KR20230093859A - Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene - Google Patents

Abstract

The present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of the mTOR gene and the STAT3 gene, and to a pharmaceutical composition for anticancer containing the same. Since the expression of is suppressed at the same time, it can be usefully used as an anti-cancer composition or an anti-cancer adjuvant, local delivery is possible, and there is an effect with excellent selectivity.

Description

Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene {Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene}

The present invention relates to a nucleic acid molecule that inhibits the expression of mTOR gene and STAT3 gene at the same time, and an anti-cancer pharmaceutical composition comprising the same.

Cancer is one of the diseases that cause the most deaths worldwide, and the development of innovative cancer treatments can reduce medical costs and create high added value at the same time. Also, according to statistics in 2008, molecular therapies that can overcome resistance to existing anticancer drugs accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, UK), and in 2018, about It is expected to show a growth rate of 9.5% compared to 2008, accounting for a market size of about $45 billion. Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy. Among them, chemotherapy is a treatment that suppresses or kills the proliferation of cancer cells with chemical substances. It shows a certain degree of toxicity, and even if anticancer drugs are effective, resistance occurs in which the effect is lost after a certain period of use, so the development of anticancer drugs that selectively act on cancer cells and do not develop resistance is urgently needed (Biowave, the current state of conquering cancer) 2004. 6(19)). Recently, the development of new anticancer drugs targeting the molecular characteristics of cancer is progressing through the acquisition of molecular genetic information on cancer, and anticancer drugs targeting molecular targets unique to cancer cells are resistant to drugs. There are also reports that this does not happen.

The technology of inhibiting gene expression is an important tool in the development of therapeutic agents and target validation for disease treatment. Since its role was discovered, RNA interference (hereinafter referred to as RNAi) has been shown to act on sequence-specific mRNAs in various types of mammalian cells (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773). RNAi is a small interfering ribonucleic acid short interfering RNA (hereinafter referred to as siRNA) having a double helix structure of 21-25 nucleotides in size that specifically binds to an mRNA transcript having a complementary sequence. It is a phenomenon that inhibits the expression of a specific protein by degrading the transcript. In cells, RNA double strands are processed by an endonuclease called Dicer and converted into siRNAs of 21 to 23 base pairs (bp), which bind to RISC (RNA-induced silencing complex) Through the process of recognizing and degrading the target mRNA by the guide (antisense) strand, the expression of the target gene is sequence-specifically inhibited (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503 -514). According to Bertrand's research team, siRNA for the same target gene has an excellent inhibitory effect on mRNA expression in vitro and in vivo compared to antisense oligonucleotide (ASO), and the effect lasts for a long time (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). The RNAi technology-based therapeutics market, including siRNA, has been analyzed to have a global market size of more than 12 trillion won by 2020. It is being evaluated as a next-generation gene therapy technology that can treat incurable diseases. In addition, since the mechanism of action of siRNA complementarily binds to the target mRNA and regulates the expression of the target gene in a sequence-specific manner, it takes a long time for existing antibody-based medicines or small molecule drugs to be optimized for a specific protein target. Compared to the development period and development cost required, it is possible to develop lead compounds optimized for all protein targets, including target substances that cannot be medicated, while the applicable target can be dramatically expanded and the development period shortened. (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13 (4): 664-670). Therefore, recently, this ribonucleic acid-mediated interference phenomenon presents a solution to the problem that occurs in the development of existing chemical synthetic medicines, and studies to selectively inhibit the expression of specific proteins at the transcript level to use them for the development of various disease treatments, especially tumor treatments is in progress In addition, unlike conventional anticancer drugs, siRNA therapeutics have the advantage that side effects are predictable because the target is clear, but such target specificity is a disease caused by problems in various genes, in the case of tumors, rather, this target specificity does not have a high therapeutic effect. can also be a cause

It is an object of the present invention to provide dual target nucleic acid molecules.

Another object of the present invention is to provide a recombinant expression vector containing the nucleic acid molecule of the present invention and a virus into which it is introduced.

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer.

In order to achieve the above object, the present invention provides a nucleic acid molecule that simultaneously inhibits the mTOR gene and the STAT3 gene.

In addition, the present invention provides a recombinant expression vector containing the nucleic acid molecule and a virus into which the vector is introduced.

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the nucleic acid molecule, a recombinant expression vector containing the same, or a virus introduced therein as an active ingredient.

The dual-target nucleic acid molecule of the present invention, designed so that the sense strand inhibits the expression of the mTOR gene and the antisense strand inhibits the expression of the STAT3 gene, simultaneously inhibits the expression of the mTOR gene and the STAT3 gene when applied as siRNA in cancer cells, thus anticancer It can be usefully used as a composition for anticancer or as an adjuvant for anticancer, can be delivered locally, and has excellent selectivity.

1 is a diagram showing a vector map for expressing shRNAs containing the dual target siRNA set of the present invention in cells.
Figure 2 is a diagram confirming the effect of inhibiting mTOR and STAT3 gene expression by double-stranded siRNAs of sets 1 to 10 of the present invention:
CA102: double-stranded siRNA that simultaneously inhibits conventional mTOR and STAT3;
mTOR/STAT3 #2: dual target siRNA set 1 (si-MS1);
mTOR/STAT3 #3: dual target siRNA set 2 (si-MS2);
mTOR/STAT3 #4: dual target siRNA set 3 (si-MS3);
mTOR/STAT3 #5: dual target siRNA set 4 (si-MS4);
mTOR/STAT3 #6: dual target siRNA set 5 (si-MS5);
mTOR/STAT3 #7: dual target siRNA set 6 (si-MS6);
mTOR/STAT3 #8: dual target siRNA set 7 (si-MS7);
mTOR/STAT3 #9: dual target siRNA set 8 (si-MS8);
mTOR/STAT3 #10: dual target siRNA set 9 (si-MS9); and
mTOR/STAT3 #11: dual target siRNA set 10 (si-MS10).

Hereinafter, the present invention will be described in detail with embodiments of the present invention. However, the following embodiments are presented as examples of the present invention, and the present invention is not limited thereby, and various modifications and applications of the present invention are possible within the description of the claims described later and equivalent scope interpreted therefrom. .

Unless otherwise indicated, nucleic acids are written in the 5′→3′ direction from left to right. Numerical ranges recited within the specification are inclusive of the numbers defining the range and include each integer or any non-integer fraction within the defined range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing the present invention, the preferred materials and methods are described herein.

In one aspect, the present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of mammalian target of rapamycin (mTOR) gene and signal transducer and activator of transcription 3 (STAT3) gene.

In one embodiment, the nucleic acid molecule may include a base sequence having 80% or more homology with each of the base sequences represented by SEQ ID NOs: 1 to 20.

In one embodiment, the nucleic acid molecule has SEQ ID NOs: 1 and 2; SEQ ID NOs 3 and 4; SEQ ID NOs 5 and 6; SEQ ID NOs 7 and 8; SEQ ID NOs 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs 17 and 18; and at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 19 and 20 or a nucleotide sequence encoding the same.

In one embodiment, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 can inhibit mTOR gene expression by RNA interference.

In one embodiment, a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20 can inhibit STAT3 gene expression by RNA interference.

In one embodiment, the nucleic acid molecule that inhibits mTOR gene expression may form a double strand with a nucleic acid molecule that inhibits STAT3 gene expression through a partial or 100% complementary bond, and the nucleic acid molecule that inhibits STAT3 gene expression is a mTOR gene It can form a double strand by partially or 100% complementary binding with a nucleic acid molecule that inhibits expression.

In one embodiment, the nucleic acid molecule that inhibits mTOR gene expression may include a nucleotide sequence having 60% or more complementarity with the reverse complementary sequence of the nucleic acid molecule that inhibits STAT3 gene expression, and the nucleic acid molecule that inhibits STAT3 gene expression is It may include a nucleotide sequence having 60% or more complementarity with a reverse complementary sequence of a nucleic acid molecule that inhibits mTOR gene expression.

In one embodiment, the nucleic acid molecule that inhibits mTOR gene expression is 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% reverse complementary sequence of the nucleic acid molecule that inhibits STAT3 gene expression. Alternatively, it may include a base sequence having 99% or more complementarity, and the nucleic acid molecule that inhibits STAT3 gene expression is 70%, 80%, 85%, 90%, 95%, 70%, 80%, 85%, 95 %, 96%, 97%, 98%, or may include a base sequence having a complementarity of 99% or more.

Nucleic acid molecules that inhibit mTOR gene expression or variants of nucleic acid molecules that inhibit STAT3 gene expression are included within the scope of the present invention. The expression cassette of the present invention is a functional equivalent of the nucleic acid molecules constituting it, for example, although some base sequences of the nucleic acid molecules have been modified by deletion, substitution, or insertion, the base sequence molecules and It is a concept that includes variants that can perform the same functional action. The "percentage of sequence homology" for nucleic acid molecules is determined by comparing two optimally aligned sequences with a region of comparison, wherein a portion of the sequence of the nucleic acid molecule in the region of comparison is a reference sequence (addition or deletion) to the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).

In one embodiment, the nucleic acid molecule has SEQ ID NO: 1 to SEQ ID NO: 2, SEQ ID NO: 3 to SEQ ID NO: 4, SEQ ID NO: 5 to SEQ ID NO: 6, SEQ ID NO: 7 to SEQ ID NO: 8, and SEQ ID NO: 9 to sequence SEQ ID NO: 10, SEQ ID NO: 11 with SEQ ID NO: 12, SEQ ID NO: 13 with SEQ ID NO: 14, SEQ ID NO: 15 with SEQ ID NO: 16, SEQ ID NO: 17 with SEQ ID NO: 18, or SEQ ID NO: 19 with SEQ ID NO: 20 It may be a double-stranded siRNA that is complementary to each other.

In one embodiment, the nucleic acid molecule is shRNA (short hairpin RNA) comprising a nucleic acid molecule that inhibits mTOR gene expression, a loop sequence capable of forming a hairpin structure, and a base sequence encoding a nucleic acid molecule that inhibits STAT3 gene expression can be

In one embodiment of the present invention, siRNAs of SEQ ID NOs: 1 and 2 of set 1 are 15mers out of 19mers, siRNAs of SEQ ID NOs: 3 and 4 of set 2 are 15mers out of 19mers, siRNAs of SEQ ID NOs: 5 and 6 of set 3 15mers of 19mers, siRNAs of SEQ ID NOs: 7 and 8 of set 4 bind to 16mers of 20mers, and siRNAs of SEQ ID NOs: 9 and 10 of set 5 bind complementaryly to 15mers of 19mers. In addition, siRNAs of SEQ ID NOs: 11 and 12 of Set 6 have 17mers out of 20mers, siRNAs of SEQ ID NOs: 13 and 14 of Set 7 have 17mers out of 19mers, siRNAs of SEQ ID NOs 15 and 16 of Set 8 have 16mers out of 19mers, siRNAs of SEQ ID NOs: 17 and 18 of Set 9 were constructed such that 17mers out of 20mers and 16mers of SEQ ID NOs: 17 and 18 of Set 10 were complementarily bonded to each other to form double-stranded siRNAs, and double-stranded siRNAs was confirmed to be a set of dual-target siRNAs by targeting the mTOR gene and the STAT3 gene, respectively, and simultaneously suppressing the expression of both genes.

In one embodiment, the shRNA is a nucleic acid molecule encoding a siRNA that inhibits the expression of the mTOR gene and a nucleic acid molecule that encodes a siRNA that inhibits the expression of the STAT3 gene are partially complementary and linked palindrome by a loop region may form a hairpin structure, and may be TTCAAGAGAG loop shRNA or TTGGATCCAA loop shRNA depending on the nucleotide sequence of the loop portion of the hairpin structure.

In the present invention, the siRNA that inhibits the expression of the mTOR gene and the STAT3 gene has a sequence complementary to a part of the human ( Homo sapiens ) mTOR gene or STAT3 gene, and can degrade mRNA of the mTOR gene or STAT3 gene or inhibit translation. can

As used herein, the term "expression inhibition" means to cause a reduction in the expression (into mRNA) or translation (into protein) of a target gene, preferably by which the expression of the target gene is undetectable or insignificant. means to exist.

As used herein, the term "siRNA (small interfering RNA)" refers to a short double-stranded RNA capable of inducing RNA interference (RNAi) through cleavage of a specific mRNA. In general, siRNA consists of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto, but in the double-stranded siRNA of the present invention, the sense RNA strand consists of the nucleotide sequence of SEQ ID NO: 1 Since it is siRNA (antisense strand for mTOR gene) and the antisense RNA strand is siRNA (antisense strand for STAT3 gene) consisting of the nucleotide sequence of SEQ ID NO: 2, the double-stranded siRNA inhibits the expression of mTOR gene and STAT3 gene at the same time, respectively Since it can be done, it is provided as an efficient gene knock-down method or as a method of gene therapy.

The term "shRNA (short hairpin RNA)" of the present invention refers to a double-stranded structure in the 3' region by partially including a palindromic nucleotide sequence in single-stranded RNA to form a hairpin-like structure and to be expressed in cells. After being cleaved by dicer, a type of RNase present in cells, it means RNA that can be converted into siRNA. The length of the double-stranded structure is not particularly limited, but is preferably 10 nucleotides or more, more preferably is at least 20 nucleotides. In the present invention, the shRNA may be included in an expression cassette, and the shRNA is converted from U to T in a set sequence consisting of an siRNA antisense strand and a sense strand for each gene, and then TTGGATCCAA (TTGGATCCAA loop) or TTCAAGAGAG (TTCAAGAGAG loop), the antisense strand and TT are sequentially connected to construct an expression cassette encoding shRNA and express it in a cell. In this case, the expression cassette may include one or more of the nucleic acids in which U is converted to T in the nucleotide sequences of SEQ ID NOs: 1 to 20.

In one aspect, the invention relates to a recombinant expression vector comprising a nucleic acid molecule of the invention.

In one embodiment, the recombinant expression vector of the present invention may include an expression cassette encoding a nucleic acid molecule that inhibits mTOR gene expression and a nucleic acid molecule that inhibits STAT3 gene expression.

In one embodiment, the recombinant expression vector of the present invention has SEQ ID NOs: 1 and 2; SEQ ID NOs 3 and 4; SEQ ID NOs 5 and 6; SEQ ID NOs 7 and 8; SEQ ID NOs 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs 17 and 18; and at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 19 and 20 or a nucleotide sequence encoding the same.

The recombinant vector of the present invention can be prepared by a recombinant DNA method known in the art, and in one embodiment, a pE3.1 vector was used.

In the present invention, useful non-viral vectors for delivering nucleic acid molecules that inhibit the expression of the mTOR gene and the STAT3 gene include all vectors commonly used in gene therapy, for example, various plasmids and liposomes that can be expressed in eukaryotic cells etc.

In the present invention, in order for the double-stranded siRNA that simultaneously suppresses the expression of the mTOR gene and the STAT3 gene to be properly transcribed in the delivered cell, the nucleotide sequence encoding the shRNA containing it is preferably operably linked to at least a promoter. The promoter may be any promoter as long as it can function in eukaryotic cells, but the U6 promoter is more preferred. Regulation including leader sequence, polyadenylation sequence, promoter, enhancer, upstream activating sequence, signal peptide sequence and transcription terminator as necessary for efficient transcription of double-stranded siRNA or shRNA that simultaneously inhibits the expression of mTOR gene and STAT3 gene Sequences may additionally be included.

In the present invention, viruses or viral vectors useful for delivering siRNA or shRNA that simultaneously inhibit the expression of mTOR gene and STAT3 gene include baculoviridiae, parvoviridiae, picornoviridiae ), herepesviridiae, poxviridiae, adenoviridiae, etc., but are not limited thereto.

In one aspect, the present invention relates to a virus into which a recombinant expression vector of the present invention has been introduced.

In one embodiment, the virus of the present invention may be an adenovirus, and may be an adenovirus having a group C serotype of type 5.

In one embodiment, the virus of the present invention may further comprise a human telomere promoter (hTERT).

In one embodiment, the virus of the present invention is SEQ ID NOs: 1 and 2, SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, SEQ ID NOs: 15 and 16, SEQ ID NOs: 17 and 18, and SEQ ID NOs: 19 and 20; and a recombinant expression vector comprising a human telomere promoter (hTERT).

In one embodiment, when a nucleic acid molecule that inhibits mTOR gene expression and a nucleic acid molecule that inhibits STAT3 gene expression are expressed, the respective expressed sequences may form double strands with partial or 100% complementary binding.

In one embodiment, a human telomere promoter may be operably linked to an endogenous gene of a virus.

In one embodiment, the endogenous gene of adenovirus has a structure of 5'ITR-C1-C2-C3-C4-C5 3'ITR; C1 includes E1A, E1B or E1A-E1B; C2 includes E2B-L1-L2-L3-E2A-L4; wherein C3 does not include E3 or includes E3; said C4 includes L5; and C5 may not include E4 or may include E4.

In one embodiment, the adenovirus may be partially deleted in the E3 region.

In one embodiment, an expression cassette comprising a nucleic acid molecule that inhibits mTOR gene expression and a nucleic acid molecule that inhibits STAT3 gene expression, or a nucleic acid molecule encoding the same (eg, shRNA) is located at the C3 site of an endogenous gene of adenovirus can do.

In one embodiment, the expression cassette can simultaneously inhibit STAT3 and mTOR by expressing a double-stranded siRNA in which a STAT3-specific sense strand and an mTOR-specific antisense strand form a partially complementary bond.

In one embodiment, the hTERT promoter can be operably linked to E1A and E1B of the endogenous gene of adenovirus.

In one embodiment, an IRES sequence may be further included between E1A and E1B of the endogenous adenovirus gene.

Adenovirus into which the recombinant expression vector of the present invention is introduced has higher oncolytic activity than wild-type adenovirus, and may have higher oncolytic activity than adenovirus into which hTERT promoter is introduced into wild-type adenovirus.

In the present invention, the term "operably linked" refers to a functional linkage between a gene expression control sequence (eg, a promoter, a signal sequence, or an array of transcriptional regulatory factor binding sites) and another gene sequence, whereby Regulatory sequences will control the transcription and/or translation of said other gene sequences.

In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating cancer containing the nucleic acid molecule of the present invention, the recombinant expression vector of the present invention, or the virus of the present invention as an active ingredient.

In one embodiment, the composition of the present invention may further include an anti-cancer agent, for example, acibacin, aclarubicin, acodazole, acronisin, adozelesin, alanosin, aldesleukin, allo Purinol Sodium, Altretamine, Aminoglutethimide, Amonafide, Amplogen, Amsacrine, Androgens, Anguidin, Aphidicolin Glycinate, Asaray, Asparaginase, 5-Azacytidine , Azathioprine, Bacillus Calmete-Guerin (BCG), Baker's Antipol, Beta-2-deoxythioguanosine, Bisantrene HCl, Bleomycin Sulfate, Bulseppan, Butionine Sulfoximin, BWA 773U82 , BW 502U83/HCl, BW 7U85 mesylate, cerasemide, carbetimer, carboplatin, carmustine, chlorambucil, chloroquinoxaline-sulfonamide, chlorozotocin, chromomycin A3, cisplatin, Cladribine, corticosteroids, Corynerbacterium parvum, CPT-11, cristinol, cyclocytidine, cyclophosphamide, cytarabine, cytombena, davis maleate, decarbazine, dactinomycin, dow Norubicin HCl, diazauridine, dexrazoxic acid, dianhydrogalactitol, diaziquone, dibromodulcitol, didemin B, diethyldithiocarbamate, diclicoaldehyde, dihydro-5- Azacytin, doxorubicin, ethinomycin, dedatrexate, edelphosine, eprolnitine, elliox solution, elsamitrucin, epirubicin, esorubicin, estramustine phosphate, estrogen, ethanidazole, etio Phosphorus, Etoposide, Fadrazole, Fajalabine, Fenretinide, Filgrastim, Finasteride, Flavone Acetic Acid, Floxuridine, Fludarabine Phosphate, 5'-Fluorouracil, Fluosol™, Flutamide, Gallium Nate Late, gemcitabine, gosereline acetate, hepsulfam, hexamethylene bisacetamide, homoharringtonine, hydrazine sulfate, 4-hydroxyandrostenedione, hydroziurea, idarubicin HCl, ifosfamide, 4 -Ipomeanol, iproplatin, isotretinoin, leucovorin calcium, leuprolide acetate, levamisole, liposomal daunorubicin, liposomal entrapped doxorubicin, lomustine, lonidamine, maytansine, mechlorethamine hydrochloride, melphalan , Menogaril, Mervalon, 6-Mercaptopurine, Mesna, Methanol Extract of Bacillus Calete-Guerin, Methotrexate, N-Methylformamide, Mifepristone, Mitoguazone, Mitomycin-C, Mitotan, Toxantrone Hydrochloride, Monocyte/Macrophage Colony-Stimulating Factor, Navilon, Nafoxidine, Neocarzinostatin, Octreotide Acetate, Ormaplatin, Oxaliplatin, Paclitaxel, Pala, Pentostatin, Piperazinedione , pipobroman, pyrarubicin, pyritrexim, pyroxantrone hydrochloride, PIXY-321, plicamycin, porfimer sodium, prednimustine, procarbazine, progestins, pyrazopurine, razoxane, sar Gramostim, Semustine, Spirogermanium, Spiromustine, Streptonigreen, Streptozocin, Sulophener, Suramin Sodium, Tamoxifen, Taxolere, Tegapur, Teniposide, Terephthalamidine, Teroxirone, Thioguanine , thiotepa, thymidine injection, thiazopurine, topotecan, toremifene, tretinoin, trifluoperazine hydrochloride, trifluridine, trimetrexate, tumor necrosis factor (TNF), uracil mustard, vinblastine sulfate , vincristine sulfate, vindesine, vinorelbine, vinzolidine, Yoshi 864, zorubicin, cytosine arabinoside, etoposide, melparan, taxol, and mixtures thereof. Preferably cisplatin, paclitaxel, 5-fluorouracil (5-FU), methotrexate, doxorubicin, daunorubicin, cytosine arabinoside, etoposide, melparan, chlorambucil, cyclophosphamide, vindesine, mycobacteria Tomycin, bleomycin, tamoxifen and taxol, more preferably cisplatin, paclitaxel or 5-fluorouracil (5-FU), but combined treatment with the composition of the present invention to achieve the purpose of showing a synergistic effect on anticancer effect To do so, it is not limited thereto.

The cancer is colorectal cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, esophageal cancer, small intestine cancer , perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureteric cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma , intraocular melanoma, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, glioblastoma multiforme, and pituitary gland It may be any one selected from the group consisting of adenomas.

As used herein, the term "treatment" refers to any activity that ameliorates or beneficially alters the death of cancer cells or symptoms of cancer by administering a composition containing the nucleic acid of the present invention. Those of ordinary skill in the art to which the present invention pertains will be able to determine the degree of improvement, enhancement and treatment by knowing the exact criteria of the disease for which the composition of the present application is effective by referring to the data presented by the Korean Medical Association, etc. will be.

In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group consisting of oral formulations, external preparations, suppositories, sterile injection solutions, and sprays.

A therapeutically effective amount of the composition of the present invention may vary depending on several factors, such as the method of administration, the target site, and the condition of the patient. Therefore, when used in the human body, the dosage should be determined in an appropriate amount considering both safety and efficiency. It is also possible to estimate the amount to be used in humans from the effective amount determined through animal experiments. These considerations in determining an effective amount can be found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The composition of the present invention may also include a carrier, diluent, excipient or a combination of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used. Customary additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate formulations for injection, such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or component by using an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition to the composition of the present invention, one or more active ingredients exhibiting the same or similar functions may be contained. The composition of the present invention includes 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, Mannitol, Taffy, Gum Arabic, Pregelatinized Starch, Corn Starch, Powdered Cellulose, Hydroxypropyl Cellulose, Opadry, Sodium Starch Glycolate, Carnauba Lead, Synthetic Aluminum Silicate, Stearic Acid, Magnesium Stearate, Aluminum Stearate, Stearic Acid Calcium, white sugar, dextrose, sorbitol, and talc may be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 part by weight to 90 parts by weight based on the composition, but is not limited thereto.

The composition of the present invention may be parenterally administered (for example, intravenously, subcutaneously, intraperitoneally, or topically applied) or orally, depending on the desired method, and the dosage may vary depending on the patient's weight, age, sex, health condition, The range varies according to diet, administration time, administration method, excretion rate, and severity of disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to divide the administration once or several times a day.

Liquid formulations for oral administration of the composition of the present invention include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, and preservatives in addition to water and liquid paraffin, which are commonly used simple diluents etc. may be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, suppositories, and the like.

The pharmaceutical composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.

The present invention will be described in more detail through the following examples. However, the following examples are only for specifying the content of the present invention, and the present invention is not limited thereto.

Example 1. Construction of mTOR and STAT3 dual target siRNA

Dual-targeting siRNA (double strand) capable of simultaneously inhibiting STAT3 (signal transducer and activator of transcription 3) and mTOR (mammalian target of rapamycin) was prepared according to the sequence shown in Table 1 below (Bioneer, Daejeon, Korea). Specifically, siRNAs of SEQ ID NOs: 1 and 2 of Set 1 have 15 mer out of 19 mer, siRNAs of SEQ ID NOs 3 and 4 of Set 2 have 15 mer out of 19 mer, and siRNAs of SEQ ID NO 5 and 6 of Set 3 have 15 mer out of 19 mer. , siRNAs of SEQ ID NOs: 7 and 8 of set 4 bind 16 mer out of 20 mer, and siRNAs of SEQ ID NOs 9 and 10 of set 5 bind 15 mer out of 19 mer complementarily. In addition, siRNAs of SEQ ID NOs: 11 and 12 of Set 6 have 17mers out of 20mers, siRNAs of SEQ ID NOs: 13 and 14 of Set 7 have 17mers out of 19mers, siRNAs of SEQ ID NOs 15 and 16 of Set 8 have 16mers out of 19mers, siRNAs of SEQ ID NOs: 17 and 18 of set 9 bind 17mers out of 20mers, and siRNAs of SEQ ID NOs: 17 and 18 of set 10 bind complementaryly to 16mers out of 19mers. After the two sequences of each set of Table 1 entered into the cell in the form of a double strand, the sense siRNA (antisense_mTOR) of each set was mTOR mRNA (gi|206725550|ref|NM_004958.3| Homo sapiens mechanistic target of rapamycin (serine/ threonine kinase (MTOR), mRNA), and antisense siRNA (antisense_STAT3) binds to STAT3 mRNA (gi|47080104|ref|NM_139276.2| Homo sapiens signal transducer and activator of transcription 3 (acute- phase response factor (STAT3), transcript variant 1, mRNA), and simultaneously reduce the expression of mTOR and STAT3 genes.

set siRNA Sequence(sense), 5'-3' sequence number Sequence (antisense), 5'-3' sequence number length complementary bond length One si-MS1 UGGAGCAUGUCCAUGAUGA One UCAUCCUGGAGAUUCUCUA 2 19 15 2 si-MS2 CGGGGCAACAAAUUAAGGA 3 UUCUUAAUUUGUUGACGGG 4 19 15 3 si-MS3 UCUAUCUCCCAGGCCUAAA 5 UUGAGGCCUUGGUGAUACA 6 19 15 4 si-MS4 UCAUGGCCUUUUAGAAGGAA 7 UUCGUUCCAAAAGGGCCAGGA 8 20 16 5 si-MS5 CUGGCUAACCACAUGAGCA 9 UGCUAAUGACGUUAUCCAG 10 19 15 6 si-MS6 UCAGCCACAGCAGCUUGGC 11 GUCAAGCUGCUGUAGCUGA 12 19 17 7 si-MS7 CCCCAUGCAGCUGCAGCAG 13 CUGCCGCAGCUCCAUUGGG 14 19 16 8 si-MS8 CAGCGCAUGCGGCCCAGCA 15 UGCUGGGCCGCAGUGGCUG 16 19 16 9 si-MS9 GCAGCGCAUGCGGCCCAGCA 17 UGCUGGCCGCAGUGGCUGC 18 20 17 10 si-MS10 GCAGCGCAUGCGGCCCAGC 19 GCUGGGCCGCAGUGGCUGC 20 19 16

Example 2. Construction of mTOR and STAT3 dual target shRNA expression cassettes

In order to express the siRNA prepared in the above example in cells, a cassette expressing shRNA was prepared. Specifically, a DNA sequence encoding shRNA (shRNA Expression cassettes (TTGGATCCAA loop shRNA and TTCAAGAGAG loop shRNA) were constructed. The prepared shRNA expression cassettes were placed after the U6 promoter at the restriction enzyme PstI and EcoRV cutting positions of the pE3.1 vector (Fig. 1), respectively, to obtain two types of shRNAs including dual target siRNAs targeting mTOR and STAT3. A recombinant expression vector for expression in cells was constructed.

Example 3. Confirmation of gene expression inhibition effect of dual target siRNA

After dispensing Hela cells at a density of 2×10 ⁵ cells/well in a 6-well plate, the cell density was 50% in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) at 37°C. , and cultured under 5% CO ₂ conditions. Thereafter, the cells were transfected with lipofectamine3000 (Invitrogen, Carlsbad, CA, USA) for the dual target siRNAs of sets 1 to 10 prepared in Example 1, respectively, to simultaneously knock down mTOR and STAT3, and as a positive control CA102 (a set of conventional double-stranded siRNAs that simultaneously inhibit mTOR and STAT3: gacuguggcauccaccugcau and augcagguaggcgccucaguc) was used. 72 hours after transfection, the cells were disrupted and total RNA was extracted using the GeneJET RNA Purification Kit (Invitrogen). A reverse transcription reaction was performed with RevoScriptTM RT PreMix (iNtRON BIOTECHNOLOGY) using the extracted total RNA as a template. For mTOR (Hs00234522_m1), STAT3 (Hs01047580_m1) and GAPDH (Hs02758991_g1) using AmpONE taq DNA polymerase (GeneAll) and TaqMan Gene Expression assays (Applied Biosystems), ABI The reaction was performed using a PRISM 7700 Sequence Detection System and QS3 Real-time PCR (Biosystems). Real-time PCR reaction conditions were [50 ° C. for 2 minutes, 95 ° C. for 10 minutes, and 95 ° C. for 15 seconds and 60 ° C. for 60 seconds in two stages] for a total of 40 cycles. All reactions were repeated three times and their average values were taken. The results obtained in this way were normalized to the mRNA value of GAPDH, a housekeeping gene.

As a result, among the dual target siRNAs of sets 1 to 10, set 1 (mTOR/STAT3 #2), sets 4, 5, 8, 9 and 10 showed that mTOR and STAT3 were significantly inhibited compared to the control group, and dual target siRNA It was found that both genes were simultaneously inhibited (Fig. 2).

<110> CURIGIN CO.,Ltd <120> Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene <130> PN <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS1 sense <400> 1 uggagcaugu ccaugauga 19 <210> 2 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS1 antisense <400> 2 ucauccugga gauucucua 19 <210> 3 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS2 sense <400> 3 cggggcaaca aauuaagga 19 <210> 4 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS2 antisense <400> 4 uucuuaauuu guugacggg 19 <210> 5 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS3 sense <400> 5 ucuaucuccc aggccuaaa 19 <210> 6 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS3 antisense <400> 6 uugaggccuu ggugauaaca 19 <210> 7 <211> 20 <212> RNA <213> artificial sequence <220> <223> si-MS4 sense <400> 7 ucauggccuu uuagaaggaa 20 <210> 8 <211> 20 <212> RNA <213> artificial sequence <220> <223> si-MS4 antisense <400> 8 uucguuccaa agggccagga 20 <210> 9 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS5 sense <400> 9 cugcuaacc acaugagca 19 <210> 10 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS5 antisense <400> 10 ugcuaaugac guuauccag 19 <210> 11 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS6 sense <400> 11 ucagccacag cagcuuggc 19 <210> 12 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS6 antisense <400> 12 gucaagcugc uguagcuga 19 <210> 13 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS7 sense <400> 13 ccccaugcag cugcagcag 19 <210> 14 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS7 antisense <400> 14 cugccgcagc uccauuggg 19 <210> 15 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS8 sense <400> 15 cagcgcaugc ggcccagca 19 <210> 16 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS8 antisense <400> 16 ugcugggccg caguggcug 19 <210> 17 <211> 20 <212> RNA <213> artificial sequence <220> <223> si-MS9 sense <400> 17 gcagcgcaug cggcccagca 20 <210> 18 <211> 20 <212> RNA <213> artificial sequence <220> <223> si-MS9 antisense <400> 18 ugcugggccg caguggcugc 20 <210> 19 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS10 sense <400> 19 gcagcgcaug cggcccagc 19 <210> 20 <211> 19 <212> RNA <213> artificial sequence <220> <223> si-MS10 antisense <400> 20 gcugggccgc aguggcugc 19

Claims (13)

A nucleic acid molecule that simultaneously inhibits the expression of mTOR (mammalian target of rapamycin) gene and STAT3 (signal transducer and activator of transcription 3) gene. The nucleic acid molecule according to claim 1, comprising a base sequence having 80% or more homology with each of the base sequences represented by SEQ ID NOs: 1 to 20. The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 inhibits expression of the mTOR gene by RNA interference. . The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20 inhibits the expression of the STAT3 gene by RNA interference. . The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule that inhibits the expression of the mTOR gene forms a double strand with a nucleic acid molecule that inhibits the expression of the STAT3 gene through partial or 100% complementary binding. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule that inhibits the expression of the mTOR gene comprises a base sequence having 60% or more complementarity with the reverse complementary sequence of the nucleic acid molecule that inhibits the expression of the STAT3 gene. The method of claim 1, wherein the shRNA (short hairpin RNA) comprising a nucleotide sequence sequentially encoding a nucleic acid molecule that inhibits expression of the mTOR gene, a loop sequence capable of forming a hairpin structure, and a nucleic acid molecule that inhibits the expression of the STAT3 gene ), a nucleic acid molecule. A recombinant expression vector comprising the nucleic acid molecule of claim 1 . 9. The recombinant expression vector according to claim 8, comprising an expression cassette encoding a nucleic acid molecule that inhibits the expression of the mTOR gene and a nucleic acid molecule that inhibits the expression of the STAT3 gene. A virus into which the recombinant expression vector of claim 8 is introduced. 11. The virus of claim 10, further comprising the human telomere promoter (hTERT). A pharmaceutical composition for preventing or treating cancer comprising the nucleic acid molecule of claim 1, the recombinant expression vector of claim 8, or the virus of claim 10 as an active ingredient. The pharmaceutical composition for preventing or treating cancer according to claim 12, further comprising an anticancer agent.

Images