96-well plate at 5 × 10 ³ cells / well and then lipofectamine 3000 (MTOR and STAT3 coincidental depletion) were transfected into cells, respectively. Cells were treated with 5 mg / mL MTT (Promega, Ltd.) 48 hours after transfection and 24 hours later and incubated for 4 hours. After that, the medium was removed and 150 ㎕ of solubilization solution and stop solution was treated and incubated at 37 캜 for 4 hours. The absorbance of the reaction solution was measured at 570 nm and the cell viability was calculated using the following equation.

As a result, when mTOR and STAT3 were simultaneously inhibited by the double-targeted siRNA of the present invention, the cell survival rate was significantly reduced as compared with the control group. Therefore, it was confirmed that the dual target siRNA of the present invention set 1-9 effectively killed cancer cells (Fig. 2).

Experimental Example  3. Dual target siRNA  Confirmation of Cancer Cell Death by Combination Treatment with Anticancer Drugs

3-1. With cisplatin  Combined treatment

Human lung cancer cell line A549 cells were divided into 5 × 10 ³ cells / well in a 96-well plate and transfected with double-target siRNA (mTOR and STAT3 simultaneously depleted) with lipofectamine 3000 respectively. After 48 hours of transfection, cisplatin was treated with 5 [mu] M and incubated for 10 hours. Thereafter, the MTT reaction was performed as in Experimental Example 2, and the absorbance of the MTT was measured at 570 nm to calculate the cell survival rate.

As a result, when mTOR and STAT3 were simultaneously inhibited by the double-target siRNA of Set 1-9 of the present invention in combination with cisplatin, the cell survival rate was reduced to about 50-70%, and a significant difference Respectively. Therefore, it was confirmed that, when the two genes were simultaneously inhibited, the cytotoxic effect was remarkably improved even in the combination treatment with an anticancer agent (FIG. 3).

3-2. With paclitaxel  Combined treatment

Human lung cancer cell line A549 cells were divided into 5 × 10 ³ cells / well in a 96-well plate and transfected with double-target siRNA (mTOR and STAT3 simultaneously depleted) with lipofectamine 3000 respectively. After 48 hours of transfection, 5 μM of paclitaxel was treated and incubated for 10 hours. Thereafter, the MTT reaction was performed as in Experimental Example 2, and the absorbance of the MTT was measured at 570 nm to calculate the cell survival rate.

As a result, when mTOR and STAT3 were simultaneously inhibited by the dual target siRNA of Set 1-9 of the present invention in combination with paclitaxel, the cell viability was reduced to about 30-50%, and a significant difference Respectively. Therefore, it was confirmed that, in combination treatment with an anticancer agent, the cytotoxic effect was remarkably improved when both genes were simultaneously inhibited (FIG. 4).

3-3. Combined treatment with 5-fluorouracil (5-FU, 5-fluorouracil)

Human lung cancer cell line A549 cells were divided into 5 × 10 ³ cells / well in a 96-well plate and transfected with double-target siRNA (mTOR and STAT3 simultaneously depleted) with lipofectamine 3000 respectively. After 48 hours of transfection, 1 μM of 5-fluorouracil was treated and incubated for 10 hours. Thereafter, the MTT reaction was performed as in Experimental Example 2, and the absorbance of the MTT was measured at 570 nm to calculate the cell survival rate.

As a result, when mTOR and STAT3 were simultaneously inhibited by the double-target siRNA of sets 1-9 of the present invention in combination with 5-fluorouracil, the cell survival rate was reduced to about 30% Respectively. Therefore, it was confirmed that the cytotoxic effect was significantly improved when the two genes were simultaneously inhibited in combination with the anticancer agent (FIG. 5).

<110> University-Industry Cooperation Group of Kyung Hee University <120> Nucleic acids for simultaneous inhibition of mTOR gene and STAT3          gene <130> PN1801-005 <160> 18 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 1 <400> 1 gactgtggca tccacctgca t 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 1 <400> 2 ctgactccgc ggatggacgt a 21 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 2 <400> 3 gactgtggca tccacctgca 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 2 <400> 4 ctgactccgc ggatggacgt 20 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 3 <400> 5 gactgtggca tccacctgc 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 3 <400> 6 ctgactccgc ggatggacg 19 <210> 7 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 4 <400> 7 gactgtggca tccacctg 18 <210> 8 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 4 <400> 8 ctgactccgc ggatggac 18 <210> 9 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 5 <400> 9 caagctgctg tggctga 17 <210> 10 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 5 <400> 10 gttcgacgac atcgact 17 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 6 <400> 11 tgctgggccg catgcgctgc 20 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 6 <400> 12 acgacccggc gtcaccgacg 20 <210> 13 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 7 <400> 13 gctgggccgc atgcgctgc 19 <210> 14 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 7 <400> 14 cgacccggcg tcaccgacg 19 <210> 15 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 8 <400> 15 ctgggccgca tgcgctgc 18 <210> 16 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 8 <400> 16 gacccggcgt caccgacg 18 <210> 17 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> antisense_mTOR of set 9 <400> 17 tgggccgcat gcgctgc 17 <210> 18 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> antisense_STAT3 of set 9 <400> 18 acccggcgtc accgacg 17

Claims (11)

 a nucleic acid molecule that simultaneously inhibits the expression of mTOR (mammalian target of rapamycin) gene and STAT3 (signal transducer and activator of transcription 3) gene. 2. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is selected from the group consisting of SEQ ID NOs: 1 and 2; SEQ ID NOS: 3 and 4; SEQ ID NOS: 5 and 6; SEQ ID NOS: 7 and 8; SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; SEQ ID NOS: 15 and 16; Or a nucleotide sequence comprising the nucleotide sequence of SEQ ID NOs: 17 and 18; 3. The nucleic acid molecule according to claim 2, wherein the nucleotide sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15 and 17 inhibits mTOR gene expression by RNA interference. 3. The method according to claim 2, wherein the nucleotide sequence shown in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16 and 18 inhibits the expression of the STAT3 gene by RNA interference. molecule. 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: , SEQ ID NO: 11 is SEQ ID NO: 12, SEQ ID NO: 13 is SEQ ID NO: 14, SEQ ID NO: 15 is SEQ ID NO: 16, SEQ ID NO: 17 is double strand ) siRNA. &lt; / RTI &gt; The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule further comprises shRNA (short hairpin RNA). A recombinant expression vector comprising the nucleic acid molecule of claim 1. A recombinant microorganism into which the recombinant expression vector of claim 7 is introduced. An anticancer pharmaceutical composition comprising the nucleic acid molecule of claim 1 as an active ingredient. 10. The pharmaceutical composition according to claim 9, wherein the nucleic acid molecule further comprises an anticancer agent. 11. The method of claim 10, wherein the anticancer agent is selected from the group consisting of cisplatin, paclitaxel, 5-fluorouracil, methotrexate, doxorubicin, daunorubicin, cytosine arabinoside, etoposide, melphalan, chlorambucil, Wherein the anticancer agent is at least one kind of anticancer agent selected from the group consisting of id, vindesine, mitomycin, bleomycin, tamoxifen, and taxol.

Images