KR20170128725A - Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism - Google Patents

Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism Download PDF

Info

Publication number
KR20170128725A
KR20170128725A KR1020160058906A KR20160058906A KR20170128725A KR 20170128725 A KR20170128725 A KR 20170128725A KR 1020160058906 A KR1020160058906 A KR 1020160058906A KR 20160058906 A KR20160058906 A KR 20160058906A KR 20170128725 A KR20170128725 A KR 20170128725A
Authority
KR
South Korea
Prior art keywords
seq
represented
atrial fibrillation
single nucleotide
base
Prior art date
Application number
KR1020160058906A
Other languages
Korean (ko)
Other versions
KR101883657B1 (en
Inventor
박희남
이지영
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Priority to KR1020160058906A priority Critical patent/KR101883657B1/en
Publication of KR20170128725A publication Critical patent/KR20170128725A/en
Application granted granted Critical
Publication of KR101883657B1 publication Critical patent/KR101883657B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

The present invention relates to a method for providing information for predicting or diagnosing the generation of atrial fibrillation by confirming single nucleotide polymorphism (SNP) of a DNA pooling, and the method for providing information of the present invention confirmed the SNP relates to atrial fibrillation diagnosis and prediction by using a large-scale genome-wide association analysis method, and confirmed Korean-specific SNP for the first time, and thus by using the same, the information can be used as personalized information in various treatment processes such as treatment, surgery, operation and the like of individual Koreans, and a basis for preventing and actively intervening in an increase of the incidence of atrial fibrillation with an increasing high-age class in the future can be prepared, thereby being expected to be effective in reducing the risk of atrial fibrillation.

Description

단일염기다형성에 의한 심방세동의 예측 또는 진단에 관한 정보 제공 방법{Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism}[0001] The present invention relates to a method for predicting or diagnosing atrial fibrillation by single nucleotide polymorphism,

본 발명은 심방세동의 예측 또는 진단에 관한 정보 제공 방법에 관한 것으로, 보다 자세하게는 전장유전체연관분석방법으로 확인된 하나 이상의 유전자좌위의 단일염기다형성을 이용하여 한국인의 심방세동 발생을 예측 또는 진단하는 방법에 관한 것이다.The present invention relates to a method for providing information on the prediction or diagnosis of atrial fibrillation, and more particularly, to a method for predicting or diagnosing the occurrence of atrial fibrillation in a Korean population using single base polymorphism of at least one gene locus identified by a full- ≪ / RTI >

최근 인간게놈프로젝트(International HapMap Project) 발표 후 인간의 유전체 염기서열 중 많은 부분이 규명되었고, 측정 기술이 발전함에 따라 전장유전체(whole genome)를 대상으로 하여 유전자와 질병과의 연관관계를 밝히기 위한 연구가 활발하게 진행되고 있다. 현재 전장유전체 관련 연구에서 가장 활발하게 연구되는 분야는 전장유전체 단일염기다형성(whole genome SNP; whole genome Single Nucleotide Polymorphism)에 대한 연구이다. 단일염기다형성은 사람의 염기서열에 있어서 평균 200-300bp 마다 하나씩 존재하는 단일염기서열(single nucleotide)의 다형성(polymorphism)을 의미한다. 단일염기다형성으로 인하여 개개인의 약물, 질병 등에 대한 감수성의 차이가 나타난다는 것을 확인하게 되면서, 최근에는 개개인의 질병에 대한 감수성이나, 치료 후 결과의 차이의 원인을 규명하는 것이 전장유전체연구의 주된 내용을 이루고 있다. 일반적으로 최근의 연구 단계는 대립유전자의 빈도가 높으며, 유전적인 효과가 상대적으로 적은 것으로 알려져 있는 질병 관련 유전자들을 확인하는 것이 주를 이루고 있으며, 전장유전체 단일염기다형성 검사는 DNA 염기서열 변이 중 이미 흔하게 변이가 일어나는 곳만을 선택적으로 칩의 형태로 제작하여 질병과 관련을 보고 있다. 그리고 이러한 다양한 연구 결과를 통하여 각종 만성 질환과 여러 가지 표현형질(phenotype)과 연관된 유전자들이 밝혀지고 있다.Recently, many parts of human genome sequences have been identified after the publication of the International HapMap Project, and research has been conducted to discover the linkage of genes and diseases to the whole genome as the measurement technology develops. Is progressing actively. Currently, the most active field in the field of field genome research is the study of whole genome single nucleotide polymorphism (SNP). Single nucleotide polymorphism refers to the polymorphism of a single nucleotide in the human nucleotide sequence, one nucleotide per 200-300 bp in average. It has been recently shown that susceptibility to an individual's disease or the cause of the difference in outcome after treatment has been identified as a major component of the overall genome research . In general, the most recent research stage is to identify disease-related genes, which are known to have a high frequency of alleles and relatively low genetic effects, and full-length genomic single nucleotide polymorphisms are already common among DNA sequence variations Only the area where the mutation occurs is selectively made in the form of chip, which is related to the disease. Through these various studies, genes associated with various chronic diseases and various phenotypes have been revealed.

한편, 심방세동(atrial fibrillation; AF)이란 심방이 무질서하게 분당 400~600회의 매우 빠른 파형을 형성하고 이로 인해 불규칙한 맥박을 형성하는 부정맥(불규칙한 맥박) 질환의 일종으로서, 임상에서 가장 흔하게 발생하며 높은 사망률 및 장애율에 연관관계를 가지고 있다(Eur. J. Heart Fail. (2002) 4(5): 571-575). 따라서, 심방세동 고위험군을 예측할 수 있는 심방세동 관련 유전자 변이에 대한 연구가 활발히 이루어지고 있다. 그런데, 심방세동 고위험군을 예측할 수 있는 유전자 변이에 대한 대부분의 연구는 서양인을 대상으로 하여 실시되고 있을 뿐, 한국인을 대상으로 한 연구는 거의 전무한 실정이다.Atrial fibrillation (AF) is a type of arrhythmia (irregular pulse) disorder in which atrial fibrillation produces an irregular pulse of 400-600 times per minute, resulting in an irregular pulse. Mortality and disability rates (Eur. J. Heart Fail. (2002) 4 (5): 571-575). Therefore, studies on atypical fibrin-related gene mutations that can predict high-risk atrial fibrillation have been actively conducted. However, most studies on gene mutation that can predict high-risk atrial fibrillation are conducted only for Westerners, and there are few studies on Koreans.

이와 같이, 한국인을 대상으로 하여 심방세동의 발생을 진단 또는 예측할 수 있는 유전자 변이(genetic variation)에 대한 연구가 요구되고 있는 실정이다.Thus, there is a need for research on genetic variation that can diagnose or predict the occurrence of atrial fibrillation in Koreans.

본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 유전자좌위의 단일염기다형성을 이용하여 한국인의 심방세동 발생을 예측 또는 진단하는 방법을 제공하는 것을 그 목적으로 한다.Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made keeping in mind the above problems occurring in the prior art, and an object of the present invention is to provide a method for predicting or diagnosing the occurrence of atrial fibrillation in a Korean population using single nucleotide polymorphism of a gene locus.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물, 및 공정 등이 기재되어 있다. 그러나 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Hereinafter, various embodiments described herein will be described with reference to the drawings. In the following description, for purposes of complete understanding of the present invention, various specific details are set forth, such as specific forms, compositions, and processes, and the like. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well-known processes and techniques of manufacture are not described in any detail, in order not to unnecessarily obscure the present invention. Reference throughout this specification to "one embodiment" or "embodiment" means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Accordingly, the appearances of the phrase " in one embodiment "or" an embodiment "in various places throughout this specification are not necessarily indicative of the same embodiment of the present invention. In addition, a particular feature, form, composition, or characteristic may be combined in any suitable manner in one or more embodiments.

본 명세서에 있어서 "생물학적 시료(biological sample)"란, 분석하고자 하는 개체의 지노믹 DNA(genomic DNA)를 포함하고 있는 모든 시료를 의미하며, 바람직하게는 혈액, 혈장, 혈청, 골수, 조직, 세포, 타액, 객담, 머리카락, 소변 등일 수 있으며, 더욱 바람직하게는 체액, 모근, 혈액, 혈장, 혈청 등일 수 있으나 유전자좌위를 확인할 수 있는 시료라면 이에 제한되지 않는다.As used herein, the term "biological sample " means all samples containing genomic DNA of an individual to be analyzed, and preferably includes blood, plasma, serum, bone marrow, , Saliva, sputum, hair, urine and the like, and more preferably, it is not limited to a sample which can be a body fluid, hair root, blood, plasma, serum and the like but can identify a gene locus.

본 명세서에 있어서, "유전자좌위(locus)"란 염색체 또는 연관지도상 유전자지도에서 유전자가 차지하는 위치를 말하기도 하지만, 동시에 기능단위로서 유전자(gene)와 같은 뜻으로 사용하는 경우도 있다. 일반적으로 유전자좌위를 표기하는 방법은 첫번째 숫자는 염색체 번호이고, 두번째 영어는 염색체 상의 위치를 의미하며, 그 다음의 숫자는 염색체 팔(arm)의 밴드의 위치를 의미한다. 예를 들어 "6p21.3"이란, 염색체 6번 상의 짧은 팔의 두번째 위치의 첫번째 밴드(band)이며, 보조 밴드(sub-band)는 3임을 의미한다.In the present specification, the term " locus " refers to a position occupied by a gene on a chromosome or an associative map, but may also be used as a gene as a functional unit. Generally, the way to mark gene loci is that the first number is the chromosome number, the second English means the position on the chromosome, and the next number means the position of the band of the chromosome arm. For example, "6p21.3" means the first band of the second position of the short arm on chromosome 6, and the sub-band is 3.

본 명세서에 있어서, "단일염기다형성(single nucleotide polymorphism; SNP)"이란 단일 유전자좌위의 단일 염기에서 대립 유전자가 존재하는 경우를 의미하며 대립 유전자형은 일반적으로 염기서열 내에 "[ ]"로 표기된다. 인구집단에서 1% 이상의 빈도로 존재하는 2개 이상의 대립 유전자가 발생하는 위치를 SNP라고 하며, 대립유전자형이 5% 이상의 빈도로 존재하는 경우 common polymorphism이라고 하며, 1~5% 인 경우 rare polymorphism으로 분류한다.As used herein, the term "single nucleotide polymorphism" (SNP) refers to the case where an allele is present in a single base of a single gene locus. The allele genotype is generally represented by "[]" within the nucleotide sequence. SNP is the location where two or more alleles occur in more than 1% of the population and is called common polymorphism when the allele genotype is more than 5%, and rare polymorphism when 1 to 5% do.

본 명세서에 있어서, "심방세동 예측(prediction) 또는 진단(diagnosis)에 관한 정보 제공 방법"이란 개체의 심방세동 발생 가능성을 확인하는 방법을 포괄적으로 의미하며, 본 발명의 정보 제공 방법은 임의의 특정 개체 또는 환자가 일상 생활 중, 또는 소정의 치료, 시술, 수술 등과 같은 처치 과정에서 심방세동이 발생할 가능성을 확인함으로써 심방세동의 발생을 예측 또는 진단함으로써 임상적으로 사용될 수 있다.In the present specification, the "method of providing information on atrial fibrillation prediction or diagnosis" refers to a method of verifying the possibility of occurrence of atrial fibrillation of an individual entity in a comprehensive manner, The individual or the patient can be clinically used by predicting or diagnosing the occurrence of atrial fibrillation by confirming the possibility of atrial fibrillation in the course of daily life, or in the course of treatment such as prescribed treatment, surgery, and surgery.

본 명세서에 있어서, "키트(kit)"란 심방세동의 발생을 예측 또는 진단할 수 있는 검진용 기기를 의미하며, 생물학적 시료로부터 단일염기다형성의 존재 여부를 확인할 수 있는 형태라면 제한이 없다. 바람직하게는 rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 및 rs7680060로 이루어진 군으로부터 선택되는 하나 이상의 단일염기다형성과 특이적으로 결합하는 또는 상기 단일염기다형성에 대한 상보적인 서열을 가지는 프로브(probe) 또는 프라이머(primer) 세트를 포함할 수 있으며, 또는 상기 단일염기다형성에 특이적으로 결합하는 항체(antibody) 또는 앱타머(aptamer)를 포함하는 형태일 수 있다. 상기 "프로브 또는 프라이머"는 단일염기다형성에 상보적인 서열을 가지는 올리고뉴클레오타이드(oliogonucleotide)를 의미하며, 길이는 8 내지 52 뉴클레오티드(nucleotide), 10 내지 50 뉴클레오티드, 또는 20 내지 40 뉴클레오티드일 수 있으나 이에 제한되지 않는다.As used herein, the term "kit " means a device for detecting or diagnosing the occurrence of atrial fibrillation, and is not limited as long as it can confirm the presence of a single nucleotide polymorphism from a biological sample. A probe that specifically binds to or has a complementary sequence to at least one single base polymorphism selected from the group consisting of rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 and rs7680060, or May comprise a set of primers, or may be in the form of an antibody or an aptamer that specifically binds to the single nucleotide polymorphism. The term "probe or primer" means an oligonucleotide having a sequence complementary to a single nucleotide polymorphism, and may be 8 to 52 nucleotides, 10 to 50 nucleotides, or 20 to 40 nucleotides, It does not.

본 발명은 생물학적 시료로부터 하나 이상의 유전자좌위(locus)의 단일염기다형성(single nucleotide polymorphism)을 확인하는 단계를 포함하는, 심방세동의 예측 또는 진단에 관한 정보를 제공하는 방법을 제공한다.The present invention provides a method for providing information about the prediction or diagnosis of atrial fibrillation, comprising identifying single nucleotide polymorphism of one or more locus from a biological sample.

본 발명의 일 구체예에서, 상기 유전자좌위는 바람직하게는 PPFIA4 및 HANDS2일 수 있다.In one embodiment of the invention, the gene locus is preferably PPFIA4 and HANDS2.

본 발명의 다른 구체예에서, 상기 단일염기다형성은 바람직하게는 rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 및 rs7680060로 이루어진 군에서 선택된 1 종 이상이 바람직하며 (hg38/human기준), 보다 바람직하게는 rs11579055일 수 있다.In another embodiment of the present invention, the single nucleotide polymorphism is preferably at least one selected from the group consisting of rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 and rs7680060 (based on hg38 / human) Can be rs11579055.

단, 본 발명에서 이용되는 상기한 단일염기다형성의 서열정보는 하기 표 1과 같다.However, the sequence information of the single nucleotide polymorphism used in the present invention is shown in Table 1 below.

유전자gene NCB1 refSNP IDNCB1 refSNP ID 서열order 서열
번호
order
number
PPFIA4PPFIA4 rs11579055rs11579055 AAACCATGTCAATAGGGATAAAAAA[G/T]ACAGTCTCGGCTGGGCGCGGTGGCTAAACCATGTCAATAGGGATAAAAAA [G / T] ACAGTCTCGGCTGGGCGCGGTGGCT 1One rs10920559rs10920559 GAGCTGCCTTGAGAAGTAATGAGTT[C/T]GCTGCCCCTGGAGGCATTCAGGCACGAGCTGCCTTGAGAAGTAATGAGTT [C / T] GCTGCCCCTGGAGGCATTCAGGCAC 22 HANDS2HANDS2 rs4615152rs4615152 ACCTTGATCTCGGACTTGTAACCTG[C/T]AGAACTGTGAAAGAATAAATTTCTGACCTTGATCTCGGACTTGTAACCTG [C / T] AGAACTGTGAAAGAATAAATTTCTG 33 rs10024812rs10024812 TAACATTTTACTTTGAGTCAGAAGT[A/G]AGTAGACCCTAGCTTATAATTTCCTTAACATTTTACTTTGAGTCAGAAGT [A / G] AGTAGACCCTAGCTTATAATTTCCT 44 rs13132889rs13132889 CACACGATACTCTGATTCAGAAGCT[G/T]CAATCTCTACAAAGCATAGGTCAGGCACACGATACTCTGATTCAGAAGCT [G / T] CAATCTCTACAAAGCATAGGTCAGG 55 rs12507756rs12507756 GTGTGTGTGTGTGTGACAGTAATAG[C/T]GGTAGATGTTCTAGTAGCCACTGCCGt; 66 rs7680060rs7680060 AGAGAGATTAGGACAAATTGAACAA[C/T]ACTGCTGTTTTCAGTTCTCTTTATAAGAGAGATTAGGACAAATTGAACAA [C / T] ACTGCTGTTTTCAGTTCTCTTTATA 77

본 발명의 또 다른 구체예에서, 상기 심방세동 발생의 예측 또는 진단에 관한 정보를 제공하는 방법은 바람직하게는 동양인을 대상으로 할 수 있으며, 더욱 바람직하게는 한국인을 대상으로 할 수 있으나, 이에 제한되지 않는다.In another embodiment of the present invention, the method for providing information on the prediction or diagnosis of the occurrence of atrial fibrillation can be preferably applied to Asians, more preferably to Koreans, It does not.

본 발명의 또 다른 구체예에서, 상기 생물학적 시료는 바람직하게는 체액, 모근, 혈액, 혈장, 혈청 등 일 수 있으나, 예측하고자 하는 개체의 지노믹 DNA(genomic DNA)를 포함하는 시료라면 이에 제한되지 않는다In another embodiment of the present invention, the biological sample may be preferably a body fluid, hair roots, blood, plasma, serum or the like, but is not limited to a sample containing genomic DNA of a subject to be predicted Do not

본 발명의 또 다른 구체예에서, 상기 단일염기다형성을 확인하는 단계는 시퀀싱 분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적 PCR(allele specific PCR), 다이나믹 대립유전자 특이적 혼성화 기법(dynamic allele-specific hybridization, DASH), TaqMan 기법, SnapShot 기법 및 PCR 연장 분석으로 이루어진 군으로부터 선택되는 기법에 의하여 수행될 수 있다. 그러나 이에 제한되지 않으며, 본 발명의 rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 또는 rs7680060의 유전자형을 분석할 수 있는 방법이면 어느 것이든 이용 가능하다.In yet another embodiment of the present invention, the step of identifying the single nucleotide polymorphism may comprise sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele specific hybridization allele-specific hybridization (DASH), TaqMan technique, SnapShot technique, and PCR extension analysis. However, the present invention is not limited thereto, and any method can be used that can analyze the genotypes of rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756, or rs7680060 of the present invention.

본 발명의 또 다른 구체예에서, 상기 단일염기다형성을 확인한 결과, 서열번호 1로 표시되는 rs11579055의 대립유전자로, 26번째 염기가 G인 경우; 서열번호 2로 표시되는 rs10920559의 대립유전자로, 26번째 염기가 C인 경우; 서열번호 3으로 표시되는 rs4615152의 대립유전자로, 26번째 염기가 C인 경우; 서열번호 4로 표시되는 rs10024812의 대립유전자로, 26번째 염기가 A인 경우; 서열번호 5로 표시되는 rs13132889의 대립유전자로, 26번째 염기가 T인 경우; 서열번호 6으로 표시되는 rs12507756의 대립유전자로, 26번째 염기가 T인 경우; 및 서열번호 7로 표시되는 rs7680060의 대립유전자로, 26번째 염기가 T인 경우; 중 적어도 하나일 때, 보다 바람직하게는 rs11579055의 대립유전자가 G일 때 심방세동의 발병 위험성이 높다고 분류하여, 심방세동의 발생을 예측 또는 진단할 수 있다.In another embodiment of the present invention, when the single nucleotide polymorphism is confirmed, the allele of rs11579055 represented by SEQ ID NO: 1 and the 26th nucleotide is G; An allele of rs10920559 represented by SEQ ID NO: 2, wherein the 26th base is C; An allele of rs4615152 represented by SEQ ID NO: 3, wherein the 26th base is C; An allele of rs10024812 represented by SEQ ID NO: 4, wherein the 26th base is A; An allele of rs13132889 represented by SEQ ID NO: 5, wherein the 26th base is T; An allele of rs12507756 represented by SEQ ID NO: 6, wherein the 26th base is T; And an allele of rs7680060 represented by SEQ ID NO: 7, wherein the 26th base is T; The risk of atrial fibrillation is high when the allele of rs11579055 is G. Thus, the occurrence of atrial fibrillation can be predicted or diagnosed.

또한, 본 발명은 rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 및 rs7680060로 이루어진 군으로부터 선택되는 하나 이상, 더욱 바람직하게는 rs11579055의 단일염기다형성(single nucleotide polymorphism)과 특이적으로 결합하는 프라이머 세트를 포함하는 심방세동 예측 또는 진단용 조성물을 제공한다.The present invention also provides a primer set that specifically binds to a single nucleotide polymorphism of rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756, and rs7680060, more preferably rs11579055 / RTI > or a pharmaceutically acceptable salt thereof.

또한, 본 발명은 상기 심방세동 예측 또는 진단용 조성물을 포함하는 심방세동 예측 또는 진단용 키트를 제공한다. In addition, the present invention provides a kit for predicting or diagnosing an atrial fibrillation comprising the composition for prediction or diagnosis of atrial fibrillation.

본 발명에 따른 유전자좌위의 단일염기다형성을 확인하여 심방세동의 예측 또는 진단에 관한 정보를 제공하는 방법은 단일염기다형성을 확인하여 한국인 환자 중 심방세동의 발생을 예측 또는 진단할 수 있는 방법으로 한국인 특이적으로 심방세동 고위험군을 예측할 수 있기 때문에 임상적으로 큰 의미를 가지며, 이를 이용하여 개개인의 치료, 시술, 수술 등 다양한 처치 과정에서의 위험성을 감소시켜 심방세동으로 인한 위험성을 감소시키는데 효과적으로 사용될 수 있을 것으로 기대된다.The method of providing information about the prediction or diagnosis of atrial fibrillation by confirming the single nucleotide polymorphism of the gene locus according to the present invention is a method for predicting or diagnosing the occurrence of atrial fibrillation among Korean patients by confirming the single nucleotide polymorphism The risk of atrial fibrillation can be effectively reduced by reducing the risk of various treatments such as treatment, surgery, and surgery using individual patients. It is expected to be.

도 1은 본 발명의 일 실시예에 따른 전장유전체연관분석에 대한 맨하탄 플롯(Manhattan plot)을 나타낸 도면이다.
도 2는 본 발명의 일 실시예에 따른 rs11579055에 대한 regional LD plot을 나타낸 도면이다.
1 is a diagram illustrating a Manhattan plot for a full field dielectric association analysis according to an embodiment of the present invention.
2 is a diagram illustrating a regional LD plot for rs11579055 according to an embodiment of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예Example

실시예Example 1: 심방세동 관련 유전자 확인을 위한 전장유전체연관분석 실시 1: Analysis of total genome association for identification of atrial fibrillation related genes

한국인의 심방세동(atrial fibrillation; AF)과 관련된 유전자를 확인하기 위하여, 전장유전체연관분석(Genome Wide Association Study; GWAS)를 실시하였다. 1단계 전장유전체연관분석을 위하여 Affymetrix Genome-Wide Human SNP array 6.0 칩(AffymetrixInc., Santa Clara, CA, USA)을 이용하여 유전자형 분석을 시행하였고, 총 5,372명의 말초혈액에서 채취한 혈액시료로부터 QIAamp® DNA Mini and Blood Mini kit(Qiagen)을 이용하여 DNA 500ng을 채취하여 유전자형 분석을 시행하였다. 전장유전체연관분석 결과를 이용한 연관성 분석에는 PLINK program version 1.07을 이용하여 수행하였다. 그리고 통계적 분석은 SAS(version 9.1)을 이용하여 분석하였다. 그 결과는 도 1에 나타내었다.Genome Wide Association Study (GWAS) was performed to identify genes associated with atrial fibrillation (AF) in Koreans. Genotype analysis was performed using the Affymetrix Genome-Wide Human SNP array 6.0 chip (Affymetrix Inc., Santa Clara, Calif., USA) for 1-step full-length genomic association analysis and the QIAamp® from blood samples collected from 5,372 peripheral blood samples DNA was extracted from 500 ng of DNA using Mini and Blood Mini kit (Qiagen). Linkage analysis using the results of the field genome association analysis was performed using the PLINK program version 1.07. Statistical analysis was performed using SAS (version 9.1). The results are shown in Fig.

도 1의 적색선은 전장유전체연관분석 결과 "P=1.0X10-8"의 유의수준(significant level)을 나타내며, 청색선은 "P=1.0X10-5"의 유의수준(significant level)을 나타낸다. 또한, 청색으로 표기된 유전자, 즉, PRRX1, PITX2, ZFHX3, NEURL, 및 TBX5는 기존에 서양인(European ancestry)을 대상으로 하여 심방세동 관련 단일염기다형성(single nucleotide polymorphism; SNP)과 최단거리에 위치하는 유전자좌위(closest locus)이며, 적색으로 표기된 유전자, 즉, PPFIA4 및 HANDS2는 본 전장유전체연관분석을 통하여 새롭게 발견된 유전자좌위이다. 상기 결과를 통하여, 기존의 서양인을 대상으로 했던 심방세동 관련 유전자좌위와, 한국인을 대상으로 한 관련 유전자위가 일치하지 않는 것을 확인하였으며, 이를 토대로 하여 한국인을 대상으로 한 심방세동 관련 단일염기다형성을 확인하는 실험을 진행하였다.The red line in Fig. 1 represents a significant level of the " P = 1.0 x 10 " -8 " and the blue line represents a significant level of" P = 1.0 x 10 -5 " In addition, PRTRX1, PITX2, ZFHX3, NEURL, and TBX5, which are blue-colored genes, have been used for European ancestry and are located at the shortest distance from the atrial fibrillation-related single nucleotide polymorphism (SNP) The genes in the closest locus, red, namely PPFIA4 and HANDS2, are newly discovered gene loci through this whole genome association assay. Based on the above results, it was confirmed that the loci of atrial fibrillation related to the Western population and the related gene loci of the Korean population were not identical. Based on this, it was confirmed that the atypical femur related single nucleotide polymorphism .

실시예Example 2: 연관 단일염기다형성의 검증 2: Verification of related single nucleotide polymorphisms

서양인에게서 발굴되지 않은 2개의 유전자좌위인 PPFIA4 및 HANDS2의 경우에는 한국인의 심방세동 발생 위험성과 매우 높은 연관관계를 나타내는 것을 확인할 수 있었다. 또한, 상기 유전자좌위 중 단일염기다형성인 rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 및 rs7680060가 한국인의 심방세동 발생 위험성과 매우 높은 연관관계를 나타내는 것을 확인할 수 있었다(표 2)(genome-wide p-value=5 x 10-8 기준). 이를 통하여, 본 발명의 유전자좌위 또는 단일염기다형성을 확인하여 한국인에게 있어서의 심방세동 발생 위험성, 즉, 심방세동의 발생을 예측 또는 진단할 수 있다는 것을 확인할 수 있었다.PPFIA4 and HANDS2, two loci not found in Western populations, showed a very high correlation with the risk of atrial fibrillation in Koreans. In addition, it was confirmed that the single nucleotide polymorphisms rs11579055, rs10920559, rs4615152, rs10024812, rs13132889, rs12507756 and rs7680060 in the locus of the locus are highly correlated with the risk of Korean atrial fibrillation (Table 2) -value = 5 x 10 -8 basis). Thus, it can be confirmed that the risk of atrial fibrillation, i.e., the occurrence of atrial fibrillation in Korean, can be predicted or diagnosed by confirming the gene locus or single base polymorphism of the present invention.

Figure pat00001
Figure pat00001

실시예Example 3: 연관 단일염기다형성 재현 실험 3: Recombinant monoclonal polymorphism experiment

새롭게 발견된 전장유전체연구의 재현연구를 위하여, 독립적인 심방세동 환자군 200명과 정상인 1,812명을 이용하여, Affymetrix Genome-Wide Human SNP array 6.0 칩(AffymetrixInc., Santa Clara, CA, USA)을 이용하여 유전자형 분석을 시행하였다. (Affymetrix Inc., Santa Clara, Calif., USA) using 200 Affymetrix Genome-Wide Human SNP array 6.0 chips (200 Affiliates, Inc., Santa Clara, Calif., USA) using 200 independent atrial fibrillation patients and 1,812 normal individuals Respectively.

그 결과, 전장유전체연관분석에서 200명의 심방세동 환자와 1,812명의 대조군에서 1번 염색체에 위치한PPFIA4 유전자에서 단일염기다형성인 rs11579055가 유의성 있게 심방세동 발생 위험도가 가장 높은 것으로 확인되었다(OR = 1.31 (95% CI = 1.01 to 1.31; P = 4.4 × 10-2)). As a result, the single nucleotide polymorphism rs11579055 in the PPFIA4 gene located on chromosome 1 in 200 atrial fibrillation patients and 1,812 controls showed the highest risk of atrial fibrillation (OR = 1.31 (95 % CI = 1.01 to 1.31; P = 4.4 x 10-2 )).

즉, 전장유전체연관분석과 그 재현연구(replication) 단계를 모두 합친 대상자군(환자군 872명, 정상인 5,512명)의 분석에서 rs11579055의 단일염기다형성이 심방세동과 연관성이 높은 것으로 확인되었다 (p< 5.0 x 10-8, 전장유전체 유의수준 p-value기준) (표 2). In summary, the single nucleotide polymorphism of rs11579055 was found to be associated with atrial fibrillation in the analysis of the subject population (872 patients, normal 5,512 subjects) who combined both the full-length genome association analysis and the replicating phase (p <5.0 x 10 -8 , total field dielectric level p-value) (Table 2).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism <130> DPB162638 <160> 7 <170> KopatentIn 2.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is g or t <400> 1 aaaccatgtc aatagggata aaaaayacag tctcggctgg gcgcggtggc t 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is c or t <400> 2 gagctgcctt gagaagtaat gagttygctg cccctggagg cattcaggca c 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is c or t <400> 3 accttgatct cggacttgta acctgyagaa ctgtgaaaga ataaatttct g 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is a or g <400> 4 taacatttta ctttgagtca gaagtyagta gaccctagct tataatttcc t 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is g or t <400> 5 cacacgatac tctgattcag aagctycaat ctctacaaag cataggtcag g 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is c or t <400> 6 gtgtgtgtgt gtgtgacagt aatagyggta gatgttctag tagccactgc c 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation <222> (26) <223> y is c or t <400> 7 agagagatta ggacaaattg aacaayactg ctgttttcag ttctctttat a 51 <110> Industry-Academic Cooperation Foundation, Yonsei University <120> Method for providing the information for predicting or diagnosing          of atrial fibrillation using single nucleotide polymorphism <130> DPB162638 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is g or t <400> 1 aaaccatgtc aatagggata aaaaayacag tctcggctgg gcgcggtggc t 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 2 gagctgcctt gagaagtaat gagttygctg cccctggagg cattcaggca c 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 3 accttgatct cggacttgta acctgyagaa ctgtgaaaga ataaatttct g 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is a or g <400> 4 taacatttta ctttgagtca gaagtyagta gaccctagct tataatttcc t 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is g or t <400> 5 cacacgatac tctgattcag aagctycaat ctctacaaag cataggtcag g 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 6 gtgtgtgtgt gtgtgacagt aatagyggta gatgttctag tagccactgc c 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <220> <221> variation (26) <223> y is c or t <400> 7 agagagatta ggacaaattg aacaayactg ctgttttcag ttctctttat a 51

Claims (7)

생물학적 시료로부터 서열번호 1로 표시되는 rs11579055; 서열번호 2로 표시되는 rs10920559; 서열번호 3으로 표시되는 rs4615152; 서열번호 4로 표시되는 rs10024812; 서열번호 5로 표시되는 rs13132889; 서열번호 6으로 표시되는 rs12507756; 및 서열번호 7로 표시되는 rs7680060로 이루어진 군으로부터 선택되는 하나 이상의 단일염기다형성(single nucleotide polymorphism)을 확인하는 단계를 포함하는, 심방세동 예측 또는 진단에 관한 정보를 제공하는 방법.Rs11579055 represented by SEQ ID NO: 1 from the biological sample; Rs10920559 represented by SEQ ID NO: 2; Rs4615152 represented by SEQ ID NO: 3; Rs10024812 represented by SEQ ID NO: 4; Rs13132889 represented by SEQ ID NO: 5; Rs12507756 represented by SEQ ID NO: 6; And at least one single nucleotide polymorphism selected from the group consisting of SEQ ID NO: 7 and rs7680060. &Lt; Desc / Clms Page number 20 &gt; 제 1 항에 있어서,
상기 심방세동 예측 또는 진단에 관한 정보를 제공하는 방법은 한국인을 대상으로 하는 것을 특징으로 하는, 방법.
The method according to claim 1,
Wherein the method for providing information on atrial fibrillation prediction or diagnosis is for a Korean person.
제 1 항에 있어서,
상기 생물학적 시료는 체액, 모근, 혈액, 혈장 또는 혈청인 것을 특징으로 하는, 방법.
The method according to claim 1,
Wherein the biological sample is a body fluid, hair roots, blood, plasma or serum.
제 1 항에 있어서,
상기 확인하는 단계는 시퀀싱 분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적 PCR(allele specific PCR), 다이나믹 대립유전자 특이적 혼성화 기법(dynamic allele-specific hybridization, DASH), TaqMan 기법, SnapShot 기법 및 PCR 연장 분석으로 이루어진 군으로부터 선택되는 기법에 의하여 수행되는, 방법.
The method according to claim 1,
The verification step may be performed by sequencing analysis, microarray hybridization, allele specific PCR, dynamic allele-specific hybridization (DASH), TaqMan technique, SnapShot technique And PCR extension analysis.
제 1 항에 있어서,
상기 정보를 제공하는 방법은,
서열번호 1로 표시되는 rs11579055의 26번째 염기가 G인 경우;
서열번호 2로 표시되는 rs10920559의 26번째 염기가 C인 경우;
서열번호 3으로 표시되는 rs4615152의 26번째 염기가 C인 경우;
서열번호 4로 표시되는 rs10024812의 26번째 염기가 A인 경우;
서열번호 5로 표시되는 rs13132889의 26번째 염기가 T인 경우;
서열번호 6으로 표시되는 rs12507756의 26번째 염기가 T인 경우; 및
서열번호 7로 표시되는 rs7680060의 26번째 염기가 T인 경우; 중 적어도 하나일 때 심방세동의 발생을 예측 또는 진단하는 것을 특징으로 하는, 방법.
The method according to claim 1,
A method for providing the information,
When the 26th base of rs11579055 represented by SEQ ID NO: 1 is G;
When the 26th base of rs10920559 represented by SEQ ID NO: 2 is C;
When the 26th base of rs4615152 represented by SEQ ID NO: 3 is C;
When the 26th base of rs10024812 represented by SEQ ID NO: 4 is A;
When the 26th base of rs13132889 represented by SEQ ID NO: 5 is T;
The 26th base of rs12507756 represented by SEQ ID NO: 6 is T; And
When the 26th base of rs7680060 represented by SEQ ID NO: 7 is T; Wherein at least one of the atrial fibrillation and the atrial fibrillation is predictive or diagnostic of the occurrence of atrial fibrillation.
서열번호 1로 표시되는 rs11579055; 서열번호 2로 표시되는 rs10920559; 서열번호 3으로 표시되는 rs4615152; 서열번호 4로 표시되는 rs10024812; 서열번호 5로 표시되는 rs13132889; 서열번호 6으로 표시되는 rs12507756; 및 서열번호 7로 표시되는 rs7680060로 이루어진 군으로부터 선택되는 하나 이상의 단일염기다형성(single nucleotide polymorphism)과 특이적으로 결합하는 프라이머 세트를 포함하는, 심방세동 예측 또는 진단용 조성물.Rs11579055 represented by SEQ ID NO: 1; Rs10920559 represented by SEQ ID NO: 2; Rs4615152 represented by SEQ ID NO: 3; Rs10024812 represented by SEQ ID NO: 4; Rs13132889 represented by SEQ ID NO: 5; Rs12507756 represented by SEQ ID NO: 6; And a set of primers that specifically bind to at least one single nucleotide polymorphism selected from the group consisting of SEQ ID NO: 7 and rs7680060. 제 6 항의 심방세동 고위험군 예측용 조성물을 포함하는, 심방세동 예측 또는 진단용 키트.An atrial fibrillation prediction or diagnostic kit comprising the atrial fibrillation high risk group composition of claim 6.
KR1020160058906A 2016-05-13 2016-05-13 Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism KR101883657B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160058906A KR101883657B1 (en) 2016-05-13 2016-05-13 Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160058906A KR101883657B1 (en) 2016-05-13 2016-05-13 Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism

Publications (2)

Publication Number Publication Date
KR20170128725A true KR20170128725A (en) 2017-11-23
KR101883657B1 KR101883657B1 (en) 2018-07-31

Family

ID=60809582

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160058906A KR101883657B1 (en) 2016-05-13 2016-05-13 Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism

Country Status (1)

Country Link
KR (1) KR101883657B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021225287A1 (en) * 2020-05-07 2021-11-11 연세대학교 산학협력단 Device and method for predicting disease risk by using genetic information

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010511404A (en) * 2006-12-05 2010-04-15 デコード・ジェネティクス・イーエイチエフ Genetic markers for risk management of cardiac arrhythmias
KR20120118845A (en) * 2012-10-17 2012-10-29 연세대학교 산학협력단 Polynucleotide for predicting prognosis of atrial fibrillation
CN103468784A (en) * 2012-06-06 2013-12-25 解码(上海)生物医药科技有限公司 Atrial fibrillation susceptibility gene non-invasive detection kit

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010511404A (en) * 2006-12-05 2010-04-15 デコード・ジェネティクス・イーエイチエフ Genetic markers for risk management of cardiac arrhythmias
CN103468784A (en) * 2012-06-06 2013-12-25 解码(上海)生物医药科技有限公司 Atrial fibrillation susceptibility gene non-invasive detection kit
KR20120118845A (en) * 2012-10-17 2012-10-29 연세대학교 산학협력단 Polynucleotide for predicting prognosis of atrial fibrillation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Circulation 2010 제122권 제976-984면 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021225287A1 (en) * 2020-05-07 2021-11-11 연세대학교 산학협력단 Device and method for predicting disease risk by using genetic information

Also Published As

Publication number Publication date
KR101883657B1 (en) 2018-07-31

Similar Documents

Publication Publication Date Title
KR20220153109A (en) Methods of diagnosing inflammatory bowel disease through rnaset2
JP5721150B2 (en) Prediction risk of age-related macular degeneration
Soon et al. Use of a panel of congenic strains to evaluate differentially expressed genes as candidate genes for blood pressure quantitative trait loci
KR101883657B1 (en) Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism
KR101757108B1 (en) Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism through by genome-wide association study
JPWO2011148715A1 (en) Normal-tension glaucoma disease susceptibility gene and use thereof
KR101795939B1 (en) Method for providing the information for predicting of left atrial reverse remodeling using genome-wide association studies
US20180105878A1 (en) Biomarker of detecting a biological sample, probe, kit and method of non-invasively and qualitatively determining severity of endometriosis
KR20170007560A (en) Composition for determining nose phenotype
JP5226256B2 (en) Prediction risk of age-related macular degeneration
KR101497282B1 (en) Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn&#39;s Disease
KR102063486B1 (en) Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population
CN113166810A (en) SNP marker for diagnosing cerebral aneurysm including single base polymorphism of GBA gene
WO2015168252A1 (en) Mitochondrial dna copy number as a predictor of frailty, cardiovascular disease, diabetes, and all-cause mortality
KR101529008B1 (en) Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn&#39;s Disease
CN104762387B (en) Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma
KR102481211B1 (en) SNP marker for chronic sensorineural tinnitus diagnosis and diagnosis method using the same
KR102281644B1 (en) INSR Gene hypermethylation marker for diagnosis of delayed cerebral ischemia
KR101497204B1 (en) Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn&#39;s Disease
KR101545097B1 (en) Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn&#39;s Disease
KR20230166278A (en) A model for predicting the prognosis of subarachnoid hemorrhage using multiple SNP markers
KR20230161736A (en) Marker for predicting prognosis of subarachnoid hemorrhage including rs56823384 SNP of untranslated RNA
KR20230164963A (en) A marker for predicting the absolute risk of cognitive impairment after subarachnoid hemorrhage
KR20230164962A (en) A marker for predicting the prognosis of subarachnoid hemorrhage including the rs76507772 SNP, which has strong linkage disequilibrium with IRS2 gene mutation
KR20230166277A (en) Composition for predicting prognosis of subarachnoid hemorrhage containing rs145397166 SNP

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant