CN104762387B - Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma - Google Patents
Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma Download PDFInfo
- Publication number
- CN104762387B CN104762387B CN201510155469.7A CN201510155469A CN104762387B CN 104762387 B CN104762387 B CN 104762387B CN 201510155469 A CN201510155469 A CN 201510155469A CN 104762387 B CN104762387 B CN 104762387B
- Authority
- CN
- China
- Prior art keywords
- pituitary adenoma
- genotype
- polymorphism
- primer
- allele
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses an application of single nucleotide polymorphism rs1708383 in detection of pituitary adenoma. According to the technical scheme adopted by the invention, a matter for detecting polymorphism (allele) or gene type in human genome rs1708383 is applied to preparing a product for detecting single nucleotide polymorphism associated with pituitary adenoma. The substance or detecting polymorphism or gene type of rs1708383 can be combined with other matters (matters for detecting single nucleotide polymorphism or gene type associated with the pituitary adenoma) to prepare a product for screening a pituitary adenoma patient.
Description
Technical field
The answering in pituitary adenoma is detected the present invention relates to SNP rs17083838 in biomedical sector
With.
Background technology
Pituitary adenoma (Pituitary adenomas) is the most common neuroendocrine of human body, is also most common
One of brain tumor.Functional pituitary adenoma can abnormal secretion hormone, cause patient occur infertile, acromegaly,
The significant endocrine disturbance symptom such as Cushing syndromes, hyperthyroidism, and then the seriously important organ function such as infringement conscience kidney.Hang down
Body adenoma incidence of occult, it is slow-growing, when there are clinical symptoms in patient goes to medical, tumour often bulky, or be in
Invasive growth, the neighbouring important anatomy structure of compressing causes patient primary pituitary hypofunction, binocular vision occur and declines and cranial nerve
The neurological deficit symptoms such as paralysis, or even irreversible nerve function lesion is developed into, the quality of life of patient is had a strong impact on, very
To threat to life.
The clinical treatment of current pituitary adenoma is based on surgery excision, supplemented by medicine and stereotactic radiotherapy.But the disease is simultaneously
Non- is a kind of simple neurosurgery related disease, but one kind involves division of endocrinology, gynemetrics, Andriatrics Dept., ophthalmology, radiotherapy department, shadow
As multi-disciplinary complex diseases such as medical science sections, many bottleneck problems are still suffered from clinic diagnosis.The morbidity machine of pituitary adenoma
System is unclear, and early diagnosis is difficult, if early diagnosing out pituitary adenoma, and takes it secondary prevention and diagnosis and treatment of layering, right
In the timely serious functional lesion terminated because tumour abnormal secretion hormone is produced to important organs such as patient's conscience kidneys, prevent because swollen
Knurl is persistently hidden the irreversible nerve function lesion caused by growth compressing and reduces Operative risk very important facing
Bed meaning.Clinically it is used to make a definite diagnosis the nuclear magnetic resonance check (MRI) of pituitary adenoma at present, not only expense is costly, it is difficult to be used for
The extensive screening of clinical case, and due to being limited by resolution ratio, it is difficult to find diameter<Micro- adenoma of 0.5cm.Therefore at present
It is badly in need of easy, inexpensive pituitary adenoma early diagnosis tool and method.
The content of the invention
The technical problems to be solved by the invention be how examination pituitary adenoma patients.
In order to solve the above technical problems, present invention firstly provides following A 1)-A6) in any purposes：
A1) polymorphism (i.e. allele) of rs17083838 or the material of genotype are preparing sieve in detection human genome
The application looked into pituitary adenoma patients product；
A2) polymorphism (i.e. allele) of rs17083838 or the material of genotype are preparing inspection in detection human genome
The application surveyed in pituitary adenoma neurological susceptibility product；
A3) polymorphism (i.e. allele) of rs17083838 or the material of genotype are preparing inspection in detection human genome
The application surveyed in the product of the SNP related to pituitary adenoma；
A4) polymorphism (i.e. allele) of rs17083838 or the material of genotype are preparing mirror in detection human genome
Application in fixed or the auxiliary identification SNP related to pituitary adenoma product；
A5) polymorphism (i.e. allele) or genotype of rs17083838 are preparing examination pituitary adenoma in human genome
Application in patient product；
A6) polymorphism (i.e. allele) or genotype of rs17083838 are preparing detection pituitary adenoma in human genome
Application in neurological susceptibility product.
Rs17083838 is a SNP site for two equipotential polymorphisms on human chromosome 13q12.13, and the variation is to turn
Change (A/G is then T/C on its complementary strand).The rs17083838 genotype is AA, AG or GG.The AA is
Rs17083838 sites are homozygous for A's, and the GG is that rs17083838 sites are the homozygous of G, and the AG is
Rs17083838 sites are the heterozygous of A and G.The polymorphism (i.e. allele) of rs17083838 in the detection human genome
Or genotype concretely detects the nucleotides species of rs17083838.
In such use, the product includes the PCR primer of the genomic DNA fragment including rs17083838 including amplification
And/or Single base extension primer；
And/or,
The polymorphism (i.e. allele) of rs17083838 or the material of genotype can be institute in the detection human genome
State PCR primer and/or the Single base extension primer.
In such use, the individual ratio in pituitary adenoma patients colony of the AA and the AG genotype is high respectively
In ratio of the corresponding genotype in normal healthy people colony.
In such use, the pituitary adenoma is specially Chinese population pituitary adenoma.
In order to solve the above technical problems, present invention also offers the polymorphism containing rs17083838 in detection human genome
The product of the material of (i.e. allele) or genotype.
The polymorphism (i.e. allele) or gene of rs17083838 in the human genome containing detection provided by the present invention
The product of the material of type, is a)-d) in any one product：
A) product of the detection SNP (i.e. allele) related to pituitary adenoma or genotype；
B) identify or aid in the identification SNP (i.e. allele) related to pituitary adenoma or genotype
Product；
C) examination pituitary adenoma patients product；
D) pituitary adenoma neurological susceptibility product is detected.
In the said goods, the product includes that amplification includes the PCR primer and/or the Single base extension primer；
And/or,
The polymorphism (i.e. allele) of rs17083838 or the material of genotype can be institute in the detection human genome
State PCR primer and/or the Single base extension primer.
In the said goods, the individual ratio in pituitary adenoma patients colony of the AA and the AG genotype is high respectively
In ratio of the corresponding genotype in normal healthy people colony.
In an embodiment of the present invention, the pituitary adenoma is specially Chinese population pituitary adenoma.
In the present invention, the PCR primer pair of the amplification including the genomic DNA fragment including rs17083838 can be by sequence
Single stranded DNA composition in single stranded DNA and sequence table in table shown in SEQ ID No.5 shown in SEQ ID No.6；The single base
The nucleotide sequence of extension primer is as shown in SEQ ID No.9 in sequence table.
It is demonstrated experimentally that the risk allele of rs17083838 is A, the allele (is suffered from case group by pituitary adenoma
Person constitutes) in ratio of the ratio than the allele in control group (being made up of normal healthy people) it is high by 1.99%.
The P values of rs17083838 are 1.89 × 10-8, and the relative risk of rs17083838 is 1.37, illustrate rs17083838 be with
The related SNP of pituitary adenoma.In three genotype of rs17083838, AA genotype and AG genotype
Ratio of the body in case group pituitary adenoma patients colony is respectively higher than the individuality of correspondence genotype in control group normal healthy people
Ratio in colony；The individuality of the individual ratio in case group pituitary adenoma patients colony less than the genotype of GG genotype
Ratio in control group normal healthy people colony.
In actual applications, can will detect rs17083838 polymorphism (i.e. allele) or genotype material and its
Its material (such as detecting the material of other SNPs related to pituitary adenoma or genotype) system of being united
The product of standby examination pituitary adenoma patients.
