KR102145664B1 - Nucleic acids for simultaneous inhibition of AR gene and mTOR gene - Google Patents

Abstract

The present invention relates to a nucleic acid molecule that simultaneously suppresses the expression of the AR gene and the mTOR gene, and an anticancer pharmaceutical composition comprising the same, and specifically, in order to overcome the disadvantage of not having a high therapeutic effect due to the target specificity of siRNA, The double-stranded siRNA of the present invention, designed to simultaneously inhibit the expression of cancer-related AR gene and mTOR gene, promotes the death of cancer cells and has the effect of synergistically improving cancer cell death in combination treatment with anticancer agents. It can be usefully used as an anticancer composition or anticancer adjuvant.

Description

Nucleic acids that simultaneously inhibit the expression of AR gene and mTOR gene {Nucleic acids for simultaneous inhibition of AR gene and mTOR gene}

The present invention relates to a nucleic acid molecule that simultaneously suppresses the expression of the AR gene and the mTOR gene, and an anticancer pharmaceutical composition comprising the same.

Cancer is one of the most fatal diseases in the world, and the development of innovative cancer treatments can reduce medical costs incurred during treatment and create high added value. In addition, according to statistics from 2008, molecular treatments that can overcome existing anticancer drug resistance accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, and UK), and about 2018 It occupies a market size of about $45 billion, and is expected to show a growth rate of 9.5% compared to 2008. Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy. Among them, chemotherapy is a treatment that inhibits or kills the proliferation of cancer cells as a chemical substance. The development of an anticancer drug that selectively acts on cancer cells and does not develop resistance is urgent because resistance occurs, which shows a degree of toxicity, and the effect is lost after a certain period of use, even though the anticancer drug is effective. 2004. 6(19)). Recently, the development of new anticancer drugs targeting the molecular characteristics of cancer is in progress through securing molecular genetic information about cancer, and anticancer drugs targeting characteristic molecular targets that only cancer cells have are drug resistant. There are also reports that this does not occur.

Technology that suppresses gene expression is an important tool in the development of therapeutic agents and target verification for disease treatment. Interfering RNA (RNA interference, hereinafter referred to as "RNAi") has been found to act on sequence-specific mRNA in a variety of mammalian cells (Silence of the transcripts: RNA interference in medicine.J Mol Med (2005) 83: 764773). RNAi is a small interfering ribonucleic acid short interfering RNA (small interfering RNA, hereinafter referred to as "siRNA") with a double helix structure of 21-25 nucleotides, specifically binding to a transcript with a complementary sequence (mRNA transcript). This is a phenomenon that suppresses the expression of a specific protein by decomposing the transcript. In cells, double-stranded RNA is processed by an endonuclease called Dicer and converted into 21-23 double-stranded siRNAs (base pair, bp), and the siRNA binds to the RNA-induced silencing complex (RISC). Thus, the guide (antisense) strand specifically inhibits the expression of the target gene through the process of recognizing and degrading the target mRNA (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503) -514). According to Bertrand researchers, siRNA against the same target gene has a superior inhibitory effect on mRNA expression in vitro and in vivo than antisense oligonucleotide (ASO), and the effect lasts for a long time. (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). The RNAi technology-based therapeutic market, including siRNA, was analyzed to form a total of 12 trillion won or more in the future global market size, and the targets to which the technology can be applied have been remarkably expanded to include existing antibodies and compound-based drugs. It is evaluated as a next-generation gene therapy technology that can treat difficult-to-treat diseases. In addition, since siRNA's mechanism of action is complementary to the target mRNA and regulates the expression of the target gene sequence-specifically, it is long before conventional antibody-based drugs or small molecule drugs are optimized for specific protein targets. Compared to the development period and cost of development, the applicable targets can be dramatically expanded, and the development period is shortened, enabling the development of lead compounds optimized for all protein targets including target substances that cannot be medicated. (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13(4):664-670). Accordingly, a recent study to use this ribonucleic acid-mediated interference phenomenon for the development of various disease treatments, especially tumor treatments, by selectively inhibiting the expression of specific proteins at the transcript level while presenting a solution to the problems arising in the development of existing chemically synthesized drugs. Is in progress. In addition, siRNA therapeutics have the advantage of predicting side effects due to clear targets unlike existing anticancer drugs, but such target specificity is in the case of tumors, which are diseases caused by problems of various genes, rather, such target specificity does not have a high therapeutic effect. It can also be a cause.

Androgen receptor (AR) is a kind of nuclear receptor that is activated by binding any one of androgen hormone, testosterone, or dihydrotestosterone to the cytoplasm and then translocating to the nucleus (International Union of Pharmacology. LXV. The pharmacology and classification of the nuclear receptor superfamily: glucocorticoid, mineralocorticoid, progesterone, and androgen receptors.Pharmacological Reviews. 58 (4): 782-97.), the main function is DNA binding transcription factors that regulate gene expression (Biological actions of androgens. Endocrine Reviews. .8 (1): 1-28.). Androgen receptors are modified by post-translational modification through acetylation, which is known to directly promote AR-mediated transactivation, apoptosis, and contact independent growth of prostate cancer cells (Acetylation). of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth.Molecular and Cellular Biology. 23 (23): 8563-75), an inhibitor targeting the N-terminal domain of the protein, considered important for therapeutic targets in prostate cancer, is being developed. .

On the other hand, mTOR (mammalian target of rapamycin) is cytokine-stimulated cell proliferation, translation of mRNA for several important proteins that regulate the G1 phase of the cell cycle, and interleukin-2 (IL It is an important enzyme in a variety of signal transduction pathways, including -2) induced transcription. Inhibition of mTOR results in inhibition of cell cycle progression from G1 to S. Since mTOR inhibitors exhibit immunosuppression, anti-proliferative and anti-cancer activities, mTOR is being targeted for the treatment of these diseases (Current Opinion in Lipidology, 16: 317-323, 2005). In addition, mTOR is an important factor in the regulation of autophage, targeting mTOR that regulates the self-digestion pathway and targeting various diseases such as cancer, neurodegenerative diseases, heart disease, aging, immune diseases, infectious diseases and Crohn Diseases and the like can be cured (Immunology, 7:767-777; Nature 451: 1069-1075, 2008).

Currently, since it is present in the cytoplasm, it is inaccessible to conventionally used antibody treatments, and there may be a problem of systemic side effects to be delivered as a drug, so the present inventors have local delivery and excellent selectivity, so AR And mTOR-induced carcinomas have come to construct effective siRNA.

In the present invention, in order to overcome the disadvantage of not having high therapeutic effect due to the target specificity of siRNA, siRNA and shRNA that simultaneously inhibit the expression of AR gene and mTOR gene were produced, and their anticancer activity and synergistic anticancer activity with anticancer agents By confirming, it is intended to be used as a pharmaceutical composition for preventing or treating cancer.

In order to achieve the above object, the present invention provides a nucleic acid molecule that simultaneously suppresses the expression of the AR gene and the mTOR gene.

In addition, the present invention provides a recombinant expression vector containing the nucleic acid molecule.

In addition, the present invention provides a transformed cell into which the recombinant expression vector has been introduced.

In addition, the present invention provides a pharmaceutical composition for anticancer, comprising the nucleic acid molecule as an active ingredient.

According to the present invention, since the sense strand of the double-stranded siRNA of the present invention inhibits the expression of the AR gene and the antisense strand inhibits the expression of the mTOR gene, it is possible to simultaneously inhibit both genes, thereby promoting the death of cancer cells. , There is an effect of synergistically improving cancer cell death in combination treatment with an anticancer agent. In addition, since siRNA can be delivered locally and has excellent selectivity, it can be usefully used as an anticancer composition or anticancer adjuvant for various cancer types.

1 is a diagram showing a map of a vector for expressing shRNAs including the dual target siRNA set 1 of the present invention in cells.
Figure 2a is a diagram confirming the inhibitory effect of the expression of the AR gene and mTOR gene by the double target siRNA set 1 of the present invention in h460 cell line (NC is a control siRNA, siAR is siRNA for AR, simTOR is siRNA for mTOR, si -AT1 is the AR and mTOR dual target siRNA set of the present invention 1).
Figure 2b is a diagram confirming the effect of inhibiting the expression of the AR gene and mTOR gene by the double target siRNA set 1 of the present invention in pc3 cell line (NC is a control siRNA, siAR is siRNA for AR, simTOR is siRNA for mTOR, si -AT1 is the AR and mTOR dual target siRNA set of the present invention 1).
Figure 3 is A549 by the dual target siRNA set 2-13 of the present invention It is a diagram confirming the effect of inhibiting the expression of the AR gene and mTOR gene in the cell line (NC is a control siRNA, si-AT2 to si-AT13 are siRNA sets 2 to 13 of the present invention).
Figure 4a is a diagram confirming the cancer cell killing effect by the combination treatment of the double target siRNA set 1 anticancer agent in the DU145 cell line (NC is a control siRNA, no treat is a group not treated with an anticancer agent, si-AT1 is the AR of the present invention and mTOR dual target siRNA set 1).
Figure 4b is a diagram confirming the cancer cell killing effect by the combination treatment of the double target siRNA set 1 anticancer agent in the H460 cell line (NC is a control siRNA, no treat is a group not treated with an anticancer agent, si-AT1 is the AR of the present invention and mTOR dual target siRNA set 1).

Hereinafter, the present invention will be described in detail as an embodiment of the present invention. However, the following embodiments are presented as examples of the present invention, and the present invention is not limited thereto, and the present invention can be variously modified and applied within the scope of equality interpreted from the description of the claims to be described later. .

In one aspect, the present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of the AR gene and the mTOR gene.

In one embodiment, the nucleic acid molecule is SEQ ID NO: 1 and 2; SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 19 and 20; SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; And it may include a nucleic acid molecule comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 25 and 26.

In one embodiment, a nucleic acid molecule comprising a nucleotide sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25 is expressed by RNA interference Can be suppressed. In addition, a nucleic acid molecule containing a nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 suppresses the expression of mTOR gene by RNA interference. Thus, the nucleic acid molecule of the present invention can simultaneously inhibit the expression of the AR gene and the mTOR gene.

In one embodiment, the nucleic acid molecule is SEQ ID NO: 1 with SEQ ID NO: 2, SEQ ID NO: 3 with SEQ ID NO: 4, SEQ ID NO: 5 with SEQ ID NO: 6, SEQ ID NO: 7 with SEQ ID NO: 8, and SEQ ID NO: 9 Number 10, SEQ ID NO: 11 with SEQ ID NO: 12, SEQ ID NO: 13 with SEQ ID NO: 14, SEQ ID NO: 15 with SEQ ID NO: 16, SEQ ID NO: 17 with SEQ ID NO: 18, SEQ ID NO: 19 with SEQ ID NO: 20, and sequence Number 21 may be SEQ ID NO: 22, SEQ ID NO: 23 is SEQ ID NO: 24, and SEQ ID NO: 25 may be a double stranded siRNA partially complementary to SEQ ID NO: 26.

In one embodiment of the present invention, a double target siRNA set 1-13 was constructed. Specifically, in the siRNA set 1 of 20mers consisting of SEQ ID NOs: 1 and 2, 18mers are complementary to each other, the siRNA set 2 of 19mers consisting of SEQ ID NOs: 3 and 4 are 17mers complementary to each other, and 18mers consisting of SEQ ID NOs: 5 and 6 SiRNA set 3 of 16mers are complementary to each other, siRNA set 4 of 17mers consisting of SEQ ID NOs: 7 and 8 is complementary to each other, and siRNA set 5 of 19mers consisting of SEQ ID NOs: 9 and 10 is complementary to each other, and sequence SiRNA set 6 of 18mer consisting of numbers 11 and 12 is complementary to each other in 14mers, siRNA set 7 of siRNA of 17mer consisting of SEQ ID NOs: 13 and 14 is complementary to each other, siRNA set 8 of 23mer consisting of SEQ ID NOs: 15 and 16 19mers are complementary to each other, siRNA set 9 of 22mer consisting of SEQ ID NOs: 17 and 18 is complementary to each other, and siRNA set 10 of 22mer consisting of SEQ ID NOs: 19 and 20 is complementary to each other, 18mers are complementary to each other, and SEQ ID NOs: 21 and 22 The 21mer siRNA set 11 consisting of 17mers is complementary to each other, the 20mer siRNA set 12 consisting of SEQ ID NOs: 23 and 24 is complementary to each other, and the 21mer siRNA set 13 consisting of SEQ ID NOs: 25 and 26 is complementary to each other. Was produced.

The siRNA (Antisense AR) of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, or 25 may complementarily bind to the mRNA of AR. In addition, siRNA (Antisense mTOR) of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 may complementarily bind to mRNA of mTOR. Therefore, the double target siRNA set 1-13 of the present invention can simultaneously reduce the expression of AR and mTOR genes.

In one embodiment, the nucleic acid molecule may be a shRNA (short hairpin RNA) comprising a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2, and the shRNA includes a nucleotide sequence of SEQ ID NO: 29 or SEQ ID NO: 30 can do.

In one embodiment, the shRNA may form a hairpin structure by partially complementary binding between the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2 and palindromatically linked by a loop region, and an embodiment of the present invention In the example, it was described as TTCAAGAGAG loop shRNA (SEQ ID NO: 29) or TTGGATCCAA loop shRNA (SEQ ID NO: 30) according to the nucleotide sequence of the loop portion of the hairpin structure.

In the present invention, the siRNA targeting AR and mTOR has a sequence complementary to the AR gene of human ( Homo sapiens ) or a part of the mTOR gene, and can degrade the mRNA of the AR gene or mTOR gene, or inhibit translation.

As used herein, the term "expression inhibition" means to cause the expression of a target gene (to mRNA) or translation (to a protein) to decrease, and preferably, the expression of the target gene becomes undetectable or at an insignificant level. It means to exist as.

The term "siRNA (small interfering RNA)" as used herein refers to a short double-stranded RNA capable of inducing RNAi (RNA interference) phenomenon through cleavage of a specific mRNA. In general, siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a sequence complementary thereto, but the dual target siRNA of the present invention has a sense RNA strand of SEQ ID NOs: 1, 3, 5, It is an siRNA (antisense strand for AR gene) consisting of nucleotide sequences of 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25, and the antisense RNA strand is SEQ ID NO: 2, 4, 6, 8, 10 , 12, 14, 16, 18, 20, 22, 24 or 26 siRNA (antisense strand for the mTOR gene), so the double target siRNA set 1-13 respectively simultaneously expresses the AR gene and the mTOR gene. Since it can be suppressed, it is provided as an efficient gene knock-down method or as a method of gene therapy.

Variants of the base sequence are included within the scope of the present invention. In the nucleic acid molecule of the present invention, a functional equivalent of the nucleic acid molecule constituting the same, for example, a partial sequence of a nucleic acid molecule that simultaneously suppresses the expression of the AR gene and the mTOR gene is deleted, substituted, or inserted ( It is a concept including variants that have been modified by insertion), but that can perform the same functionally as the nucleic acid molecule. Specifically, the gene includes a nucleotide sequence having sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% of the nucleotide sequence of SEQ ID NO: can do. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include additions or deletions (ie, gaps) compared to (not including).

In one aspect, the present invention relates to a recombinant expression vector comprising the nucleic acid molecule of the present invention.

In the present specification, the term "vector" refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Phagemid vector; Cozmid vector; And viral vectors such as bacteriophage vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors, and the like, preferably adenovirus vectors, but are not limited thereto.

The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence are generally included. When E. coli (eg HB101, BL21, DH5α, etc.) is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018- 1024) and a left-facing promoter of the phage (pLλ promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14:399-445) can be used as a regulatory site.

On the other hand, the vector that can be used in the present invention is a plasmid often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series, and pUC19, etc.), phagemid (eg pComb3X), phage (M13, etc.) or viruses (eg SV40, etc.).

On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and private promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be fused with other sequences as necessary to facilitate protein purification of amino acids, and the fused sequence is, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA) may be used, but are not limited thereto. In addition, the expression vector of the present invention may contain an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin , Neomycin and tetracycline resistance genes.

In one embodiment, the recombinant expression vector of the present invention may include siRNA comprising the nucleotide sequence of SEQ ID NO: 1 and siRNA comprising the nucleotide sequence of SEQ ID NO: 2, and shRNA or shRNA comprising the nucleotide sequence of SEQ ID NO: 29 It may include shRNA including the nucleotide sequence of SEQ ID NO: 30.

The recombinant vector of the present invention can be prepared by a recombinant DNA method known in the art, and in one embodiment, a pE3.1 vector was used.

Nonviral vectors useful for delivering siRNA against AR and mTOR in the present invention include all vectors commonly used in gene therapy, and include, for example, various plasmids and liposomes that can be expressed in eukaryotic cells.

In the present invention, in order to ensure that the double-stranded siRNA targeting AR and mTOR is properly transcribed in the transferred cells, shRNA containing them, particularly, shRNA consisting of the nucleotide sequence of SEQ ID NO: 29 or the nucleotide sequence of SEQ ID NO: 30, is at least used in the promoter It is preferred to be operatively connected. The promoter may be any promoter capable of functioning in eukaryotic cells, but the U7 promoter shown in SEQ ID NO: 31 is more preferred. For efficient transcription of double-stranded siRNA or shRNA targeting AR and mTOR, additional regulatory sequences including leader sequence, polyadenylation sequence, promoter, enhancer, upstream activation sequence, signal peptide sequence, and transcription terminator are added as needed. It can also be included.

In the present invention, useful viruses or viral vectors for delivering siRNA or shRNA for AR and mTOR include baculoviridiae, parvoviridiae, picornoviridiae, and Herpesviridiae. (herepesviridiae), poxviridiae, adenoviridiae, and the like, but are not limited thereto.

In one aspect, the present invention relates to an anticancer pharmaceutical composition comprising the nucleic acid molecule of the present invention as an active ingredient.

In one embodiment, the anticancer pharmaceutical composition of the present invention may further include an anticancer agent, and the anticancer agent is acibicin, aclarubicin, acodazole, acronycin, adozelesin, alanosine, aldesru Kin, allopurinol sodium, altretamine, aminoglutethymide, amonapide, ampligen, amsacrine, androgens, anguidin, apidicholine glycinate, asale, asparaginase, 5- Azacytidine, azathioprine, Bacillus calmethe-guerine (BCG), Bakers antipol, beta-2-dioxythioguanosine, bisanthrene HCl, bleomycin sulfate, bullsulfone, butionine sulfoximine , BWA 773U82, BW 502U83/HCl, BW 7U85 mesylate, cerasemide, carbetimer, carboplatin, carmustine, chlorambucil, chloroquinoxaline-sulfonamide, chlorozotocin, chromomycin A3 , Cisplatin, Cladribine, Corticosteroid, Corynebacterium parboom, CPT-11, Crisnatol, Cyclocytidine, Cyclophosphamide, Cytarabine, Cytembena, Dabis Maleate, Decarbazine, Dactino Mycin, Daunorubicin HCl, Diazauridine, Dexrazoic Acid, Deionhydro Galactitol, Diaziquone, Dibromodulcitol, Didamine B, Diethyldithiocarbamate, Diclycoaldehyde, Dihydro -5-Azacytin, doxorubicin, ethinomycin, dedatrexate, edelfosin, eflonitin, ellios solution, elsamitrusin, epirubicin, esorubicin, estramustine phosphate, estrogen, ethanidazole , Ethiophos, Etoposide, Padrazole, Pazarabine, Penretinide, Pilgrastim, Finasteride, Flavone Acetic Acid, Phloxuridine, Fludarabine Phosphate, 5'-Fluorouracil, Fluosol, Flutamide, Gallium nitrate, gemcytabine, goserelin acetate, hefsulfame, hexamethylene bisacetamide, homoharingtonine, hydrazine sulfate, 4-hydroxyandrostenedione, hydrodiurea, idarubicin HCl, ifosfamide , 4-ipomeanol, iproplatin, isotretinoin, leucovorin calcium, leuprolide acetate Ytte, levamisol, liposome daunorubicin, liposome capture doxorubicin, romastin, ronidamine, mytansine, mechloretamine hydrochloride, melphalan, menogaryl, merbaron, 6-mercaptopurine, mesna, bacillus knife Methanol extract of rete-guerine, methotrexate, N-methylformamide, mifepristone, mitoguazone, mitomycin-C, mitotan, mitoxantrone hydrochloride, monosite/macrophage colony-stimulating factor, nabilon, Napoxidine, Neocarzinostatin, Octreotide Acetate, Ormaplatin, Oxaliplatin, Paclitaxel, Pala, Pentostatin, Piperazindione, Pipobroman, Pirarubicin, Pytrexim, Piroxantrone Hydrochloride , PIXY-321, Plicamycin, Porpimer Sodium, Prednimustine, Procarbazine, Progestins, Pyrazofurine, Razox Acid, Sargramostim, Semustine, Spirogermanium, Spiromustine, Streptonimustine, Streptozosine, Sulopener, Suramine Sodium, Tamoxifen, Taxorere, Tegafur, Teniposide, Terephthalamidine, Teroxirone, Thioguanine, Thiotepa, Thymidine Injection, Thiazofurine, Topotecan, Torremifen, Tretinoin, trifluoroperazine hydrochloride, trifluridine, trimetrexate, TNF (tumor necrosis factor), uracil mustard, vinblastine sulfate, vincristine sulfate, vindesine, vinorelbine, vinzolidin, Yoshi 864, Zorubicin, cytosine arabinoside, etoposide, melphalan, and taxol are at least one selected from the group consisting of, and preferably Taxol, Cisplatin or Etoposide, or of the present invention. It is not limited thereto as long as it is used in combination with a double target siRNA set to achieve a purpose in which a synergistic effect can appear effectively.

In one embodiment, the cancer is colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer , Esophageal cancer, small intestine cancer, anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, Cervical cancer, cutaneous melanoma, intraocular melanoma, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, It may be any one selected from the group consisting of glioblastoma polymorphism and pituitary adenoma, and it may be more preferable that it is prostate cancer or lung cancer, but if it is a type of cancer that can use the dual target siRNA set of the present invention, it is not limited thereto. .

The term "treatment" as used in the present invention refers to any act of improving or beneficially altering the death of cancer cells or symptoms of cancer by administration of a composition containing the nucleic acid of the present invention. Those of ordinary skill in the art to which the present invention pertains can know the exact criteria of the disease in which the composition of the present application is effective, and determine the degree of improvement, improvement and treatment by referring to data presented by the Korean Medical Association. will be.

In one embodiment, the pharmaceutical composition may be one or more dosage forms selected from the group including oral dosage forms, external preparations, suppositories, sterile injectable solutions and sprays.

The therapeutically effective amount of the composition of the present invention may vary depending on various factors, for example, the method of administration, the target site, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined as an appropriate amount in consideration of safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations when determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The compositions of the present invention may also contain carriers, diluents, excipients or combinations of two or more commonly used in biological preparations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivery of the composition in vivo, and, for example, Merck Index, 13th ed., Merck & Co. Inc. Compounds described in, saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components can be mixed and used, and antioxidants, buffers, bacteriostatic agents, etc. Conventional additives can be added. In addition, a diluent, a dispersant, a surfactant, a binder, and a lubricant may be additionally added to form an injectable formulation such as an aqueous solution, a suspension, an emulsion, and a pill, capsule, granule, or tablet. Furthermore, it may be preferably formulated according to each disease or component by an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In addition to the composition of the present invention, it may contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention contains 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, mannitol, syrup, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, stearic acid Calcium, sucrose, dextrose, sorbitol, talc, and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

The composition of the present invention may be parenterally administered (for example, intravenously, subcutaneously, intraperitoneally or topically applied) or orally according to a desired method, and the dosage may be the patient's weight, age, sex, health status, The range varies depending on diet, administration time, administration method, excretion rate, and severity of disease. The daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to administer once to several times a day.

Liquid formulations for oral administration of the composition of the present invention include suspensions, liquid solutions, emulsions, syrups, etc., and various excipients, such as wetting agents, sweeteners, fragrances, preservatives, in addition to water and liquid paraffin, which are commonly used simple diluents. Etc. may be included together. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories, and the like.

The pharmaceutical composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.

The present invention will be described in more detail through the following examples. However, the following examples are only for embodiing the contents of the present invention and the present invention is not limited thereto.

Example 1. Construction of dual target siRNA

A double target siRNA (double strand) set capable of simultaneously inhibiting an androgen receptor (AR) and a mammalian target of rapamycin (mTOR) was constructed with the sequence shown in Table 1 below (Bioneer, Daejeon, Korea).

set siRNA Sequence(sense), 5'-3' Sequence number Sequence(antisense), 5'-3' Sequence number length Complementary bond length One si-AT1 GCU GCU GCU GCU GCC UGG GG One CCC CAU GCA GCU GCA GCA GC 2 20mer 18mer 2 si-AT2 CUG CUG CUG CUG CCU GGG G 3 CCC CAU GCA GCU GCA GCA G 4 19mer 17mer 3 si-AT3 UGC UGC UGC UGC CUG GGG 5 CCC CAU GCA GCU GCA GCA 6 18mer 16mer 4 si-AT4 GCU GCU GCU GCC UGG GG 7 CCC CAU GCA GCU GCA GC 8 17mer 15mer 5 si-AT5 CCA CCC CCA CCA CCA CCA C 9 GUG GUG GCA GCG GUG GUG G 10 19mer 15mer 6 si-AT6 CCA CCC CCA CCA CCA CCA 11 UGG UGG CAG CGG UGG UGG 12 18mer 14mer 7 si-AT7 CCA CCC CCA CCA CCA CC 13 GGU GGC AGC GGU GGU GG 14 17mer 13mer 8 si-AT8 UGG AGG CAG AGA GUG AGA GAG AA 15 UUC UCU CAG ACG CUC UCC CUC CA 16 23mer 19mer 9 si-AT9 GGA GGC AGA GAG UGA GAG AGA A 17 UUC UCU CAG ACG CUC UCC CUC C 18 22mer 18mer 10 si-AT10 UGG AGG CAG AGA GUG AGA GAG A 19 UCU CUC AGA CGC UCU CCC UCC A 20 22mer 18mer 11 si-AT11 UGG AGG CAG AGA GUG AGA GAG 21 CUC UCA GAC GCU CUC CCU CCA 22 21mer 17mer 12 si-AT12 GGA GGC AGA GAG UGA GAG AG 23 CUC UCA GAC GCU CUC CCU CC 24 20mer 16mer 13 si-AT13 GGA GGC AGA GAG UGA GAG AGA 25 UCU CUC AGA CGC UCU CCC UCC 26 21mer 17mer

In the siRNA set 1 of 20mers consisting of SEQ ID NOs: 1 and 2, 18mers are complementary to each other. In the siRNA set 2 of 19mers consisting of SEQ ID NOs: 3 and 4, 17mers are complementary to each other. In the siRNA set 3 of 18mers consisting of SEQ ID NOs: 5 and 6, 16mers are complementary to each other. In the siRNA set 4 of 17mers consisting of SEQ ID NOs: 7 and 8, 15mers are complementary to each other. In the siRNA set 5 of 19mers consisting of SEQ ID NOs: 9 and 10, 15mers are complementary to each other. In the siRNA set 6 of 18mers consisting of SEQ ID NOs: 11 and 12, 14mers are complementary to each other. In the siRNA set 7 of 17mers consisting of SEQ ID NOs: 13 and 14, 13mers are complementary to each other. In the siRNA set 8 of 23mers consisting of SEQ ID NOs: 15 and 16, 19mers are complementary to each other. In the siRNA set 9 of 22mers consisting of SEQ ID NOs: 17 and 18, 18mers are complementary to each other. In the siRNA set 10 of 22mers consisting of SEQ ID NOs: 19 and 20, 18mers are complementary to each other. In the siRNA set 11 of 21mers consisting of SEQ ID NOs: 21 and 22, 17mers are complementary to each other. In the siRNA set 12 of 20mers consisting of SEQ ID NOs: 23 and 24, 16mers are complementary to each other. In the siRNA set 13 of 21mers consisting of SEQ ID NOs: 25 and 26, 17mers are complementary to each other.

The siRNA (Antisense AR) of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25 complementarily binds to the mRNA of AR. SiRNA (Antisense mTOR) of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 complementarily binds to mRNA of mTOR. Therefore, siRNA set 1-13 of the present invention simultaneously reduces the expression of AR and mTOR genes.

Example 2. Double target shRNA construction

In order to be able to express the double target siRNA prepared in Example 1 in cells, shRNA comprising the DNA conversion sequence (SEQ ID NOs: 27 and 28) of the double target siRNA set 1 (si-AT1) and a loop sequence Were produced (TTCAAGAGAG loop shRNA and TTGGATCCAA loop shRNA) (Table 2). The prepared shRNAs were arranged so as to come after the U7 promoter (SEQ ID NO: 31) at the restriction enzymes Pst I and Eco RV cleavage sites of the pE3.1 vector (Fig. 1), respectively, and contain dual target siRNA targeting AR and mTOR. A recombinant expression vector capable of expressing two types of shRNA in cells was constructed.

Sequence (5'→3') Sequence number Antisense AR GCTGCTGCTGCTGCCTGGGG 27 Antisense mTOR CCCCATGCAGCTGCAGCAGC 28 TTCAAGAGAG loop shRNA GCTGCTGCTGCTGCCTGGGGTTCAAGAGAGCCCCATGCAGCTGCAGCAGCTT 29 TTGGATCCAA loop shRNA GCTGCTGCTGCTGCCTGGGGTTGGATCCAACCCCATGCAGCTGCAGCAGCTT 30

Experimental Example 1. Confirmation of AR and mTOR gene expression inhibition effect of double target siRNA set 1-13

1-1. Confirmation of the inhibitory effect of AR and mTOR gene expression of dual target siRNA set 1 (si-AT1)

After dispensing the PC3 cell line and the h460 cell line into a 12-well plate, respectively, in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) until the cell confluent reaches 50%, under conditions of 37°C and 5% CO ₂ Cultured. Thereafter, 3 μl of lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) at 80 pmoles per well of the double target siRNA set 1 (si-AT1) prepared in Example 1 in the wells in which the cells were cultured. ) To knock down AR and mTOR at the same time. In addition, as a positive control for this, siRNA for AR and siRNA for mTOR described in Table 3 below were transfected, respectively. 48 hours after transfection, cells were disrupted and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). Using the extracted total RNA as a template, reverse transcription to cDNA through RT-PCR reaction, and then mRNA of AR and mTOR by each siRNA and dual target siRNA set 1 (si-AT1) of the present invention through q-PCR reaction The expression level was confirmed. In order to confirm the mRNA expression level, the mRNA of AR and mTOR in the cell lysate knocked down under the PCR conditions of Table 6 was converted into cDNA using the primer set of Table 4 and the reaction mixture of Table 5 below. In addition, using the reverse transcribed cDNA as a template, a reaction mixture was prepared with the composition shown in Table 7 below, and qPCR was performed under the conditions shown in Table 8. For reference, the probes used were AR (Thermo, Hs00171172_m1), mTOR (Thermo, Hs00234508_m1), GAPDH (Thermo, Hs02786624_g1), and were performed using QS3 equipment. All reactions were repeated 3 times and their average value was taken. The results obtained were normalized to the mRNA value of the housekeeping gene GAPDH.

Sequence (5'→3') Sequence number AR siRNA
sense CACAAGUCCCGGAUGUACA(dTdT) 32 anti-sense UGUACAUCCGGGACUUGUG(dTdT) 33 mTOR siRNA
sense GUGGAAACAGGACCCAUGA(dTdT) 34 anti-sense UCAUGGGUCCUGUUUCCAC(dTdT) 35

Sequence (5'→3') Sequence number AR
forward GGAATTCCTGTGCATGAAA 36 reverse CGAAGTTCATCAAAGAATT 37 mTOR
forward CGCGAACCTCAGGGCAA 38 reverse TCAGCGGTAAAAGTGTCCCC 39 GAPDH
forward CTAGGCGCTCACTGTTCTCTC 40 reverse GTCCGAGCGCTGACCTT 41

10X reaction buffer 2 μl HQ Buffer 2 μl dNTP 1.6µl Primer(F, R, 10 pmole/ul) 1µl each Template(500 ng) 2 μl Taq 0.2 μl DW 10.2µl Total vol. 20µl

Pre heat 95 ℃ 2 min Denaturation 95 ℃ 20 sec 30 cycles Annealing 60 ℃ 10 sec Extension 72 ℃ 30 ~ 60 sec Final extension 72 ℃ 5 min

Template(RT-PCR product) 6µl Taqman probe 3µl 10X reaction buffer 6µl HQ Buffer 6µl dNTP 4.8µl Taq 0.6µl DW 10.2µl Total vol. 60µl

Pre denaturation 95 ℃ 10 min Denaturation 95 ℃ 15 sec 40 cycles
Extension 60 ℃ 1 min

As a result, both the expression of AR and mTOR were decreased by the double target siRNA set 1 (si-AT1) of the present invention in both PC3 cells and h460 cell lines, and the degree of reduction was similar to or better than the effect of each siRNA. appear. Through this, it was found that the double target siRNA of the present invention can effectively inhibit the expression of two genes at the same time (FIGS. 2A and 2B ).

1-2. Confirmation of AR and mTOR gene expression inhibition effect of double target siRNA set 2-13 (si-AT2 to si-AT13)

A549 to the method described in Experimental Example 1-1 The effect of inhibiting expression of AR and mTOR genes was confirmed using the cell line.

As a result, the A549 In the cell line, the expression of AR and mTOR was reduced by the double target siRNA set 2-13 (si-AT2 to si-AT13) of the present invention, and it was found that expression of the two genes can be effectively suppressed at the same time (Fig. 3).

Experimental Example 2. Confirmation of cancer cell killing effect by combination treatment of dual target siRNA and anticancer agent

After culturing the DU145 cell line and the H460 cell line in a 6-well plate, respectively, after transfection with the dual target siRNA (siAR&mTOR) of the present invention, 48 hours later, cisplatin 50uM, etoposide 20uM, or Taxol 1uM were treated and incubated for 16 hours. I did. Thereafter, the cells were treated with 5mg/mL MTT (Promega, Ltd.) and incubated for 4 hours, and then the medium was removed, and 150µl of a solubilization solution and a stop solution were treated at 37°C. Incubated for 4 hours. The absorbance of the reaction solution was measured at 570 nm, and cell viability was calculated using the following equation.

As a result, with respect to the prostate cancer cell line DU145 cell line, the dual target siRNA of the present invention induces apoptosis alone (anticancer agent no treat group), and the dual target siRNA of the present invention also in the cisplatin-treated group that does not exhibit apoptosis effect It was found to cause apoptosis. In addition, it was confirmed that DU145 apoptosis was remarkably improved by co-treating the dual target siRNA of the present invention for etoposide and taxol, which showed slight anticancer activity (FIG. 4A).

In addition, for the lung cancer cell line H460, similarly to the DU145 cell line, the double target siRNA of the present invention exhibited apoptosis effect, and it was found that when combined treatment with etoposide and taxol showed remarkably anticancer activity (Fig. 4b). .

<110> Curigene Co., Ltd <120> Nucleic acids for simultaneous inhibition of AR gene and mTOR gene <130> PN1806-201 <160> 41 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-AT1_sense RNA (Antisense AR) <400> 1 gcugcugcug cugccugggg 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-AT1_antisense RNA (Antisense mTOR) <400> 2 ccccaugcag cugcagcagc 20 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-AT2_sense RNA (Antisense AR) <400> 3 cugcugcugc ugccugggg 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-AT2_antisense RNA (Antisense mTOR) <400> 4 ccccaugcag cugcagcag 19 <210> 5 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-AT3_sense RNA (Antisense AR) <400> 5 ugcugcugcu gccugggg 18 <210> 6 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-AT3_antisense RNA (Antisense mTOR) <400> 6 ccccaugcag cugcagca 18 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> si-AT4_sense RNA (Antisense AR) <400> 7 gcugcugcug ccugggg 17 <210> 8 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> si-AT4_antisense RNA (Antisense mTOR) <400> 8 ccccaugcag cugcagc 17 <210> 9 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-AT5_sense RNA (Antisense AR) <400> 9 ccacccccac caccaccac 19 <210> 10 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-AT5_antisense RNA (Antisense mTOR) <400> 10 gugguggcag cgguggugg 19 <210> 11 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-AT6_sense RNA (Antisense AR) <400> 11 ccacccccac caccacca 18 <210> 12 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> si-AT6_antisense RNA (Antisense mTOR) <400> 12 ugguggcagc gguggugg 18 <210> 13 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> si-AT7_sense RNA (Antisense AR) <400> 13 ccacccccac caccacc 17 <210> 14 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> si-AT7_antisense RNA (Antisense mTOR) <400> 14 gguggcagcg guggugg 17 <210> 15 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> si-AT8_sense RNA (Antisense AR) <400> 15 uggaggcaga gagugagaga gaa 23 <210> 16 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> si-AT8_antisense RNA (Antisense mTOR) <400> 16 uucucucaga cgcucucccu cca 23 <210> 17 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> si-AT9_sense RNA (Antisense AR) <400> 17 ggaggcagag agugagagag aa 22 <210> 18 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> si-AT9_antisense RNA (Antisense mTOR) <400> 18 uucucucaga cgcucucccu cc 22 <210> 19 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> si-AT10_sense RNA (Antisense AR) <400> 19 uggaggcaga gagugagaga ga 22 <210> 20 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> si-AT10_antisense RNA (Antisense mTOR) <400> 20 ucucucagac gcucucccuc ca 22 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> si-AT11_sense RNA (Antisense AR) <400> 21 uggaggcaga gagugagaga g 21 <210> 22 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> si-AT11_antisense RNA (Antisense mTOR) <400> 22 cucucagacg cucucccucc a 21 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-AT12_sense RNA (Antisense AR) <400> 23 ggaggcagag agugagagag 20 <210> 24 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> si-AT12_antisense RNA (Antisense mTOR) <400> 24 cucucagacg cucucccucc 20 <210> 25 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> si-AT13_sense RNA (Antisense AR) <400> 25 ggaggcagag agugagagag a 21 <210> 26 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> si-AT13_antisense RNA (Antisense mTOR) <400> 26 ucucucagac gcucucccuc c 21 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense DNA (AR antisense) <400> 27 gctgctgctg ctgcctgggg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense DNA (mTOR antisense) <400> 28 ccccatgcag ctgcagcagc 20 <210> 29 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> TTCAAGAGAG loop shRNA <400> 29 gctgctgctg ctgcctgggg ttcaagagag ccccatgcag ctgcagcagc tt 52 <210> 30 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> TTGGATCCAA loop shRNA <400> 30 gctgctgctg ctgcctgggg ttggatccaa ccccatgcag ctgcagcagc tt 52 <210> 31 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> U7 promotor <400> 31 cctagagtcg acactagata acaacatagg agctgtgatt ggctgttttc agccaatcag 60 cactgactca tttgcatagc ctttacaagc ggtcacaaac tcaagaaacg agcggtttta 120 atagtctttt agaatattgt ttatcgaacc gaataaggaa ctgtgctttg tgattcacat 180 atcagtggag gggtgtggaa atggcacctt gatctcaccc tcatcgaaag tggagttgat 240 gtccttccct ggctcgctac agacgcactt ccgcaa 276 <210> 32 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> AR siRNA sense strand <400> 32 cacaaguccc ggauguacad tdt 23 <210> 33 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> AR siRNA antisense strand <400> 33 uguacauccg ggacuugugd tdt 23 <210> 34 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> mTOR siRNA sense strand <400> 34 guggaaacag gacccaugad tdt 23 <210> 35 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> mTOR siRNA antisense strand <400> 35 ucaugggucc uguuuccacd tdt 23 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AR forward primer <400> 36 ggaattcctg tgcatgaaa 19 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AR reverse primer <400> 37 cgaagttcat caaagaatt 19 <210> 38 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> mTOR forward primer <400> 38 cgcgaacctc agggcaa 17 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mTOR reverse primer <400> 39 tcagcggtaa aagtgtcccc 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 40 ctaggcgctc actgttctct c 21 <210> 41 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 41 gtccgagcgc tgacctt 17

Claims (12)

A nucleic acid molecule that simultaneously suppresses the expression of the AR (androgen receptor) gene and the mTOR (mammalian target of rapamycin) gene. SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 19 and 20; SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; And at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 25 and 26 or a nucleotide sequence encoding the same. delete The method of claim 1, wherein the nucleic acid molecule comprising a nucleotide sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25 is an AR gene by RNA interference. A nucleic acid molecule characterized in that it inhibits expression. The method of claim 1, wherein the nucleic acid molecule comprising a nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 is mTOR gene by RNA interference A nucleic acid molecule characterized in that it inhibits the expression of. The method of claim 1, wherein SEQ ID NO: 1 is SEQ ID NO: 2, SEQ ID NO: 3 is SEQ ID NO: 4, SEQ ID NO: 5 is SEQ ID NO: 6, SEQ ID NO: 7 is SEQ ID NO: 8, and SEQ ID NO: 9 is SEQ ID NO: 10 And, SEQ ID NO: 11 with SEQ ID NO: 12, SEQ ID NO: 13 with SEQ ID NO: 14, SEQ ID NO: 15 with SEQ ID NO: 16, SEQ ID NO: 17 with SEQ ID NO: 18, SEQ ID NO: 19 with SEQ ID NO: 20, and SEQ ID NO: 21 And SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 is a double-stranded siRNA that is partially complementary to SEQ ID NO: 26, characterized in that the nucleic acid molecule. The nucleic acid molecule of claim 1, wherein the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2 are partially complementary to each other to form a hairpin structure. The nucleic acid molecule according to claim 1, which is a shRNA (short hairpin RNA) comprising a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2. The nucleic acid molecule of claim 7, wherein the shRNA comprises the nucleotide sequence of SEQ ID NO: 29 or SEQ ID NO: 30. A nucleic acid molecule that simultaneously suppresses the expression of the AR (androgen receptor) gene and the mTOR (mammalian target of rapamycin) gene. SEQ ID NOs: 3 and 4; SEQ ID NOs: 5 and 6; SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 19 and 20; SEQ ID NOs: 21 and 22; SEQ ID NOs: 23 and 24; And A recombinant expression vector comprising a nucleic acid molecule encoding at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 25 and 26. A transformed cell into which the recombinant expression vector of claim 9 has been introduced. An anticancer pharmaceutical composition for lung cancer or prostate cancer comprising the nucleic acid molecule of claim 1 as an active ingredient. The pharmaceutical composition for anticancer of lung cancer or prostate cancer according to claim 11, further comprising an anticancer agent.

Images