KR102145665B1 - Nucleic acids for simultaneous inhibition of BCL2 gene and BI-1 gene - Google Patents

Abstract

The present invention relates to a nucleic acid molecule that simultaneously suppresses the expression of the BCL2 gene and the BI-1 gene, and to a pharmaceutical composition for anticancer comprising the same, and specifically, to overcome the disadvantage of not having a high therapeutic effect due to the target specificity of siRNA. For this purpose, the double-stranded siRNA of the present invention, designed to simultaneously inhibit the expression of the BCL2 gene and BI-1 gene related to cancer, promotes the death of cancer cells, and has the effect of synergistically improving cancer cell death in combination treatment with an anticancer agent. , It can be usefully used as an anticancer composition or anticancer adjuvant for various cancer types.

Description

Nucleic acids that simultaneously inhibit the expression of BCL2 gene and BI-1 gene {Nucleic acids for simultaneous inhibition of BCL2 gene and BI-1 gene}

The present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of the BCL2 gene and the BI-1 gene, and an anticancer pharmaceutical composition comprising the same.

Cancer is one of the most fatal diseases in the world, and the development of innovative cancer treatments can reduce medical costs incurred during treatment and create high added value. In addition, according to statistics from 2008, molecular treatments that can overcome existing anticancer drug resistance accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, and UK), and about 2018 It occupies a market size of about $45 billion, and is expected to show a growth rate of 9.5% compared to 2008. Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy. Among them, chemotherapy is a treatment that inhibits or kills the proliferation of cancer cells as a chemical substance. The development of an anticancer drug that selectively acts on cancer cells and does not develop resistance is urgent because resistance occurs, which shows a degree of toxicity, and the effect is lost after a certain period of use, even though the anticancer drug is effective. 2004. 6(19)). Recently, the development of new anticancer drugs targeting the molecular characteristics of cancer is in progress through securing molecular genetic information about cancer, and anticancer drugs targeting characteristic molecular targets that only cancer cells have are drug resistant. There are also reports that this does not occur.

Technology that suppresses gene expression is an important tool in the development of therapeutic agents and target verification for disease treatment. Interfering RNA (RNA interference, hereinafter referred to as "RNAi") has been found to act on sequence-specific mRNA in a variety of mammalian cells (Silence of the transcripts: RNA interference in medicine.J Mol Med (2005) 83: 764773). RNAi is a small interfering ribonucleic acid short interfering RNA (small interfering RNA, hereinafter referred to as "siRNA") with a double helix structure of 21-25 nucleotides, specifically binding to a transcript with a complementary sequence (mRNA transcript). This is a phenomenon that suppresses the expression of a specific protein by decomposing the transcript. In cells, double-stranded RNA is processed by an endonuclease called Dicer and converted into 21-23 double-stranded siRNAs (base pair, bp), and the siRNA binds to the RNA-induced silencing complex (RISC). Thus, the guide (antisense) strand specifically inhibits the expression of the target gene through the process of recognizing and degrading the target mRNA (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503) -514). According to Bertrand researchers, siRNA against the same target gene has a superior inhibitory effect on mRNA expression in vitro and in vivo than antisense oligonucleotide (ASO), and the effect lasts for a long time. (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). The RNAi technology-based therapeutic market, including siRNA, was analyzed to form a total of 12 trillion won or more in the future global market size, and the targets to which the technology can be applied have been remarkably expanded to include existing antibodies and compound-based drugs. It is evaluated as a next-generation gene therapy technology that can treat difficult-to-treat diseases. In addition, since siRNA's mechanism of action is complementary to the target mRNA and regulates the expression of the target gene sequence-specifically, it is long before conventional antibody-based drugs or small molecule drugs are optimized for specific protein targets. Compared to the development period and cost of development, the applicable targets can be dramatically expanded, and the development period is shortened, enabling the development of lead compounds optimized for all protein targets including target substances that cannot be medicated. (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13(4):664-670). Accordingly, a recent study to use this ribonucleic acid-mediated interference phenomenon for the development of various disease treatments, especially tumor treatments, by selectively inhibiting the expression of specific proteins at the transcript level while presenting a solution to the problems arising in the development of existing chemically synthesized drugs. Is in progress. In addition, siRNA therapeutics have the advantage of predicting side effects due to clear targets unlike existing anticancer drugs, but such target specificity is in the case of tumors, which are diseases caused by problems of various genes, rather, such target specificity does not have a high therapeutic effect. It can also be a cause.