Wherein, the polymorphism (i.e. allele) of rs17083838 or the material of genotype can be logical in detection human genome
The reagent and/or instrument crossed needed for following at least one methods determine the polymorphism (i.e. allele) or genotype of rs17083838
Device：DNA sequencing, Restrictive fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance chromatography, SNP chip,
TaqMan probe technology and Sequenom MassArray technologies.Wherein, determined using Sequenom MassArray technologies
Reagent and/or instrument needed for the polymorphism (i.e. allele) or genotype of rs17083838 include PCR primer to, based on list
The extension primer of base extension, phosphatase (such as shrimp alkaline phosphotase (shrimp alkaline phosphatase,
SAP)), resin, chip, MALDI-TOF (matrix-assisted laser desorption/ionization-time of
Fligh, matrix solid-dispersion flight time mass spectrum) and/or Sequenom MassArray technologies required for
Other reagents and instrument；Polymorphism (i.e. allele) or the genotype institute of rs17083838 are determined using TaqMan probe technology
The reagent and/or instrument for needing include TaqMan probe, PCR primer to, quantitative PCR apparatus, the module for carrying out Genotyping (such as
7500System SDS software) and/or TaqMan probe technology required for other reagents；SNP chip includes being based on core
Chip, the chip based on single base extension, the core based on allele-specific primers extension of acid hybridization reaction
Piece, based on " one-step method " reaction chip, the chip based on primer coupled reaction, the chip based on restriction enzyme reaction,
Chip based on protein D NA association reactions and/or the chip based on fluorescence molecule DNA association reactions.
The product can be reagent or kit, can also be the system being made up of reagent or kit and instrument, such as by drawing
The system of thing and DNA sequencer composition, the system being made up of PCR reagent and DNA sequencing reagent and DNA sequencer, by TaqMan
Other examinations of probe, PCR primer to, quantitative PCR apparatus and required for carrying out the module and TaqMan probe technology of Genotyping
The system of agent composition, other reagents and instrument group as required for probe, PCR primer pair and Ligase detection reaction (LDR)
Into system, by PCR primer to, Single base extension primer, chip, PCR instrument, the module for carrying out Genotyping and/or
The system of other reagents and the instrument composition required for Sequenom MassArray technologies.
In one embodiment of the present of invention, the polymorphism of rs17083838 is determined using Sequenom MassArray technologies
(i.e. allele) and genotype.The PCR primer to there is no particular/special requirement in sequence, as long as can amplify including
Rs17083838 in interior genomic DNA fragment, concretely SEQ ID No.5 and SEQ ID No.6 institutes in sequence table
The single stranded DNA for showing.Single base extension primer single stranded DNA concretely in sequence table shown in SEQ ID No.9.
Other instruments required for Sequenom MassArray technologies include MassARRAY Nanodispenser RS1000 point samples
Instrument (Sequenom) and/or MALDI-TOF mass spectrographs.Chip required for Sequenom MassArray technologies is
SpectroCHIP (Sequenom) chip (Sequenom).The module for carrying out Genotyping is the softwares of TYPER 4.0
(Sequenom)。
In an embodiment of the present invention, the PCR reaction systems such as institute of table 1 that Genotyping is used is carried out to rs17083838
Show, reaction condition is：95 degrees Celsius of 2min (predegeneration)；95 degrees Celsius of 30s, 56 degrees Celsius of 30s, 45 circulations；72 degrees Celsius
60s；72 degrees Celsius of 5min；4 degrees Celsius of preservations.
Table 1, PCR reaction systems
| Reagent and its concentration | Volume (μ l) |
| Template DNA (10ng/ μ l) | 1 |
| Primers F (single stranded DNA shown in SEQ ID No.5,0.5 μM) | 0.5 |
| Primer R (single stranded DNA shown in SEQ ID No.6,0.5 μM) | 0.5 |
| 10 × Buffer (contains Mg2+) | 0.5 |
| MgCl2(25mM) | 0.4 |
| dNTPs(25mM) | 0.1 |
| Hotstar(5U/μl) | 0.1 |
| Ultra-pure water | 1.9 |
| Cumulative volume | 5 |
In an embodiment of the present invention, the SAP digestion reaction systems of the 2 μ l that Genotyping is used are carried out to rs17083838
For：0.17 μ l, SAP Enzyme of SAP Buffer 0.3 μ l, the μ l of ultra-pure water 1.53.The program of SAP digestion reactions is：37 is Celsius
Degree 40min；85 degrees Celsius of 5min；4 degrees Celsius of holdings.
In an embodiment of the present invention, the system of the single base extension that Genotyping is used is carried out to rs17083838
As shown in table 2.
Table 2, single base extension system
| Reagent and its concentration | Volume (μ l) |
| Single base extension primer | 0.94 |
| Gold Buffer | 0.2 |
| Termination mix | 0.1 |
| Enzyme | 0.021 |
| Ultra-pure water | 0.739 |
| Cumulative volume | 2 |
The single base extension is carried out in ABI9700 instrument, and reaction condition is：
4 degrees Celsius of holdings.
Utilization Sequenom MassArray technologies in the present invention determine polymorphism (the i.e. equipotential base of rs17083838
Cause) or the reagent of genotype to may be from the article No. of Sequenom be the Complete of 10148-2Gold
Genotyping Reagent Set 10x384, Hotstar (5U/ μ l), the 10 × Buffer (contain Mg as described2+), it is described
DNTPs (25mM), the MgCl2(25mM), the shrimp alkaline phosphotase (shrimp alkaline phosphatase,
SAP), the SAP Buffer, the resin, the Gold Buffer, the Termination mix, the Enzyme.
ABI9700 instrument in the present invention can be ABI Products, model 9700.
The present invention has found that rs17083838 is the monokaryon related to pituitary adenoma in a sample from Chinese population
Nucleotide polymorphism.Can will detect the polymorphism (i.e. allele) of rs17083838 or the material of genotype with other materials (such as
The material of the other SNPs (i.e. allele) related to pituitary adenoma of detection or genotype) it is united
Prepare the product of pituitary adenoma patients in examination Chinese population.
Brief description of the drawings
Fig. 1 is two principal component PCA plot of primary dcreening operation stage sample.Wherein, C1 is principal component 1, and C2 is principal component 2.
Fig. 2 schemes for the Q-Q in primary dcreening operation stage.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for explaining
The bright present invention, rather than in order to limit the scope of the present invention.Experimental technique in following embodiments, unless otherwise specified, is
Conventional method.Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
Utilization Sequenom MassArray technologies in following embodiments determine that the reagent of mononucleotide genotype is
Sequenom products.
Embodiment 1, rs2359536, rs10763170 and rs17083838 is that the mononucleotide related to pituitary adenoma is more
State property
First, research object
Case group：3313 pituitary adenoma patients gone to a doctor and perform the operation in Huashan Hospital Affiliated To Fudan Univ neurosurgery.
3313 pituitary adenoma patients are pituitary adenoma and two through clinical manifestation, endocrine laboratory examination, imageological examination
Above pathology expert carries out histological characterization and is diagnosed as pituitary adenoma patients to tumor specimen.3313 pituitary adenoma patients
With other malignant diseases (such as meningioma, glioma, lymthoma, leukaemia, lung cancer, stomach cancer, intestinal cancer, breast cancer and palace
Neck cancer etc.), 3313 pituitary adenoma patients are not familial pituitary adenoma patients.By 3313 pituitary adenomas of case group
Patient is divided into three groups (tables 3), i.e. case group 1, case group 2 and case group 3, the pituitary adenoma patients in case group 2 essentially from
In East China (predominantly Shanghai City, is secondly Zhejiang Province and Jiangsu Province), the pituitary adenoma patients in case group 3 are main
Come from Central Region (mainly including Anhui Province, Jiangxi Province, Hubei Province and Henan Province).
Control group：6408 do not suffer from pituitary adenoma and without the normal healthy people of pituitary adenoma family history, and without it
His medical history.6408 normal healthy peoples of control group are divided into three groups (tables 3), i.e. control group 1, control group 2 and control group 3,
Normal healthy people in control group 2 mostlys come from East China, and (predominantly Shanghai City, is secondly Zhejiang Province and Jiangsu
Save), the normal healthy people in control group 3 mostlys come from Central Region (mainly including Anhui Province, Jiangxi Province, Hubei Province
And Henan Province).
All research objects for participating in research gave informed consent before experiment starts, and the research obtains participant
The license of member.This research obtains the approval of Huashan Hospital Ethical Committee.
The research object in primary dcreening operation stage is case group 1 and control group 1.Qualify Phase is divided into 2 parts, the i.e. He of Qualify Phase 1
Qualify Phase 2, the research object of Qualify Phase 1 is case group 2 and control group 2, and the research object of Qualify Phase 2 is case group 3
With control group 3.
Table 3, research object information
| Case group | Control group | |
| The primary dcreening operation stage | 771 | 2788 |
| Qualify Phase 1 | 2080 | 2093 |
| Qualify Phase 2 | 462 | 1527 |
| Sum | 3313 | 6408 |
| Average age (year) | 44.9±13.9 | 57.7±9.3 |
| Female ratio (＆) | 52.0 | 53.8 |
2nd, association analysis
The peripheric venous blood of each patient of above-mentioned case group and each normal healthy people of above-mentioned control group is extracted respectively
5ml, is positioned in EDTANa2 anticoagulant tubes, obtains blood sample.Carried using Flexi Gene DNA extraction kits (Qiagen)
The genomic DNA of blood sample is taken, and the genomic DNA quality obtained using the detection of standard agarose gel electrophoretic techniques,
Genomic DNA concentration is detected using NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA).Primary dcreening operation rank
The case group 1 of section and the genomic DNA concentration of control group 1 are 50ng/ μ l, the case group 2 of Qualify Phase, control group 2, case
The genomic DNA concentration of group 3 and control group 3 is 10-20ng/ μ l.
1st, Genotyping
Amplification is reacted including the DNA fragmentation including SNP site with PCR on ABI9700PCR instrument, to the PCR primer for obtaining
Single base extension is carried out after carrying out digestion reaction with shrimp alkaline phosphotase (shrimp alkal ine phosphatase, SAP)
Reaction, then the product to single base extension carries out purifying resin, finally to product utilization sequenom MassArray
Technology carries out Genotyping.
In primary dcreening operation stage, Qualify Phase 1 and Qualify Phase 2, expand including the genomic DNA fragment including rs2359536
Primer be F：ACGTTGGATGTCCATATCACCGTAGAACTC (SEQ ID No.1 in sequence table) and R：
ACGTTGGATGAGTTGCTTGTAAATCTGTGC (SEQ ID No.2), expands including the genomic DNA including rs10763170
The primer of fragment is F：ACGTTGGATGAGAACACCTCCATTCAGCAC (SEQ ID No.3) and R：
ACGTTGGATGGGGAAATAGAGTTATGGGAG (SEQ ID No.4), expands including the genomic DNA including rs17083838
The primer of fragment is F：ACGTTGGATGCACTTGCCATATCATAGCAC (SEQ ID No.5) and R：
ACGTTGGATGCAAGTTCCTTCTTTTAGAGAG(SEQ ID No.6).Single base extension primer is according to SNP in human genome
Site upstream and downstream (not including the SNP site) is designed, and last 1 nucleotides of Single base extension primer is corresponding in human genome
Preceding 1 nucleotides of the SNP site.The sequence of the Single base extension primer of rs2359536 is GTAGAACTCAACAGTGAAATA
(SEQ ID No.7)；The sequence of the Single base extension primer of rs10763170 is gaccATGCAGAAATCTACATTCCAAACC
(SEQ ID No.8)；The sequence of the Single base extension primer of rs17083838 is gttgAGAGAGTTTTCTGTGTCTAC (SEQ
ID No.9)。
The system that PCR reacts is prepared according to table 4, is reacted on ABI9700PCR instrument, reaction condition is：95 degrees Celsius
2min (predegeneration)；95 degrees Celsius of 30s, 56 degrees Celsius of 30s, 45 circulations；72 degrees Celsius of 60s；72 degrees Celsius of 5min；4 is Celsius
Degree is preserved.
Table 4, PCR reaction systems
| Reagent and its concentration | Volume (μ l) |
| Template DNA (10ng/ μ l) | 1 |
| Primers F (0.5 μM) | 0.5 |
| Primer R (0.5 μM) | 0.5 |
| 10 × Buffer (contains Mg2+) | 0.5 |
| MgCl2(25mM) | 0.4 |
| dNTPs(25mM) | 0.1 |
| Hotstar(5U/μl) | 0.1 |
| Ultra-pure water | 1.9 |
| Cumulative volume | 5 |
SAP digestion reaction systems are prepared, is carried out during the SAP digestion reactions system of 2 μ l is added into PCR primer obtained above
Reaction.The SAP digestion reaction systems of 2 μ l are：0.17 μ l, SAP Enzyme of SAP Buffer 0.3 μ l, the μ l of ultra-pure water 1.53.
The program of SAP digestion reactions is：37 degrees Celsius of 40min；85 degrees Celsius of 5min；4 degrees Celsius of holdings.
The system of single base extension is prepared according to table 5, the system that will be prepared adds SAP reactions obtained above to produce
In thing.
Table 5, single base extension system
| Reagent and its concentration | Volume (μ l) |
| Single base extension primer | 0.94 |
| Gold Buffer | 0.2 |
| Termination mix | 0.1 |
| Enzyme | 0.021 |
| Ultra-pure water | 0.739 |
| Cumulative volume | 2 |
Single base extension is carried out in ABI9700 instrument, and reaction condition is：
4 degrees Celsius of holdings
2nd, association analysis
2.1st, the primary dcreening operation stage
Before association analysis, quality control is carried out to blood sample and SNP levels：In the blood to case group and control group
In the quality control of sample, exclude sample parting success rate ＜ 97% and deviate the blood sample of law of inheritance, totally 34 (are
Control group sample)；It is higher than 6 blood samples of standard deviation of average value, totally 0 to exclude heterozygosis rate；Excluded using Plink softwares surplus
May be repeated in remaining sample or have akin sample, totally 9 (being control group sample)；In the quality control to SNP
In, exclude the site of SNP parting success rates ＜ 97%, totally 8021；Site of the gene frequency less than 3% is excluded, altogether
121268；Exclude the SNP site (P of the deviation law of genetic equilibrium in Hardy-Weinberg balance checks<1.0×10-5), altogether
1667.The matching degree of the principal component analysis (PCA) of crowd, inspection case group and control group is finally carried out, 64 matchings are removed
Abnormal blood sample (case group 5, control group 59).After this research is through quality control, finally included altogether in the primary dcreening operation stage
2788 normal healthy peoples (as shown in table 1) of 771 pituitary adenoma patients of case group and control group, finally include being located at for statistics
SNP on autosome has 720770.Finally to this totally 720770 SNPs carry out whole-genome association.
Statistical analysis：
The Analysis of quality control of system is realized by PLINK.It is right using the EIGENSTRAT softwares (Fig. 1) based on PCA methods
Sample population has carried out structural appraisal, and generates 20 main components to be corrected to potential people's sub-cluster structure.
Using the examination phase data after being corrected to principal component scores, by the logistic regression analyses of PLINK, list is have detected
Relation between individual SNP and pituitary adenoma.Afterwards, the P value figures of full-length genome are generated by Haploview；Drawn by R softwares
(Fig. 2, lambda value are 1.0157), in bright this research of Q-Q charts measured by each mononucleotide polymorphism site to have gone out Q-Q figures
The correlation distribution situation of value (y-axis) and predicted value (x-axis), genome coefficient of variation λ is 1.0157；And administrative division map is then application
LocusZoom generations.Inventor have detected the independent of single SNP by condition analysis.
2.2nd, Qualify Phase
In 2 independent Qualify Phases, inventor applies iPLEX platforms (Sequenom, San Diego, CA, USA),
From 17 uncorrelated genome areas in primary dcreening operation stage, 22 representational SNP are picked, and to its parting, and finally
Confirm 6 SNP (P of significance<0.05).
The allelic association analysis of Qualify Phase is also to be realized by PLINK.Fixed effect in being analyzed by meta
Model is answered, the result in primary dcreening operation stage, Qualify Phase 1 and Qualify Phase 2 is integrated (table 7).Apply Cochran ' s Q simultaneously
Heterogeneity between inspection, assessment data.Gene is filled up (genotype imputation)：Gene is carried out with SHAPEIT softwares
Type region division, and in the range of the upstream and downstream 1Mb centered on Tag SNP, integrated using IMPUTE2 softwares
Associated haplotype information in 1000Genomes Project Phase I, obtains more associated SNP positions (INFO>0.8,
MAF>0.03) further analyzing.
EQTL is analyzed：The brain tissue gene expression profile data that this Tag SNP site studied is set up with Ramasamy
(http://www.braineac.org/) integrated, with p after multiple correction<0.025 is statistical significance standard, enters one
The related hereditary variation site related to gene expression variation in step positioning Tag SNP site.
Finally three the SNP related to pituitary adenoma is determined by primary dcreening operation stage, Qualify Phase 1 and Qualify Phase 2
Point, these three SNP sites are respectively rs2359536, rs10763170 and rs17083838, the related letter of these three SNP sites
Breath can be from UCSC databases (http://genome.ucsc.edu/cgi-bin/hgGatewayHgsid=418821027_
PF1FvZWDySFVNQRE4aOAJLhPenAx obtained in), relevant information is shown in Table 6.The rs2359536 be given in the present invention etc.
Position gene is A and G, and the allele of the rs2359536 be given in UCSC databases is the allele on its complementary strand, i.e.,
T and C；The allele of the rs10763170 be given in the present invention is A and G, the rs10763170 be given in UCSC databases
Allele be allele on its complementary strand, i.e. T and C.
The OR values of rs2359536 are that 1.44, P values are 2.25 × 10-10；The OR values of rs10763170 are for 1.28, P values
6.88×10-10；The OR values of rs17083838 are that 1.37, P values are 1.89 × 10-8.Rs2359536, rs10763170 and
The genotype individuals number in case group and control group of rs17083838 is shown in Table 8, and genotype frequency is shown in Table 9, gene frequency
It is shown in Table 10.
Table 6, mononucleotide polymorphism site essential information
| SNP | Chromosomal region band | Position (BP) | Allele |
| rs2359536 | 10p12.31 | 20899608 | A/G |
| rs10763170 | 10q21.1 | 56777024 | A/G |
| rs17083838 | 13q12.13 | 26911112 | A/G |
Table 7, in pituitary adenoma 3 SNPs in primary dcreening operation and each phase authentication result and combined analysis result
Genotype individuals numbers of 8, three SNP of table in case group and control group
9, three genotype frequencies of the SNP in case group and control group of table
In three genotype of rs2359536, the individual ratio in case group of GG genotype is higher than it in control group
In ratio, the individual ratio in case group of AG genotype is higher than its ratio in control group, the individuality of AA genotype
Ratio in case group is less than its ratio in control group.In three genotype of rs10763170, AA and AG genotype
The individual ratio in case group be respectively higher than ratio of the corresponding genotype in control group, the individuality of GG genotype is in disease
Ratio in example group is less than its ratio in control group.In three genotype of rs17083838, AA and AG genotype
Ratio of the body in case group is respectively higher than ratio of the corresponding genotype in control group, and the individuality of GG genotype is in case group
In ratio be less than its ratio in control group.Show, rs2359536, rs10763170 and rs17083838 are and hang down
The related SNP site of body adenoma.
10, three gene frequencies of the SNP in case group and control group of table
Ratio of ratios of the allele G of rs2359536 in case group than the allele in control group is high
2.76%, the risk allele for showing rs2359536 is G.Ratio ratios of the allele A of rs10763170 in case group
Ratio of the allele in control group is high by 2.94%, and the risk allele for showing rs10763170 is A.rs17083838
Ratio of ratios of the allele A in case group than the allele in control group it is high by 1.99%, show
The risk allele of rs17083838 is A.
It is demonstrated experimentally that rs2359536, rs10763170 and rs17083838 examination pituitary adenoma patients can be utilized.
Claims (4)
1. the polymorphism of rs17083838 or the material of genotype are preparing examination pituitary adenoma patients product in detection human genome
Application in product；
The product includes the PCR primer and/or Single base extension of the genomic DNA fragment including rs17083838 including amplification
Primer；
The material of the polymorphism of rs17083838 or genotype is the PCR primer and/or described in the detection human genome
Single base extension primer.
2. application according to claim 1, it is characterised in that：The PCR primer is in sequence table shown in SEQ ID No.5
Single stranded DNA and sequence table in single stranded DNA shown in SEQ ID No.6；The Single base extension primer is SEQ in sequence table
Single stranded DNA shown in ID No.9.
3. the polymorphism of rs17083838 or the material of genotype are preparing detection pituitary adenoma neurological susceptibility in detection human genome
Application in product；
The product includes the PCR primer and/or Single base extension of the genomic DNA fragment including rs17083838 including amplification
Primer；
The material of the polymorphism of rs17083838 or genotype is the PCR primer and/or described in the detection human genome
Single base extension primer.
4. application according to claim 3, it is characterised in that：The PCR primer is in sequence table shown in SEQ ID No.5
Single stranded DNA and sequence table in single stranded DNA shown in SEQ ID No.6；The Single base extension primer is SEQ in sequence table
Single stranded DNA shown in ID No.9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155469.7A CN104762387B (en) | 2015-04-02 | 2015-04-02 | Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155469.7A CN104762387B (en) | 2015-04-02 | 2015-04-02 | Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104762387A CN104762387A (en) | 2015-07-08 |
| CN104762387B true CN104762387B (en) | 2017-05-17 |
Family
ID=53644477
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510155469.7A Active CN104762387B (en) | 2015-04-02 | 2015-04-02 | Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104762387B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937546A (en) * | 2018-01-04 | 2018-04-20 | 大连医科大学附属第二医院 | Applications of the circRAPGEF51 in pituitary adenoma biomarker |
-
2015
- 2015-04-02 CN CN201510155469.7A patent/CN104762387B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104762387A (en) | 2015-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ahmadian et al. | Analysis of the FHIT gene and FRA3B region in sporadic breast cancer, preneoplastic lesions, and familial breast cancer probands | |
| US20080286785A1 (en) | Method to predict or monitor the response of a patient to an erbb receptor drug | |
| Mastracci et al. | Genomic alterations in lobular neoplasia: a microarray comparative genomic hybridization signature for early neoplastic proliferationin the breast | |
| EP2949763A2 (en) | Consensus coding sequences of human breast cancers | |
| CN101679971A (en) | The decision method of progression risk of glaucoma | |
| CN111560428B (en) | Application of substance for detecting single nucleotide polymorphism of mitochondrial DNA rs3937033 | |
| EP2772540A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
| US20050255507A1 (en) | Cytogenetically determined diagnosis and prognosis of proliferative disorders | |
| CN104762387B (en) | Application of single nucleotide polymorphism rs17083838 in detection of pituitary adenoma | |
| Linjawi et al. | Tetra-primer ARMS PCR as an efficient alternative for SNPs detection in molecular diagnostic: A comparison study | |
| EP1848821B1 (en) | Polynucleotide associated with breast cancer comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for diagnosing breast cancer using the same | |
| KR20170051747A (en) | Single nucleotide polymorphism markers for determining of probability of skin wrinkle and use thereof | |
| CN104762388B (en) | Application of single nucleotide polymorphism rs10763170 in detection of pituitary adenoma | |
| CN104762389B (en) | Application of single nucleotide polymorphism rs2359536 in detection of pituitary adenoma | |
| CN108753970B (en) | Nonfunctional pituitary adenoma detection device and application | |
| CN108707548B (en) | Nonfunctional pituitary adenoma detection device and application | |
| KR102063486B1 (en) | Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population | |
| EP2584039A1 (en) | Snp for predicting the sensitivity to anticancer targeted therapeutic formulation | |
| KR102158715B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of OLFML2A gene | |
| KR102158721B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of RNF144A gene | |
| KR101883657B1 (en) | Method for providing the information for predicting or diagnosing of atrial fibrillation using single nucleotide polymorphism | |
| CN107446921B (en) | THSD7A gene sequence, expression change detection and application thereof in coronary heart disease prediction | |
| KR102110883B1 (en) | Kmt2c snp marker for diagnosis of mental disorder | |
| KR102063240B1 (en) | Novel SNP marker for pattern identification of lung cancer patients and uses thereof | |
| KR102254341B1 (en) | methods for diagnosing the high risk group of Diabetes based on Genetic Risk Score |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |