KR101999515B1 - Nucleic acids for simultaneous inhibition of AR gene and mTOR gene - Google Patents

Abstract

The present invention relates to a nucleic acid molecule which simultaneously inhibits expression of an AR gene and an mTOR gene, and a pharmaceutical composition for anticancer therapy comprising the same, and more particularly, to overcome the disadvantage that the therapeutic effect due to the target specificity of siRNA is not high, The double-stranded siRNA of the present invention, which is designed to simultaneously inhibit the expression of AR gene and mTOR gene associated with cancer, promotes the killing of cancer cells and synergistically enhances cancer cell death in combination with an anticancer drug. Therefore, And can be usefully used as anticancer compositions or anticancer adjuvants.

Description

Nucleic acids for simultaneous inhibition of the AR gene and the mTOR gene [

The present invention relates to a nucleic acid molecule which simultaneously inhibits the expression of an AR gene and an mTOR gene, and a pharmaceutical composition for anticancer comprising the same.

Cancer is one of the most deadly diseases worldwide, and the development of innovative cancer treatments can create high added value while reducing the cost of medical care. According to statistics in 2008, the molecular therapy products that can overcome the existing anticancer drug resistance amounted to $ 17.5 billion in seven major countries (US, Japan, France, Germany, Italy, Spain and UK) It is estimated that the market size of $ 45 billion will grow by 9.5% compared to 2008. The treatment of cancer is divided into surgery, radiotherapy, chemotherapy, and biological treatment. Among them, chemotherapy is a chemical substance that suppresses or kills the cancer cell proliferation. Since the toxicity caused by the anticancer drug appears in the normal cells, , And it is necessary to develop an anticancer agent that selectively acts on cancer cells and does not develop resistance because the anticancer agent exhibits the effect that the effect is lost after a certain period of use even if the anticancer agent is effective (Biowave 2004, 6 (19)). Recently, a new anticancer drug targeting the molecular characteristics of cancer has been developed through the securing of molecular genetic information on cancer, and anticancer drugs aiming at characteristic molecular targets possessed only by cancer cells have been developed, There is also a report that does not occur.

Techniques to inhibit the expression of genes are important tools in the development of therapeutic agents for the treatment of disease and in the target validation. RNA interference (RNAi) has been shown to act on sequence-specific mRNAs in a variety of mammalian cells since its discovery (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773). RNAi is a small interfering RNA (hereinafter abbreviated as 'siRNA') with a small interfering ribonucleic acid double-stranded structure with a size of 21-25 nucleotides that specifically binds to a mRNA transcript having a complementary sequence And the expression of a specific protein is inhibited by decomposing the transcript. Within the cell, the RNA double strand is processed by endonuclease Dicer and converted into siRNA of 21-23 base pairs (bp), and the siRNA is bound to RNA-induced silencing complex (RISC) (Antisense) strand recognizes and degrades the target mRNA, thereby specifically inhibiting the expression of the target gene in a sequence-specific manner (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS, Nature Reviews Drug Discovery 2002. 1, 503 -514). According to the Bertrand researchers, siRNAs against the same target gene are superior to the antisense oligonucleotide (ASO) in inhibiting mRNA expression in vivo / in vitro (in vitro and in vivo) (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004). The market for siRNA-based RNAi technology-based therapeutics has been analyzed by the global market size to be more than KRW 12 trillion by 2020, and the number of targets to which the technology can be applied has been dramatically expanded to include existing antibodies and compound-based drugs It is being evaluated as a next-generation gene therapy technology that can treat diseases that are difficult to treat. In addition, since the action mechanism of siRNA is complementary to the target mRNA and regulates the expression of the target gene in a sequence-specific manner, it has been known for a long time until the existing antibody-based drug or small molecule drug is optimized for a specific protein target The development period and the development cost of the protein can be significantly extended and the development period can be shortened so that the optimized lead compound can be developed for all the protein targets including the target substance which can not be medicated (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY 2006 13 (4): 664-670). Recently, the ribonucleic acid-mediated interference phenomenon has been proposed to solve the problems that occur in the development of existing chemical synthetic medicine, and to selectively suppress the expression of a specific protein at the transcript level and to use it in the development of various disease treatments, . In addition, siRNA therapeutic agents have the advantage of being able to predict side effects due to their clear targets, unlike conventional anticancer agents. However, these target specificities are not as effective in treating tumors that are diseases caused by various gene problems, It is also a cause.

The androgen receptor (AR) is a type of nuclear receptor that is activated by binding either the androgen hormone, testosterone or dihydrootestosterone to the cytoplasm and then translocating to the nucleus (International Union of Pharmacology. LXV. The pharmacology and classification of 58 (4): 782-97). The main function is the DNA-binding transcription factor that regulates gene expression (Biological actions of androgens. Endocrine Reviews 8 (1): 1? 28.). The androgen receptor is modified by post-translational modification through acetylation, which is known to directly promote AR-mediated transactivation, apoptosis and contact independent growth of prostate cancer cells (Acetylation 23 (23): 8563-75), an inhibitor targeting the N-terminal domain of a protein is under development, believed to be important in the therapeutic target of prostate cancer .

On the other hand, mTOR (mammalian Target of Rapamycin) is a cytokine-stimulated cell proliferation, translation of mRNA for several important proteins that regulate the G1 phase of the cell cycle, and interleukin-2 (IL -2) inducible transcription. ≪ / RTI > Inhibition of mTOR leads to inhibition of the progression of the cell cycle from G1 to S. Since mTOR inhibitors exhibit immunosuppression, antiproliferative and anticancer activities, mTOR has been targeted for the treatment of these diseases (Current Opinion in Lipidology, 16: 317-323, 2005). In addition, mTOR is an important factor for autophagy control, and it targets mTOR which regulates autophosphorylation pathway to target various diseases such as cancer, neurodegenerative disease, heart disease, aging, Diseases, etc. (Immunology, 7: 767-777; Nature 451: 1069-1075, 2008).

 Currently, since it is present in the cytoplasm, it can not be approached as a conventional therapeutic agent for a widely used antibody, and the systemic side effects may be a problem in delivering it as a drug. Thus, the present inventors have found that AR And mTOR-induced carcinomas.

In order to overcome the disadvantage that the therapeutic effect is not high due to the target specificity of the siRNA, siRNA and shRNA which simultaneously suppress the expression of the AR gene and the mTOR gene were prepared, and its anticancer activity and synergistic anticancer activity with the anticancer drug Which is used as a pharmaceutical composition for preventing or treating cancer.

To achieve the above object, the present invention provides a nucleic acid molecule that simultaneously inhibits the expression of AR gene and mTOR gene.

The present invention also provides a recombinant expression vector comprising the nucleic acid molecule.

The present invention also provides a virus into which the recombinant expression vector is introduced.

In addition, the present invention provides a pharmaceutical composition for anti-cancer comprising the nucleic acid molecule as an active ingredient.

According to the present invention, since the sense strand of the double-stranded siRNA of the present invention inhibits the expression of the AR gene and the antisense strand inhibits the expression of the mTOR gene, both genes can be inhibited simultaneously, thereby promoting the death of cancer cells , Synergistically enhancing the cancer cell death in combination with an anticancer agent, and siRNA is locally transmissible and excellent in selectivity, and thus can be usefully used as an anticancer composition or anticancer adjuvant in various types of cancer.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a map showing vectors for expressing shRNAs containing the double target siRNA of the present invention in a cell. Fig.
FIG. 2 is a graph showing the inhibitory effect of AR gene and mTOR gene on expression of PC3 and A549 cells by the double-target siRNA of the present invention.
nc1: control siRNA;
siRNA: siRNA for AR;
simTOR: siRNA for mTOR; And
siAR & mTOR: AR and mTOR dual target siRNA of the invention.
FIG. 3 is a chart for confirming the cancer cell killing effect by the combination treatment of a dual target siRNA and an anticancer agent:
NC: control siRNA;
siAR & mTOR: AR and mTOR dual target siRNA of the invention; And
no treat: not treated with anticancer drugs.

Hereinafter, the present invention will be described in detail with reference to embodiments of the present invention. It should be understood, however, that the invention is not limited thereto and that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents. .

In one aspect, the invention relates to nucleic acid molecules that simultaneously inhibit the expression of AR and mTOR genes.

In one embodiment, the nucleic acid molecule may comprise the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2.

In one embodiment, the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 is capable of inhibiting AR androgen receptor gene expression by RNA interference, and the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: the expression of mTOR (mammalian target of rapamycin) gene can be inhibited. Thus, the nucleic acid molecule of the present invention can simultaneously suppress the expression of AR gene and mTOR gene.

In one embodiment, the nucleic acid molecule may be an siRNA comprising the nucleotide sequence of SEQ ID NO: 1 and a double strand siRNA wherein the siRNA comprising the nucleotide sequence of SEQ ID NO: 2 is partially complementary. In one embodiment of the present invention, the siRNA (antisense strand to the AR gene) consisting of the nucleotide sequence of SEQ ID NO: 1 and the siRNA (antisense strand to the mTOR gene) consisting of the nucleotide sequence of SEQ ID NO: 2 are complementary To construct double-stranded siRNA, and it was confirmed that double-stranded siRNAs targeted the AR gene and the mTOR gene, respectively, to simultaneously inhibit the expression of the two genes, thereby confirming the double-target siRNA set.

In one embodiment, the nucleic acid molecule may be a short hairpin RNA (shRNA) comprising the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2, wherein the shRNA comprises the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: can do.

In one embodiment, the shRNA may form a hairpin structure by partially complementary binding of the nucleotide sequence of SEQ ID NO: 1 with the nucleotide sequence of SEQ ID NO: 2, and by a loop region to form a hairpin structure. In the example, TTCAAGAGAG loop shRNA (SEQ ID NO: 5) or TTGGATCCAA loop shRNA (SEQ ID NO: 6) was described according to the loop partial sequence of the hairpin structure.

In the present invention, the siRNA targeting AR and mTOR may have a sequence complementary to a part of the AR gene or mTOR gene of human ( Homo sapiens ), and may decompose or inhibit translation of the mRNA of the AR gene or mTOR gene.

As used herein, the term " inhibition of expression "refers to causing expression of a target gene (to mRNA) or degradation of translation (to a protein), and preferably means that the expression of the target gene is undetectable or insignificant As shown in FIG.

As used herein, the term " siRNA (small interfering RNA) " refers to short double-stranded RNA capable of inducing RNAi (RNA interference) phenomenon through cleavage of a specific mRNA. Generally, the siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of the target gene and an antisense RNA strand having a complementary sequence. In the double stranded siRNA of the present invention, the sense RNA strand is composed of the nucleotide sequence of SEQ ID NO: 1 siRNA (antisense strand for the AR gene), and the antisense RNA strand is the siRNA (antisense strand to the mTOR gene) consisting of the nucleotide sequence of SEQ ID NO: 2, the double stranded siRNA simultaneously inhibits the expression of the AR gene and the mTOR gene Or as an efficient gene knock-down method or as a method of gene therapy.

In one aspect, the invention relates to a recombinant expression vector comprising a nucleic acid molecule of the invention.

In one embodiment, the recombinant expression vector of the present invention may comprise an siRNA comprising the nucleotide sequence of SEQ ID NO: 1 and an siRNA comprising the nucleotide sequence of SEQ ID NO: 2, or an shRNA comprising the nucleotide sequence of SEQ ID NO: 5 or A shRNA comprising the base sequence of the nucleotide sequence of SEQ ID NO: 6.

The recombinant vector of the present invention can be prepared by a recombinant DNA method known in the art, and in one embodiment, a pE3.1 vector was used.

Non-viral vectors useful for delivering siRNA for AR and mTOR in the present invention include all vectors commonly used in gene therapy, for example, various plasmids and liposomes that can be expressed in eukaryotic cells.

In order to appropriately transcribe the double-stranded siRNA targeted to AR and mTOR in the present invention, an shRNA comprising the siRNA, in particular, a nucleotide sequence of SEQ ID NO: 5 or an siRNA comprising the nucleotide sequence of SEQ ID NO: 6, Preferably, it is operatively connected. Any promoter capable of functioning in eukaryotic cells may be used as the promoter, and the U7 promoter described in SEQ ID NO: 7 is more preferable. Additional control sequences, including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences and transcription termination factors, as necessary for efficient transcription of double-stranded siRNAs or shRNAs targeting AR and mTOR .

Viral or viral vectors useful for delivering siRNA or shRNA to AR and mTOR in the present invention include baculoviridiae, parvoviridiae, picornoviridiae, (herepesviridiae), poxviridiae, adenoviridiae, and the like.

In one aspect, the present invention relates to a pharmaceutical composition for anticancer therapy comprising the nucleic acid molecule of the present invention as an active ingredient.

In one embodiment, the anticancer pharmaceutical composition of the present invention may further comprise an anticancer agent, wherein the anticancer agent is selected from the group consisting of Taxol, doxorubicin, cisplatin, paclitaxel, vincristine, ), Topotecan, etoposide, docetaxel, 5-fluorouracil (5-FU), gleevec, carboplatin, daunorubicin, It may be any one selected from the group consisting of valsartan, valtubicin, flutamide and gemcitabine, more preferably Taxol, Cisplatin or Etoposide .

In one embodiment, the cancer is selected from the group consisting of: colorectal cancer, breast cancer, cervical cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, stomach cancer, pancreatic cancer, Renal cell carcinoma, kidney cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, endometrial carcinoma, endometrial carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, Cancer of the central nervous system (CNS), primary CNS lymphoma, spinal cord tumor, cervical cancer, endometrial carcinoma, endometrial carcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, Polymorphic glioblastoma, and pituitary adenoma, and more preferably is prostate cancer or lung cancer.

The term "treatment" as used herein refers to any action that improves or alters the death or cancer of a cancer cell by administering a composition comprising the nucleic acid of the present invention. Those skilled in the art will be able to ascertain the precise criteria of the disease for which the composition of the present invention is effective by referring to the data presented by the Korean Medical Association, will be.

In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group comprising oral formulations, external preparations, suppositories, sterile injectable solutions and sprays.

The therapeutically effective amount of the composition of the present invention may vary depending on a variety of factors, such as the method of administration, the site of administration, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined in consideration of safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. Such considerations in determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman ' s Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington ' s Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

Compositions of the present invention may also include carriers, diluents, excipients, or a combination of two or more thereof commonly used in biological formulations. The pharmaceutically acceptable carrier is not particularly limited as long as the composition is suitable for in vivo delivery, for example, Merck Index, 13th ed., Merck & Inc. A buffered saline solution, a buffer solution, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and if necessary, an antioxidant, a buffer, Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into main dosage forms such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules or tablets. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990) in a suitable manner in the art.

The composition of the present invention may further contain one or more active ingredients showing the same or similar functions. The composition of the present invention contains 0.0001 to 10% by weight, preferably 0.001 to 1% by weight of the protein, based on the total weight of the composition.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Wherein the starch is selected from the group consisting of lactose, mannitol, sugar, arabic gum, pregelatinized starch, cornstarch, powdered cellulose, hydroxypropyl cellulose, opaques, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, Calcium, white sugar, dextrose, sorbitol and talc may be used. The pharmaceutically acceptable additives according to the present invention are preferably included in the composition in an amount of 0.1 to 90 parts by weight, but are not limited thereto.

The composition of the present invention may be administered orally or non-orally (for example, intravenously, subcutaneously, intraperitoneally or topically) or orally administered in accordance with a desired method, and the dose may be appropriately determined depending on the patient's body weight, The range varies depending on diet, time of administration, method of administration, excretion rate, and severity of the disease. The daily dose of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, more preferably administered once to several times a day.

Examples of the liquid preparation for oral administration of the composition of the present invention include suspensions, solutions, emulsions, syrups, and the like. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, Etc. may be included together. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.

The pharmaceutical composition of the present invention can be used for preventing or treating cancer and its complications, and can also be used as an anti-cancer adjuvant.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Example  1. Dual target siRNA  making

A double-stranded 19-mer siRNA (double strand) capable of simultaneously inhibiting both AR (androgen receptor) and mTOR (mammalian target of rapamycin) was prepared from the sequence shown in Table 1 (Bioneer, Daejeon, Korea).

siRNA The sequence (5 '- > 3') SEQ ID NO: sense (Antisense AR) GCU GCU GCU GCU GCC UGG G One antisense (Antisense mTOR) CCC AUG CAG CUG CAG CAG C 2

The 19-mer siRNAs of SEQ ID NOS: 1 and 2 are complementary to the 17-mer of 19-mers. SiRNA (Antisense AR) of SEQ ID NO: 1 complementarily binds to mRNA of AR, and siRNA (Antisense mTOR) Complementarily binds to mTOR mRNA and simultaneously reduces the expression of AR and mTOR genes.

Example  2. Dual target shRNA  making

(SEQ ID NOS: 3 and 4) and shRNAs containing a loop sequence (TTCAAGAGAG loop shRNA and TTGGATCCAA (SEQ ID NOs: 3 and 4)) were used to express the double target siRNA prepared in Example 1 in the cells. Loop shRNA) (Table 2). The constructed shRNAs were each placed so as to come after the U7 promoter (SEQ ID NO: 7) at the cleavage sites of the restriction enzymes Pst I and Eco RV of the pE3.1 vector (FIG. 1), to contain the double target siRNA targeting AR and mTOR A recombinant expression vector capable of expressing two species of shRNA in the cell was prepared.

The sequence (5 '- > 3') SEQ ID NO: Antisense AR GCTGCTGCTGCTGCCTGGG 3 Antisense mTOR CCCATGCAGCTGCAGCAGC 4 TTCAAGAGAG loop shRNA GCTGCTGCTGCTGCCTGGGTTCAAGAGAGCCCATGCAGCTGCAGCAGCTT 5 TTGGATCCAA loop shRNA GCTGCTGCTGCTGCCTGGGTTGGATCCAACCCATGCAGCTGCAGCAGCTT 6

Experimental Example  1. Dual target siRNA  AR and mTOR gene expression inhibition

PC3 cell line and A549 cell line were dispensed into a 12-well plate, and the cells were treated with RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) at 37 ° C under 5% CO ₂ until the cell confluent reached 50% Lt; / RTI > Subsequently, the double-target siRNA prepared in Example 1 was transfected with 3 μl of lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) at 80 pmoles per well to the wells in which the cells were cultured to obtain AR And mTOR at the same time. In addition, siRNA for AR and siRNA for mTOR described in Table 3 below were each transfected as a positive control for this. After 48 hours of transfection, cells were disrupted and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). The extracted total RNA was used as a template to reverse-transcribe the cDNA by RT-PCR reaction, and then the amount of AR and mTOR mRNA expression by each siRNA and the double target siRNA of the present invention was confirmed through q-PCR reaction. In order to confirm the expression level of mRNA, the mRNA of AR and mTOR in the cell lysate declined to the PCR condition of Table 6 was converted into cDNA using the primer set of Table 4 and the reaction mixture of Table 5 below. In addition, qPCR was performed under the conditions shown in Table 8 by preparing a reaction mixture with the composition shown in the following Table 7 using the reverse transcribed cDNA as a template. For reference, the probes used were AR (Thermo, Hs00171172_m1), mTOR (Thermo, Hs00234508_m1), GAPDH (Thermo, Hs02786624_g1) and QS3 equipment. All reactions were repeated three times and their mean values were taken. The results were normalized to the mRNA values of the housekeeping gene GAPDH.

The sequence (5 '- > 3') SEQ ID NO: AR siRNA
sense CACAAGUCCCGGAUGUACA (dTdT) 8 anti-sense UGUACAUCCGGGACUUGUG (dTdT) 9 mTOR siRNA
sense GUGGAAACAGGACCCAUGA (dTdT) 10 anti-sense UCAUGGGUCCUGUUUCCAC (dTdT) 11

The sequence (5 '- > 3') SEQ ID NO: AR
forward GGAATTCCTGTGCATGAAA 12 reverse CGAAGTTCATCAAAGAATT 13 mTOR
forward CGCGAACCTCAGGGCAA 14 reverse TCAGCGGTAAAAGTGTCCCC 15 GAPDH
forward CTAGGCGCTCACTGTTCTCTC 16 reverse GTCCGAGCGCTGACCTT 17

10X reaction Buffer 2 μl HQ Buffer 2 μl dNTP 1.6 占 퐇 Primer (F, R, 10 pmoles / ul) 1 μl each Template (500 ng) 2 μl Taq 0.2 쨉 l DW 10.2 l Total vol. 20 쨉 l

Pre heat 95 ℃ 2 min Denaturation 95 ℃ 20 sec 30 cycles Annealing 60 ℃ 10 sec Extension 72 ° C 30 ~ 60 sec Final extension 72 ℃ 5 min

Template (RT-PCR product) 6 μl Taqman probe 3 μl 10X reaction Buffer 6 μl HQ Buffer 6 μl dNTP 4.8 l Taq 0.6 쨉 l DW 10.2 l Total vol. 60 쨉 l

Pre denaturation 95 ℃ 10 min Denaturation 95 ℃ 15 sec 40 cycles
Extension 60 ° C 1 min

As a result, the expression of both AR and mTOR was decreased by the double target siRNA of the present invention in both PC3 and A549 cell lines, and the degree of decrease was similar to or better than that of each siRNA. Thus, it was found that the double-target siRNA of the present invention can effectively suppress the expression of both genes simultaneously (Fig. 2).

Experimental Example  2. Combination of dual target siRNA and anticancer agent to determine cancer cell killing effect

DU145 cell line and H460 cell line were cultured in 6-well plates, respectively. After transfection of each of the double target siRNAs of the present invention (siAR & mTOR), 50 uM cefplatin, 20 uM etoposide or Taxol 1 uM was treated and incubated for 16 hours Respectively. Then, cells were treated with 5 mg / mL MTT (Promega, Ltd.) and incubated for 4 hours. Then, the medium was removed and treated with 150 sol of solubilization solution and stop solution, And incubated for 4 hours. The absorbance of the reaction solution was measured at 570 nm and the cell viability was calculated using the following equation.

As a result, the double-target siRNA of the present invention induces apoptosis alone (anti-cancer agent no treat group) and the double-target siRNA of the present invention even in the cisplatin-treated group which does not exhibit the apoptosis effect to the prostate cancer cell line DU145 cell line Resulting in apoptosis. In addition, it was confirmed that DU145 cell death was significantly improved by using the double-target siRNA of the present invention in combination with etoposide and taxol showing a slight anticancer activity (FIG. 3).

Similar to the DU145 cell line, the double-target siRNA of the present invention exhibited cell killing effect on H460, a lung cancer cell line, and exhibited remarkable anticancer activity upon treatment with etoposide and taxol (Fig. 3 ).

<110> University-Industry Cooperation Group of Kyung Hee University <120> Nucleic acids for simultaneous inhibition of AR gene and mTOR          gene <130> PN1612-482 <160> 17 <170> KoPatentin 3.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> sense RNA (Antisense AR) <400> 1 gcugcugcug cugccuggg 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Antisense RNA (Antisense mTOR) <400> 2 cccaugcagc ugcagcagc 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense DNA (AR antisense) <400> 3 gctgctgctg ctgcctggg 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Antisense DNA (mTOR antisense) <400> 4 cccatgcagc tgcagcagc 19 <210> 5 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> TTCAAGAGAG loop shRNA <400> 5 gctgctgctg ctgcctgggt tcaagagagc ccatgcagct gcagcagctt 50 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> TTGGATCCAA loop shRNA <400> 6 gctgctgctg ctgcctgggt tggatccaac ccatgcagct gcagcagctt 50 <210> 7 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> U7 promotor <400> 7 cctagagtcg acactagata acaacatagg agctgtgatt ggctgttttc agccaatcag 60 cactgactca tttgcatagc ctttacaagc ggtcacaaac tcaagaaacg agcggtttta 120 atagtctttt agaatattgt ttatcgaacc gaataaggaa ctgtgctttg tgattcacat 180 atcagtggag gggtgtggaa atggcacctt gatctcaccc tcatcgaaag tggagttgat 240 gtccttccct ggctcgctac agacgcactt ccgcaa 276 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> AR siRNA sense strand <400> 8 cacaaguccc ggauguacad tdt 23 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> AR siRNA antisense strand <400> 9 uguacauccg ggacuugugd tdt 23 <210> 10 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> mTOR siRNA sense strand <400> 10 guggaaacag gacccaugad tdt 23 <210> 11 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> mTOR siRNA antisense strand <400> 11 ucaugggucc uguuuccacd tdt 23 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AR forward primer <400> 12 ggaattcctg tgcatgaaa 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AR reverse primer <400> 13 cgaagttcat caaagaatt 19 <210> 14 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> mTOR forward primer <400> 14 cgcgaacctc agggcaa 17 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mTOR reverse primer <400> 15 tcagcggtaa aagtgtcccc 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 16 ctaggcgctc actgttctct c 21 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 17 gtccgagcgc tgacctt 17

Claims (13)

1. A nucleic acid molecule which inhibits an AR gene and an mROR (mammalian target of rapamycin) gene simultaneously and contains the nucleotide sequence of SEQ ID NOS: 1 and 2. delete 2. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 inhibits the expression of AR (androgen receptor) gene by RNA interference. 2. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 2 inhibits the expression of the mTOR gene by RNA interference. 2. The method according to claim 1, wherein the siRNA (small interfering RNA) comprising the nucleotide sequence of SEQ ID NO: 1 and the double strand siRNA having the partial complementary binding to the siRNA comprising the nucleotide sequence of SEQ ID NO: &Lt; / RTI &gt; The nucleic acid molecule according to claim 1, wherein the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2 partially combine to form a hairpin structure. 2. The nucleic acid molecule according to claim 1, which is a shRNA (short hairpin RNA) comprising the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2. 8. The nucleic acid molecule according to claim 7, wherein the shRNA is expressed in the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6. SEQ ID NOS: 3 and 4; Or a recombinant expression vector comprising the nucleotide sequence of SEQ ID NOs: 5 and 6. A virus into which the recombinant expression vector of claim 9 is introduced. SEQ ID NOS: 1 and 2; SEQ ID NOS: 3 and 4; And nucleotide sequences of SEQ ID NOS: 5 and 6 as an active ingredient. 12. The pharmaceutical composition according to claim 11, wherein the composition further comprises an anticancer agent. 13. The anticancer pharmaceutical composition according to claim 12, wherein the anticancer agent is at least one selected from the group consisting of Taxol, Cisplatin and Etoposide.

Images