In humans, Bcl-2 (B-cell lymphoma 2), which is encoded by the BCL2 gene, is known as a protein that regulates apoptosis by inducing (pro-apoptotic) or suppressing (anti-apoptotic) apoptosis (" Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation.Science.226 (4678): 1097.).Bcl-2 is considered an important anti-cell death protein, but as a primary cancer-gene. Damage to the Bcl-2 gene has been shown to be the cause of a variety of cancers, including melanoma, breast cancer, prostate cancer, chronic lymphocytic leukemia and lung cancer, and has been shown to be the cause of schizophrenia and autoimmunity. It is also known that this is the cause of resistance to cancer treatment, since Bcl2 is a good target for anticancer drugs, various inhibitors have been developed, but there have been problems in that various side effects and resistance occur.

On the other hand, BI-1 (BAX inhibitor 1) is known to inhibit apoptosis by Bax and protect cells from apoptosis caused by various stimuli. In addition, it has been found that similar proteins exist in microorganisms, including animals, plants, and it is known that their actions and mechanisms are similar.

Currently, Bcl-2 is a target for the development of anticancer drugs, but the present inventors confirmed that even if it inhibits the function of Bcl-2, overexpression of BI-1 inhibits the therapeutic effect of the anticancer agent, and siRNA to inhibit them simultaneously Came to construct.

In the present invention, in order to overcome the disadvantage of not having high therapeutic effect due to the target specificity of siRNA, siRNA that simultaneously suppresses the expression of the BCL2 gene and BI-1 gene related to cancer was produced, and its anticancer activity and synergistic effect with anticancer drugs It is intended to be used as a pharmaceutical composition for preventing or treating cancer by confirming anticancer activity.

In order to achieve the above object, the present invention provides a nucleic acid molecule that simultaneously suppresses the expression of the BCL2 gene and the BI-1 gene.

In addition, the present invention provides a recombinant expression vector containing the nucleic acid molecule.

In addition, the present invention provides a recombinant cell into which the recombinant expression vector has been introduced.

In addition, the present invention provides a pharmaceutical composition for anticancer, comprising the nucleic acid molecule as an active ingredient.

According to the present invention, since the sense strand of the double-stranded siRNA of the present invention inhibits the expression of the BCL2 gene and the antisense strand inhibits the expression of the BI-1 gene, it is possible to simultaneously inhibit both genes, thereby preventing the death of cancer cells. It promotes, and the anticancer activity is remarkable than the one treated with each siRNA together. In addition, it has the effect of synergistically improving cancer cell death in combination treatment with an anticancer agent, and siRNA can be delivered locally and has excellent selectivity, so it can be usefully used as an anticancer composition or anticancer adjuvant for various cancer types.

1 is a diagram confirming the effect of inhibiting the expression of the BCL2 gene and the BI-1 gene by the double target siRNA of the present invention (NC is a control siRNA, si-BB1 to si-BB5 are siRNA sets 1 to 5 of the present invention) .

Hereinafter, the present invention will be described in detail as an embodiment of the present invention. However, the following embodiments are presented as examples of the present invention, and the present invention is not limited thereto, and the present invention can be variously modified and applied within the scope of equality interpreted from the description of the claims to be described later. .

In one aspect, the present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of the BCL2 gene and the BI-1 gene.

In one embodiment, the nucleic acid molecule is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; And SEQ ID NO: 9 and 10; may include a nucleic acid molecule comprising at least one nucleotide sequence selected from the group consisting of.

In one embodiment, the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7 or 9 can inhibit BCL2 (B-cell lymphoma 2) gene expression by RNA interference, and SEQ ID NO: 2, 4 A nucleic acid molecule containing a nucleotide sequence of 6, 8 or 10 can inhibit the expression of the BI-1 (BAX inhibitor 1) gene by RNA interference, and the nucleic acid molecule of the present invention is the BCL2 gene and the BI-1 gene. Expression can be simultaneously suppressed.

In the present invention, the siRNA targeting BCL2 and BI-1 has a sequence complementary to a part of the BCL2 gene or BI-1 gene of human ( Homo sapiens ), and degrades or translates the mRNA of the BCL2 gene or the BI-1 gene. Can be suppressed.

As used herein, the term "expression inhibition" means to cause the expression of a target gene (to mRNA) or translation (to a protein) to decrease, and preferably, the expression of the target gene becomes undetectable or at an insignificant level. It means to exist as.

The term "siRNA (small interfering RNA)" as used herein refers to a short double-stranded RNA capable of inducing RNAi (RNA interference) phenomenon through cleavage of a specific mRNA. In general, siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto, but the double-stranded siRNA of the present invention has a sense RNA strand of SEQ ID NOs: 1, 3, 5, SiRNA consisting of a nucleotide sequence of 7 or 9 (antisense strand for the BCL2 gene), and an antisense RNA strand consisting of a nucleotide sequence of SEQ ID NO: 2, 4, 6, 8 or 10 (antisense strand for the BI-1 gene) Therefore, since the double-stranded siRNA can simultaneously suppress the expression of the BCL2 gene and the BI-1 gene, respectively, it is provided as an efficient gene knock-down method or as a method of gene therapy.

Variants of the base sequence are included within the scope of the present invention. In the nucleic acid molecule of the present invention, a functional equivalent of the nucleic acid molecule constituting it, for example, a partial nucleotide sequence of a nucleic acid molecule that simultaneously suppresses the expression of the BCL2 gene and the BI-1 gene, is deleted, substituted, or Although modified by insertion, it is a concept including variants capable of functioning functionally the same as the nucleic acid molecule. Specifically, the gene includes a nucleotide sequence having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% of the nucleotide sequence of SEQ ID NO: can do. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include additions or deletions (ie, gaps) compared to (not including).

In one embodiment of the present invention, the 20mer siRNA set 1 consisting of SEQ ID NOs: 1 and 2 has 14mers complementary to each other, and the 20mer siRNA set 2 consisting of SEQ ID NOs: 3 and 4 has 14mers complementary to each other, and SEQ ID NO: 5 And siRNA set 3 of 19mers consisting of 6 13mers are complementary to each other, siRNA set 4 of 19mers consisting of SEQ ID NOs: 7 and 8 is complementary to each other, siRNA set 5 of 18mers consisting of SEQ ID NOs: 9 and 10 is 12mer They are complementary to each other.

The siRNA of SEQ ID NO: 1, 3, 5, 7 or 9 (Antisense Bcl-2) can complementarily bind to the mRNA of Bcl-2. In addition, siRNA of SEQ ID NO: 2, 4, 6, 8 or 10 (Antisense BI-1) binds complementarily to the mRNA of BI-1, thereby simultaneously reducing the expression of the Bcl-2 and BI-1 genes.

In one aspect, the present invention relates to a recombinant expression vector comprising the nucleic acid molecule of the present invention.

In the present specification, the term "vector" refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Phagemid vector; Cozmid vector; And viral vectors such as bacteriophage vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors, and the like, preferably adenovirus vectors, but are not limited thereto.

The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence are generally included. When E. coli (eg HB101, BL21, DH5α, etc.) is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018- 1024) and a left-facing promoter of the phage (pLλ promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14:399-445) can be used as a regulatory site.

On the other hand, the vector that can be used in the present invention is a plasmid often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series, and pUC19, etc.), phagemid (eg pComb3X), phage (M13, etc.) or viruses (eg SV40, etc.).

On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and private promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be fused with other sequences as necessary to facilitate protein purification of amino acids, and the fused sequence is, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA) may be used, but are not limited thereto. In addition, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin , Neomycin and tetracycline resistance genes.

In one embodiment, the recombinant expression vector of the present invention may include siRNA comprising the nucleotide sequence of SEQ ID NO: 1 to 10.

The recombinant vector of the present invention can be prepared by a recombinant DNA method known in the art, and in one embodiment, a pE3.1 vector was used.

In the present invention, useful non-viral vectors for delivering siRNA against BCL2 and BI-1 include all vectors commonly used in gene therapy, and include, for example, various plasmids and liposomes that can be expressed in eukaryotic cells.

In the present invention, in order to ensure that the double-stranded siRNA targeting BCL2 and BI-1 is properly transcribed in the transferred cell, the shRNA containing the same may be operably linked to a promoter. The promoter may be any promoter capable of functioning in eukaryotic cells, but the U7 promoter is more preferred. For efficient transcription of double-stranded siRNA or shRNA targeting BCL2 and BI-1, regulatory sequences including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences, and transcription terminators are used as needed. It may be included in addition.

Viruses or viral vectors useful for delivering siRNA or shRNA against BCL2 and BI-1 in the present invention include baculoviridiae, parvoviridiae, picornoviridiae, and Herpes. Viridiae (herepesviridiae), poxviridiae (poxviridiae), adenoviridiae (adenoviridiae), and the like, but are not limited thereto.

In one aspect, the present invention relates to an anticancer pharmaceutical composition comprising the nucleic acid molecule of the present invention as an active ingredient.

In one embodiment, the anticancer pharmaceutical composition of the present invention may further include an anticancer agent, and the anticancer agent is acibicin, aclarubicin, acodazole, acronycin, adozelesin, alanosine, aldesru Kin, allopurinol sodium, altretamine, aminoglutethymide, amonapide, ampligen, amsacrine, androgens, anguidin, apidicholine glycinate, asale, asparaginase, 5- Azacytidine, azathioprine, Bacillus calmethe-guerine (BCG), Bakers antipol, beta-2-dioxythioguanosine, bisanthrene HCl, bleomycin sulfate, bullsulfone, butionine sulfoximine , BWA 773U82, BW 502U83/HCl, BW 7U85 mesylate, cerasemide, carbetimer, carboplatin, carmustine, chlorambucil, chloroquinoxaline-sulfonamide, chlorozotocin, chromomycin A3 , Cisplatin, Cladribine, Corticosteroid, Corynebacterium parboom, CPT-11, Crisnatol, Cyclocytidine, Cyclophosphamide, Cytarabine, Cytembena, Dabis Maleate, Decarbazine, Dactino Mycin, Daunorubicin HCl, Diazauridine, Dexrazoic Acid, Deionhydro Galactitol, Diaziquone, Dibromodulcitol, Didamine B, Diethyldithiocarbamate, Diclycoaldehyde, Dihydro -5-Azacytin, doxorubicin, ethinomycin, dedatrexate, edelfosin, eflonitin, ellios solution, elsamitrusin, epirubicin, esorubicin, estramustine phosphate, estrogen, ethanidazole , Ethiophos, Etoposide, Padrazole, Pazarabine, Penretinide, Pilgrastim, Finasteride, Flavone Acetic Acid, Phloxuridine, Fludarabine Phosphate, 5'-Fluorouracil, Fluosol, Flutamide, Gallium nitrate, gemcytabine, goserelin acetate, hefsulfame, hexamethylene bisacetamide, homoharingtonine, hydrazine sulfate, 4-hydroxyandrostenedione, hydrodiurea, idarubicin HCl, ifosfamide , 4-ipomeanol, iproplatin, isotretinoin, leucovorin calcium, leuprolide acetate Ytte, levamisol, liposome daunorubicin, liposome capture doxorubicin, romastin, ronidamine, mytansine, mechloretamine hydrochloride, melphalan, menogaryl, merbaron, 6-mercaptopurine, mesna, bacillus knife Methanol extract of rete-guerine, methotrexate, N-methylformamide, mifepristone, mitoguazone, mitomycin-C, mitotan, mitoxantrone hydrochloride, monosite/macrophage colony-stimulating factor, nabilon, Napoxidine, Neocarzinostatin, Octreotide Acetate, Ormaplatin, Oxaliplatin, Paclitaxel, Pala, Pentostatin, Piperazindione, Pipobroman, Pirarubicin, Pytrexim, Piroxantrone Hydrochloride , PIXY-321, Plicamycin, Porpimer Sodium, Prednimustine, Procarbazine, Progestins, Pyrazofurine, Razox Acid, Sargramostim, Semustine, Spirogermanium, Spiromustine, Streptonimustine, Streptozosine, Sulopener, Suramine Sodium, Tamoxifen, Taxorere, Tegafur, Teniposide, Terephthalamidine, Teroxirone, Thioguanine, Thiotepa, Thymidine Injection, Thiazofurine, Topotecan, Torremifen, Tretinoin, trifluoroperazine hydrochloride, trifluridine, trimetrexate, TNF (tumor necrosis factor), uracil mustard, vinblastine sulfate, vincristine sulfate, vindesine, vinorelbine, vinzolidin, Yoshi 864, It is at least one selected from the group consisting of zorubicin, cytosine arabinoside, etoposide, melparan, and taxol, and preferably BT-737, Taxol, Cisplatin or Etoposide, or , In order to achieve the purpose of effectively exhibiting a synergistic effect in combination with the dual target siRNA set 1-5 of the present invention, it is not limited thereto.

In one embodiment, the cancer is colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer , Esophageal cancer, small intestine cancer, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, Cervical cancer, cutaneous melanoma, intraocular melanoma, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, It may be any one selected from the group consisting of glioblastoma polymorphism and adenoma of the pituitary gland, more preferably prostate cancer or cervical cancer.

The term "treatment" as used in the present invention refers to any act of improving or beneficially altering the death of cancer cells or symptoms of cancer by administration of a composition containing the nucleic acid of the present invention. Those of ordinary skill in the art to which the present invention pertains can know the exact criteria of the disease in which the composition of the present application is effective, and determine the degree of improvement, improvement and treatment by referring to data presented by the Korean Medical Association. will be.

In one embodiment, the pharmaceutical composition may be one or more dosage forms selected from the group including oral dosage forms, external preparations, suppositories, sterile injectable solutions and sprays.

The therapeutically effective amount of the composition of the present invention may vary depending on various factors, for example, the method of administration, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations when determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The compositions of the present invention may also contain carriers, diluents, excipients or combinations of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivery of the composition in vivo, and, for example, Merck Index, 13th ed., Merck & Co. Inc. Compounds described in, saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and antioxidants, buffers, bacteriostatic agents, etc. Conventional additives can be added. In addition, a diluent, a dispersant, a surfactant, a binder, and a lubricant may be additionally added to form an injectable formulation such as an aqueous solution, a suspension, an emulsion, and a pill, capsule, granule, or tablet. Furthermore, it may be preferably formulated according to each disease or component by an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition to the composition of the present invention, it may contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention contains 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid Calcium, sucrose, dextrose, sorbitol, talc, and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

The composition of the present invention may be parenterally administered (for example, intravenously, subcutaneously, intraperitoneally or topically applied) or orally according to a desired method, and the dosage may be the patient's weight, age, sex, health status, The range varies depending on diet, administration time, administration method, excretion rate, and severity of disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to administer once to several times a day.

Liquid formulations for oral administration of the composition of the present invention include suspensions, liquid solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, preservatives, in addition to water and liquid paraffin, which are commonly used simple diluents. Etc. may be included together. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, and the like.

The pharmaceutical composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.

The present invention will be described in more detail through the following examples. However, the following examples are only for embodiing the contents of the present invention and the present invention is not limited thereto.

Example 1. Construction of dual target siRNA

A double target siRNA (double strand) capable of simultaneously inhibiting BCL2 (B-cell lymphoma 2) and BI-1 (BAX inhibitor 1) was constructed with the sequence shown in Table 1 below (Bioneer, Daejeon, Korea).

set siRNA Sequence(sense), 5'-3' Sequence number Sequence(antisense), 5'-3' Sequence number length Complementary bond length One si-BB1 AAG AAG AGG AGA AAA AAA UG One CAU UUC UUC UCU UUC UUC UU 2 20mer 14mer 2 si-BB2 AGA AGA GGA GAA AAA AAU GA 3 CAU UUC UUC UCU UUC UUC UU 4 20mer 14mer 3 si-BB3 GAA GAG GAG AAA AAA AUG A 5 UCA UUU CUU CUC UUU CUU C 6 19mer 13mer 4 si-BB4 AGA AGA GGA GAA AAA AAU G 7 CAU UUC UUC UCU UUC UUC U 8 19mer 13mer 5 si-BB5 GAA GAG GAG AAA AAA AUG 9 CAU UUC UUC UCU UUC UUC 10 18mer 12mer

In the siRNA set 1 of 20mers consisting of SEQ ID NOs: 1 and 2, 14mers are complementary to each other. In the siRNA set 2 of 20mers consisting of SEQ ID NOs: 3 and 4, 14mers are complementary to each other. In the siRNA set 3 of 19mers consisting of SEQ ID NOs: 5 and 6, 13mers are complementary to each other. In the siRNA set 4 of 19mers consisting of SEQ ID NOs: 7 and 8, 13mers are complementary to each other. In the siRNA set 5 of 18mers consisting of SEQ ID NOs: 9 and 10, 12mers are complementary to each other.

The siRNA of SEQ ID NO: 1, 3, 5, 7 or 9 (Antisense Bcl-2) binds complementarily to the mRNA of Bcl-2. In addition, siRNA of SEQ ID NO: 2, 4, 6, 8 or 10 (Antisense BI-1) binds complementarily to the mRNA of BI-1, thereby simultaneously reducing the expression of Bcl-2 and BI-1 genes.

Experimental Example 1. Confirmation of the effect of double target siRNA on inhibiting Bcl-2 and BI-1 gene expression

After dispensing Hela, Hek293 and A549 cells into a 12-well plate, respectively, in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) until the cell confluent reaches 50%, 37°C, 5% CO ₂ conditions Was cultured. Thereafter, the double target siRNA prepared in Example 1 was transfected with 3 μl of lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) at 80 pmoles per well into the wells in which the cells were cultured, and BCL2 And BI-1 were knocked down at the same time. 48 hours after transfection, cells were disrupted and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). The extracted total RNA was used as a template and reverse transcribed to cDNA through RT-PCR reaction, and then mRNA expression levels of BCL2 and BI-1 by double target siRNA were confirmed through q-PCR reaction. Specifically, the mRNA of BCL2 and BI-1 in the cell lysate knocked down under the PCR conditions of Table 4 was converted into cDNA using the primer set of Table 2 and the reaction mixture of Table 3 below.

Sequence (5'→3') Sequence number BCL2
forward TTTGAGTTCGGTGGGGTCAT 11 reverse TGACTTCACTTGTGGCCCAG 12 BI-1
forward GCCGGGTAAAAGATCGGGAG 13 reverse AAGATCATTGCCGTGCCCAT 14 GAPDH
forward CTAGGCGCTCACTGTTCTCTC 15 reverse GTCCGAGCGCTGACCTT 16

10X reaction buffer 2 μl HQ Buffer 2 μl dNTP 1.6µl Primer(F, R, 10 pmole/ul) 1µl each Template(500 ng) 2 μl Taq 0.2 μl DW 10.2µl Total vol. 20µl

Pre heat 95 ℃ 2 min Denaturation 95 ℃ 20 sec 30 cycles Annealing 60 ℃ 10 sec Extension 72 ℃ 30 ~ 60 sec Final extension 72 ℃ 5 min

Using the reverse transcribed cDNA as a template, a reaction mixture was prepared in the composition shown in Table 5 below, and qPCR was performed under the conditions shown in Table 6. For reference, the probes used were Bcl2 (Thermo, Hs00608023_m1), BI-1 (Thermo, Dm01835892_g1), GAPDH (Thermo, Hs02786624_g1), and were performed using QS3 equipment. All reactions were repeated 3 times and their average value was taken. The results obtained were normalized to the mRNA value of the housekeeping gene GAPDH.

Template(RT-PCR product) 6µl Taqman probe 3µl 10X reaction buffer 6µl HQ Buffer 6µl dNTP 4.8µl Taq 0.6µl DW 10.2µl Total vol. 60µl

Pre denaturation 95 ℃ 10 min Denaturation 95 ℃ 15 sec 40 cycles Extension 60 ℃ 1 min

As a result, the expression of both BCL2 and BI-1 was decreased by the double target siRNA set 1-5, and it was found that the double target siRNA of the present invention simultaneously suppressed the expression of both genes (Fig. 2).

Therefore, the dual target siRNA of the present invention simultaneously inhibits the expression of two genes, thereby promoting the death of cancer cells, confirming that remarkable anti-cancer activity is shown, and will be usefully used as an anti-cancer composition or anti-cancer adjuvant for various carcinomas. Suggests that you can.

<110> Curigin Co., Ltd <120> Nucleic acids for simultaneous inhibition of BCL2 gene and BI-1 gene <130> PN1806-202 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-BB1_sense RNA (BCL2 antisense) <400> 1 aagaagagga gaaaaaaaug 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-BB1_antisense RNA (BI-1 antisense) <400> 2 cauuucuucu cuuucuucuu 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-BB2_sense RNA (BCL2 antisense) <400> 3 agaagaggag aaaaaaauga 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-BB2_antisense RNA (BI-1 antisense) <400> 4 cauuucuucu cuuucuucuu 20 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-BB3_sense RNA (BCL2 antisense) <400> 5 gaagaggaga aaaaaauga 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-BB3_antisense RNA (BI-1 antisense) <400> 6 ucauuucuuc ucuuucuuc 19 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-BB4_sense RNA (BCL2 antisense) <400> 7 agaagaggag aaaaaaaug 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-BB4_antisense RNA (BI-1 antisense) <400> 8 cauuucuucu cuuucuucu 19 <210> 9 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-BB5_sense RNA (BCL2 antisense) <400> 9 gaagaggaga aaaaaaug 18 <210> 10 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-BB5_antisense RNA (BI-1 antisense) <400> 10 cauuucuucu cuuucuuc 18 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BCL2 foward primer <400> 11 tttgagttcg gtggggtcat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BCL2 reverse primer <400> 12 tgacttcact tgtggcccag 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BI-1 forward primer <400> 13 gccgggtaaa agatcgggag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BI-1 reverse primer <400> 14 aagatcattg ccgtgcccat 20 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 15 ctaggcgctc actgttctct c 21 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 16 gtccgagcgc tgacctt 17

Claims (9)

A nucleic acid molecule that simultaneously inhibits the expression of the BCL2 gene and the BI-1 gene. The nucleic acid molecule includes SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; And SEQ ID NO: 9 and 10; Nucleic acid molecule comprising at least one nucleotide sequence or a nucleotide sequence encoding the same selected from the group consisting of. delete The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7 or 9 inhibits BCL2 (B-cell lymphoma 2) gene expression by RNA interference. . The nucleic acid according to claim 1, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8 or 10 inhibits the expression of the BI-1 (BAX inhibitor 1) gene by RNA interference. molecule. The method of claim 1, wherein SEQ ID NO: 1 is SEQ ID NO: 2, SEQ ID NO: 3 is SEQ ID NO: 4, SEQ ID NO: 5 is SEQ ID NO: 6, SEQ ID NO: 7 is SEQ ID NO: 8, and SEQ ID NO: 9 is SEQ ID NO: 10 Nucleic acid molecule, characterized in that the double-stranded siRNA forming a partial complementary bond with. A nucleic acid molecule that simultaneously inhibits the expression of the BCL2 gene and the BI-1 gene. The nucleic acid molecule includes SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; And SEQ ID NO: 9 and 10; Recombinant expression vector comprising a nucleic acid molecule encoding at least one nucleotide sequence selected from the group consisting of. A transformed cell into which the recombinant expression vector of claim 6 has been introduced. An anticancer pharmaceutical composition for prostate cancer or cervical cancer comprising the nucleic acid molecule of claim 1 as an active ingredient. The pharmaceutical composition for anticancer of prostate cancer or cervical cancer according to claim 8, further comprising an anticancer agent.

Images