KR20170051747A - Single nucleotide polymorphism markers for determining of probability of skin wrinkle and use thereof - Google Patents

Abstract

The present invention relates to a skin wrinkle formation sensitivity diagnostic marker comprising one or more single base polymorphic markers selected from single base polymorphism (SNP) markers capable of judging skin wrinkle generation sensitivity, a probe capable of detecting the marker, A kit or a microarray comprising the composition, and a method for providing information for diagnosis of skin wrinkle generation sensitivity using the marker.
The single nucleotide polymorphic marker of the present invention is a marker capable of diagnosing the sensitivity of the skin wrinkle formation to each individual, and can give information on the accurate skin type to the individual. Thus, the skin characteristic of the cosmetic consumer can be scientifically classified And can be used to develop customized cosmetics for each skin characteristic.

Description

Single nucleotide polymorphism markers for diagnosis of skin wrinkle susceptibility and their use

The present invention relates to a composition comprising a single nucleotide polymorphism (SNP) marker capable of determining sensitivity to the occurrence of skin wrinkles, a probe capable of detecting the marker or a preparation capable of amplifying the marker, And a method for providing information for diagnosing the sensitivity of skin wrinkle generation using the marker.

The degree of wrinkles on the skin of a person, that is, the sensitivity to the occurrence of wrinkles, is affected by a variety of factors such as genetic factors, endocrine factors, and the environment in which the individual is present, such as collagen, elastin ), And the degree to which the extracellular matrix is reduced or transformed. Of these many factors, genetic factors are known to be the strongest determinant of sensitivity to wrinkles.

However, until now, the judgment of individual wrinkle degree and the like mainly grasps skin condition through simple skin test and skin test, and it is difficult to obtain complete trust in individual skin condition information.

For example, the method of measuring wrinkles by using an image analyzer system such as Primos using a replica simply represents the physical state of the skin surface by numerical value. In this case, There is a possibility that an error may be caused in evaluating the small improvement degree of the testee. In addition, in the case of the visual evaluation of the tester and the evaluation of the questionnaire by the tester, the subjective aspect greatly affects and it is difficult to evaluate the subject's skin condition objectively and precisely. In addition, these methods can measure wrinkles that already occur, but they have limitations in predicting individual wrinkle formation.

Therefore, there is almost no system to provide a customized cosmetics by precisely diagnosing the sensitivity of skin wrinkle formation by approaching with scientific grounds.

Under these circumstances, the inventors of the present invention have found a genetic characteristic that determines the sensitivity of skin wrinkle formation to human, developed a personalized custom active ingredient on the basis thereof, and contributed to the development of customized cosmetics for each skin gene. As a result, The present invention has been accomplished by selecting a single nucleotide polymorphic marker having a significant correlation with sensitivity and identifying a method for diagnosing the same.

One object of the present invention is to provide a single nucleotide polymorphism (SNP) marker capable of determining skin wrinkle generation sensitivity.

Another object of the present invention is to provide a composition for diagnosing skin wrinkle production sensitivity, which comprises a probe capable of detecting the marker for skin wrinkle formation sensitivity diagnosis or an agent capable of amplifying the probe.

Another object of the present invention is to provide a skin wrinkle formation sensitivity diagnostic kit or microarray comprising the composition for diagnosing sensitivity to skin wrinkle production.

It is another object of the present invention to provide a method for providing information for diagnosis of skin wrinkle generation sensitivity, which comprises identifying a polymorphic site of the single nucleotide polymorphism marker.

In one aspect of the present invention, the present invention provides a single nucleotide polymorphism (SNP) marker capable of determining skin wrinkle generation sensitivity.

In the present invention, the term " polymorphism " refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base differs from a polymorphism region to a single base polymorphism (single nucleotide polymorphism, SNP). The term " single nucleotide polymorphism marker " in the present invention means a polynucleotide comprising a sequence having a single nucleotide polymorphism, through which skin wrinkle generation sensitivity can be judged. Preferred polymorphic markers have two or more alleles exhibiting an incidence of 1% or more, more preferably 10% or 20% or more, in the selected population.

In the present invention, the term " allele " refers to various types of a gene existing at the same gene locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In the present invention, the term " rs_id " means rs-ID, which is an independent marker assigned to all SNPs initially registered by the NCBI that has started accumulating SNP information since 1998. [ The rs_id indicates the SNP marker of the present invention.

In the present invention, the term "skin wrinkle" refers to the degree of skin wrinkles of an individual to be measured or diagnosed, and particularly refers to the amount of wrinkles of the skin being large or small. The term " wrinkle sensitivity " It means the degree that can occur. The single nucleotide polymorphic marker of the present invention can be used to evaluate the skin wrinkle generation sensitivity of the individual by collecting a sample from a subject to be tested for sensitivity to skin wrinkle formation.

In a specific embodiment of the present invention, the present inventors used the expert evaluation after photographing (facial stage DM3, Minolta, Japan) on the basis of the visual assessment of the cosmetic evaluation method (KFDA standard) (7 points) and the lowest value (2 points), and classified as wrinkle-free skin with an average wrinkle grade of 6.69 and wrinkle-free skin with a wrinkle grade of 2, based on the naked eye evaluation.

Since the single nucleotide polymorphic marker of the present invention allows accurate measurement of the sensitivity of skin wrinkle formation, it can also provide information on the sensitivity of the skin contacted with the active ingredient to altered skin wrinkle formation. Specifically, for example, when the wrinkle grade is 7 or more, it can be judged that the skin is prone to wrinkles. It can be determined by using the single base polymorphism marker of the present invention without measuring the skin type of the subject using an image analysis machine or the like Can be measured and diagnosed more precisely.

Specifically, the single nucleotide polymorphism marker may be at least one single nucleotide polymorphism marker selected from the single nucleotide polymorphism markers shown in Table 3. More specifically, the single nucleotide polymorphism markers may include one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight Or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, May be a base polymorphism marker. The single nucleotide polymorphic markers shown in Table 3 above may be used to determine the degree of skin wrinkle formation sensitivity.

Whether the single nucleotide polymorphism marker of the present invention was diagnosed as a skin wrinkle formation sensitivity was determined by measuring the frequency of each marker. Such significance may be characterized by p-values such as less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001. Specifically, the p-value may be less than 0.01, and more specifically, the p-value may be less than 0.001, but is not limited thereto.

The marker for skin wrinkle formation sensitivity diagnosis comprises a polynucleotide comprising as a SNP the 26th base out of at least one base sequence selected from the group consisting of SEQ ID NOS: 1 to 20 and consisting of 5 to 51 consecutive DNA sequences, (I) the 26th base of SEQ ID NO: 1 is A or T, (ii) the 26th base of SEQ ID NO: 2 is A or C, (iii) the 26th nucleotide of SEQ ID NO: (Iv) the 26th base of SEQ ID NO: 4 is T or C, (v) the 26th base of SEQ ID NO: 5 is T or C, G or T; (vii) the 26th base of SEQ ID NO: 7 is G or A; (viii) the 26th base of SEQ ID NO: 8 is A or G; T, (x) the 26th base of SEQ ID NO: 10 is A or G, (xi) (Xii) the 26th base of SEQ ID NO: 12 is T or G, (xiii) the 26th base of SEQ ID NO: 13 is A or C, (xiv) the 26th base of SEQ ID NO: (Xvi) the 26th base of SEQ ID NO: 16 is T or C; (xvii) the 26th base of SEQ ID NO: 15 is C or T; T or C, (xviii) the 26th base of SEQ ID NO: 18 is C or A, and (xix) the 26th base of SEQ ID NO: 19 is C or T, Or < RTI ID = 0.0 > G, < / RTI >

Specifically, the skin color or blackening sensitivity diagnostic marker may be at least one, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 selected from the group consisting of SEQ ID NOS: Of the nucleotide sequences of SEQ ID NOs: 1 to 12, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 to 19, , Or a polynucleotide complementary to the polynucleotide.

The present inventors have confirmed through the following proof that the SNP is a marker for skin wrinkle formation sensitivity diagnosis.

Specifically, the skin with wrinkles with an average wrinkle grade of 6.69 and the wrinkle without wrinkles with a wrinkle grade of 2 had 13 cases with the highest value of the extremes, and 13 patients with the lowest values were the control (control ) (Table 2).

Next, genomic DNA (gDNA) was extracted from the saliva of the classified individuals, and SNPs having a significance in the skin wrinkle production sensitivity were sorted by comparing the sequence with the hg19 human genome reference as a control group 3 and 4). SNPs that can diagnose the degree of sensitization of skin wrinkles were first identified by the present inventors.

In another aspect, the present invention provides a composition for diagnosing skin wrinkle formation sensitivity comprising a probe capable of detecting the marker for skin wrinkle formation sensitivity diagnosis or an agent capable of amplifying the probe.

In the present invention, the term "probe capable of detecting a marker for skin wrinkle generation sensitivity sensitivity" means a composition capable of diagnosing sensitivity to skin wrinkle formation by specifically hybridizing with a polymorphic site of the above-mentioned gene The specific method of such gene analysis is not particularly limited, and may be by any gene detection method known in the art.

In the present invention, the term "agent capable of amplifying marker for skin wrinkle generation sensitivity sensitivity" means a composition capable of diagnosing sensitivity to skin wrinkle formation by amplifying the polymorphic site of the gene as described above, Means a primer capable of specifically amplifying the polynucleotide of the marker for skin wrinkle formation sensitivity diagnosis.

The primers used for the polymorphic marker amplification can be amplified using appropriate conditions in suitable buffers (e.g., four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotides that can serve as the starting point of synthesis. The appropriate length of the primer may vary depending on the purpose of use, and is usually, but not limited to, 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

The term "primer" in the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. PCR amplification can be performed to predict skin type through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The probes or primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution with an equivalent of one or more natural nucleotides, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In another aspect, the present invention provides a skin wrinkle formation sensitivity diagnostic kit comprising the composition for diagnosing sensitivity to skin wrinkle formation.

The kit may be an RT-PCR kit or a DNA chip kit.

The kit of the present invention can diagnose skin wrinkle generation sensitivity by confirming the SNP polymorphism marker which is a marker for skin wrinkle formation sensitivity diagnosis or by confirming the expression level of SNP polymorphism marker with the mRNA expression level.

As a specific example, the kit for measuring the mRNA expression level of the marker for skin wrinkle production sensitivity diagnosis in the present invention may be a kit containing essential elements necessary for performing RT-PCR. The RT-PCR kit contains test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq- Enzymes such as polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control. Also preferably, the kit of the present invention may be a skin wrinkle formation sensitivity diagnostic kit containing essential elements necessary for carrying out a DNA chip.

DNA chip kits are those in which nucleic acid species are attached in a gridded array on a generally flat solid support plate, typically a glass surface not larger than a slide for a microscope, and nucleic acids are uniformly arranged on the chip surface, Hybridization reaction occurs between the nucleic acid on the surface and the complementary nucleic acid contained in the solution treated on the surface of the chip to enable a mass parallel analysis.

In another aspect, the present invention provides a microarray for skin wrinkle formation sensitivity diagnosis comprising a polynucleotide of the marker for the skin wrinkle formation sensitivity diagnosis.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms.

The probe of the present invention can detect an allele and can be used for diagnosis of skin type and the like. The diagnostic methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 0 C may be suitable for allele-specific probe hybridization.

Immobilization on the substrate of the probe polynucleotide associated with the skin diagnosis of the present invention can also be easily made using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray and detecting The hybridization result can be detected by detecting the generated signal.

In another aspect, the present invention provides a method for amplifying a polynucleotide comprising: (a) amplifying or hybridizing a polymorphic site of the single nucleotide polymorphic marker from DNA obtained from a sample of the isolated individual; And (b) identifying the base of the amplified or hybridized polymorphic site of step (a). The present invention also provides a method for providing information for diagnosing skin wrinkle sensitivity.

The term "individual" of the present invention means a subject to be tested for diagnosis of skin wrinkle generation sensitivity. DNA can be obtained from the sample, such as hair, urine, blood, various body fluids, isolated tissues, isolated cells or saliva, but is not limited thereto.

The method of obtaining the genomic DNA of step (a) may be any method known to those skilled in the art.

The amplification of the polymorphic site of the single nucleotide polymorphic marker from the DNA obtained in step (a) or hybridization with the probe may be performed by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. USA 86, 1173 (1989)), self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA).

In order to determine the base of the polymorphic site of step (b), sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specifichybridization, DASH), PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio- But are not limited to, the BioRad system, the CEQ and SNPstream system (Beckman), the Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium assay) Do not. One or more of the alleles in a polymorphic marker can be identified, including microsatellite, SNP or other types of polymorphic markers, by such methods or by other methods available to those skilled in the art to which the invention pertains. The base of such a polymorphic site can be determined preferably through a SNP chip.

The term "SNP chip" in the present invention means one of DNA microarrays capable of confirming each base of several hundred thousand SNPs at a time.

The TaqMan method comprises the steps of: (1) designing and constructing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

In the above, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer. The allele-specific PCR means a PCR method in which a DNA fragment in which the SNP is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the SNP is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, In the case where the base at the SNP position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single base polymorphism is located is amplified by a pair of primers, and all nucleotides added to the reaction are deactivated by dephosphorylation, and SNP- specific extension primers, a dNTP mixture, a digoxin nucleotide, a reaction buffer, and a DNA polymerase to perform a primer extension reaction. At this time, the extension primer has a base immediately adjacent to the 5 'direction of the base in which the SNP is located at the 3' terminus, and the nucleic acid having the same base as the dodecoxynucleotide is excluded in the dNTP mixture, and the dodecoxynucleotide indicates the SNP Base type. For example, when dGTP, dCTP and dTTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer in the substituted base is extended by DNA polymerase, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the type of the base representing the SNP by comparing the lengths of the extended primers.

At this time, as a detection method, when the extension primer or the dideoxy nucleotide is fluorescence-labeled, the SNP is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 of ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the didyxin nucleotide are used, the SNP can be detected by measuring the molecular weight using MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The method for providing information for diagnosing sensitivity to skin wrinkle formation is not limited thereto, but it is preferable that at least one of the single nucleotide polymorphic markers among the nucleotide sequences identified in step (b) is a polynucleotide of SEQ ID NO: When the 26th base is A; In the polynucleotide of SEQ ID NO: 2, when the 26th base is A; In the polynucleotide of SEQ ID NO: 3, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T; In the polynucleotide of SEQ ID NO: 6, when the 26th base is G; In the polynucleotide of SEQ ID NO: 7, when the 26th base is G; In the polynucleotide of SEQ ID NO: 8, when the 26th base is A; In the polynucleotide of SEQ ID NO: 9, when the 26th base is T; In the polynucleotide of SEQ ID NO: 10, when the 26th base is G; In the polynucleotide of SEQ ID NO: 11, when the 26th base is T; In the polynucleotide of SEQ ID NO: 12, when the 26th base is G; In the polynucleotide of SEQ ID NO: 13, when the 26th base is A; In the polynucleotide of SEQ ID NO: 14, when the 26th base is C; In the polynucleotide of SEQ ID NO: 15, when the 26th base is C; 16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is T; In the polynucleotide of SEQ ID NO: 17, when the 26th base is C; In the polynucleotide of SEQ ID NO: 18, when the 26th base is A; In the polynucleotide of SEQ ID NO: 19, when the 26th base is C; Or determining that the polynucleotide of SEQ ID NO: 20 has high wrinkle production sensitivity when the 26th base is A, Specifically, the wrinkle generation sensitivity can be determined based on the visual class evaluated according to the method according to one embodiment of the present invention.

Further, in the polynucleotide described in SEQ ID NO: 1, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 2, when the 26th base is C; In the polynucleotide of SEQ ID NO: 3, when the 26th base is G; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is C; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is C; In the polynucleotide of SEQ ID NO: 6, when the 26th base is T; In the polynucleotide of SEQ ID NO: 7, when the 26th base is A; In the polynucleotide of SEQ ID NO: 8, when the 26th base is G; In the polynucleotide of SEQ ID NO: 9, when the 26th base is C; In the polynucleotide of SEQ ID NO: 10, when the 26th base is A; In the polynucleotide of SEQ ID NO: 11, when the 26th base is C; In the polynucleotide of SEQ ID NO: 12, when the 26th base is T; In the polynucleotide of SEQ ID NO: 13, when the 26th base is C; In the polynucleotide of SEQ ID NO: 14, when the 26th base is G; In the polynucleotide of SEQ ID NO: 15, when the 26th base is T; 16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is C; In the polynucleotide of SEQ ID NO: 17, when the 26th base is T; 18. The polynucleotide according to SEQ ID NO: 18, wherein the 26th base is C; In the polynucleotide described in SEQ ID NO: 19, when the 26th base is T; Or determining that the polynucleotide of SEQ ID NO: 20 has low wrinkle production sensitivity when the 26th base is G. [ Specifically, the wrinkle generation sensitivity can be determined based on the visual class evaluated according to the method according to one embodiment of the present invention.

The nucleotide sequence identified in step (b) may include at least one selected from the nucleotide sequences of SEQ ID NOS: 1 to 20, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 , 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more or 20 Lt; RTI ID = 0.0 > polymorphism < / RTI >

The single nucleotide polymorphic marker of the present invention is a marker capable of diagnosing the skin color or blackening sensitivity of each individual, and can give information on the accurate skin type to the individual. Thus, And can be used to develop customized cosmetics according to skin characteristics.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified in various forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example  1: Classification and gene sampling according to skin wrinkle sensitivity

The present inventors conducted an experiment on 300 healthy female women aged 30 to 50 years to establish criteria for judging skin wrinkle generation sensitivity by gene type and to develop a personalized active ingredient (Table 1) .

Clinical characteristics of the subjects Number of samples 300 Age (mean ± SD) 40.54 + - 4.34 female ( % ) 100% Smoking history ( % ) One% Skin Cancer History % ) 0%

If you are pregnant or breastfeeding or planning to become pregnant within 6 months, (2) you have used a skin contour containing steroids for at least one month to treat skin diseases, (3) you have not taken six months ⑤ If you have sensitive or sensitive skin, ⑤ If you have skin abnormalities such as dots, acne, erythema and capillary dilatation on the test site. ⑥ If you use the same or similar cosmetics or medicines (Eg, asthma, diabetes, hypertension, etc.), (9) have atopic dermatitis, and (9) have atopic dermatitis. ⑩ Other cases where the test was deemed difficult by the tester's decision, were excluded from the tester.

Next, 13 subjects with the highest value of the extremes were selected as the test cases and 13 subjects with the lowest values were selected as the control (control) based on the visual evaluation wrinkle grade of the subjects (Table 2) .

Wrinkled ( Experimental group ) Wrinkle less (control group) p -value Number of samples 13 13 Age, mean ± SD 40.7 ± 3.4 38.6 ± 1.9 0.072 Clinical score wrinkle 6.69 ± 0.48 2.00 ± 0.00 <0.001 ^ Pigmentation 2.92 ± 1.19 2.69 ± 1.38 0.614 ^ Skin hydration (a.u.) 47.25 + - 13.69 56.38 ± 13.22 0.096 Bright
Skin color Brightness ^* ) 63.27 + - 2.82 63.39 + - 3.36 0.801 ^ The degree of redness ^* ) 8.93 ± 2.00 7.94 ± 1.70 0.169 ^ Yellow degree (b ^* ) 17.37 ± 1.13 18.47 ± 1.55 0.049 ITA  ° 37.06 + - 6.92 35.64 8.42 0.880 ^ Dark
Skin color
Brightness ^* ) 58.62 ± 3.09 57.55 + - 3.80 0.437 The degree of redness ^* ) 11.24 + - 1.65 11.62 + - 1.74 0.572 Yellow degree (b ^* ) 17.92 ± 2.18 16.93 ± 1.90 0.223 ^ ITA  ° 25.59 + - 8.55 23.82 ± 12.15 0.840 ^

p-value : significance by individual t-test (p <0.05), ^: Mann-Whitney test.

The degree of wrinkling of the subject was determined by a visual inspection by a specialist after the photography (facial stage DM3, Minolta, Japan) based on the visual assessment of the cosmetic evaluation method (KFDA standard) (7 points) and the lowest value (2 points) were classified as wrinkled skin with an average wrinkle grade of 6.69 and wrinkled skin with a wrinkle grade of 2. Grades of wrinkled skin and less wrinkled skin were repeatedly measured and their mean values were calculated.

The ITA value reflects the whiteness of the skin. The ITA value can be calculated using the L ^* value indicating the skin brightness and the b ^* value (melanization parameter) indicating the degree of melanin. The ITA value calculation formula is as follows. In particular, the larger the value of ITA °, the brighter the skin color (ITA ° = [Arc tan (L ^* - 50) / b ^* ] x 180 / π), L ^* : Brightness factor; Brightness, b ^* : color factor; Blue - yellow). The skin color (L ^* , a ^* , b ^* ) was measured using a Minolta spectrophotometer (CM2600d, Minolta, Japan). The skin of the bright area and the skin of the dark area were repeatedly measured and their average values were calculated. The classification of skin moisturizing was measured using a moisture meter, Corneometer CM825 (C + K, Germany). Skin moisturization was repeatedly measured and the mean value was calculated. Skin measurement data were statistically treated by independent t-test ( p <0.05) and Mann-Whitney test using SPSS software (Ver. 22.0).

Example  2. From saliva  DNA sampling

Twenty-six saliva samples were collected through Example 1. The saliva was collected twice, and the first saliva was collected after the subject was fasted one hour before harvesting, and the second saliva was obtained immediately after the morning wake.

High purity genomic DNA (gDNA) was extracted from the saliva of the subject using an Oragene® saliva kit. Then, an intact gDNA band having an OD 260/280> 1.7, 10 ng / ㎕ or more in a 1 x TAE 1% agarose gel was identified, and a gene analysis experiment was conducted.

Example  3. Whole genome sequencing.

50 ng of the gDNA isolated in Example 2 was used for target amplification according to the manual of Ion AmpliSeq Exome kit (Life Technologies).

The Ion Torrent adapter-ligated library was then constructed according to the Ion AmpliSeq ™ Library 2.0 (Life Technologies) protocol (Part # 4475345 Rev. B). Each of the amplicons was partially digested primer sequences and ligated to Ion Torrent adapters P1 and A using DNA ligase.

Then, the library was separated using an AMPure bead (Beckman Coulter). Library Quantification Kit (LifeTechnologies) and Agilent High Sensitivity DNA Kit (Agilent Technologies) were used to evaluate the quantity and quality of each of the separate libraries.

Emulsion PCR was performed using Ion PI Template OT2 200 kit v2 and OneTouch 2 instrument (Life Technologies). Enrichment of template-positive ion spheres (ISP) on the Ion PI chip was performed using the Ion OneTouch ES enrichment system (Life Technologies). Ion PI chips were prepared and loaded according to the manual. We used the Ion Torrent platform-specific pipeline software (Torrent Suite v4.0) to align sequences with the hg19 human genome reference, perform target-region coverage analysis, and filter and remove poor signal reads.

Example  4. Bioinformatics analysis and statistical processing

Sequence alignment with human genome reference (hg19) was performed using TMAP (Torrent Suite version: 4.0.2).

Base quality recalibration, indel realignment and variant calling were performed using GATK (Genome Analysis Toolkit, version: 2.3.9). Variations were annotated using the SnpEff program (http://snpeff.sourceforge.net/) (ref. Snpeff) and the databases of the 1000 Genomes Project and NCBI dbSNP. We also analyzed all possible non-synonymous single-nucleotide variants (nsSNVs) in the whole-exome region using the dbNSFP database (https://sites.google.com/site/ jpopgen / dbNSFP) (ref. DbNSFP).

In order to filter the short read, if the quality scorer was less than 9 at the window size of 30, one base pair at the end of the short read sequence was removed. After SNP calling, heterozygous SNPs with a depth of < 10 and homozygous SNPs with a depth of < 5 were filtered.

SNPs with minor allele frequency (MAF) of <5% and SNPs with a call rate of <95% were tested for SNP quality control using the PLINK program (http://pngu.mgh.harvard.edu/) ~ purcell / plink) (Ver 1.07) (ref. plink). After SNP filtering, we analyzed the relationship between skin color and SNP that passed through filtering using logistic regression additive model (one degree of freedom).

As a result, a total of 423 SNPs showed high significance, among which SETDB1, CERS2, SETDB1, TCEB1, KRT40, CD300LF, ACER1, PLEK, OR4C6, OR5T2, GPR101, MRPS30, TOMM34, EFHD2, TNFRSF11A, TTLL12, PADI4, And the top 20 SNPs present in the HORMAD1 gene were selected (Table 3). Table 4 shows the flanking sequences of the top 20 SNPs.

Top 20 SNPs Chr . Position Func . Gene rs  Number Alleles (A / B) RA RAF OR P Case Control chrl 150923774 intron SETDB1 rs2124952 A / T A 0.42 0.12 18.33 0.004052 chrl 150939744 intron CERS2 rs11204750 A / C A 0.42 0.12 18.33 0.004052 chrl 150940357 splice site CERS2 rs6656535 T / G T 0.42 0.12 18.33 0.004052 chrl 150940358 splice site CERS2 rs59988025 T / C T 0.42 0.12 18.33 0.004052 chrl 150941381 down SETDB1 rs752376 T / C T 0.42 0.12 18.33 0.004052 chr8 74859123 intron TCEB1 rs55903314 G / T G 0.42 0.12 18.33 0.004052 chr17 39135369 intron KRT40 rs75202326 G / A G 0.38 0.08 18.33 0.004052 chr17 72700943 missense CD300LF rs35489971 A / G A 0.38 0.08 18.33 0.004052 chr19 6312290 missense ACER1 rs72981971 C / T T 0.88 0.54 0.05852 0.004652 chr2 68613710 syn PLEK rs2070171 A / G G 0.92 0.58 0.05934 0.004929 chr11 55433040 missense OR4C6 rs11230600 C / T T 0.85 0.5 0.0394 0.006723 chr11 56000600 missense OR5T2 rs3919907 T / G G 0.85 0.5 0.0394 0.006723 chr23 136113464 missense GPR101 rs1190736 A / C A 0.5 0.15 25.38 0.006723 chr5 44809162 missense MRPS30 rs3747479 G / C C 0.81 0.35 0.1238 0.00933 chr20 43567442 down (4,311) TOMM34 rs6073572 C / T C 0.65 0.19 8.08 0.00933 chrl 15755248 3'UTR EFHD2 rs3765372 T / C T 0.38 0.12 11.11 0.009694 chr18 60028858 intron TNFRSF11A rs17069895 T / C C 0.88 0.62 0.09 0.009694 chr22 43575774 intron TTLL12 rs138945 C / A A 0.88 0.62 0.09 0.009694 chrl 17662804 intron PADI4 rs1748032 C / T C 0.69 0.23 7.244 0.009891 chrl 150679033 missense HORMAD1 rs1336900 A / G A 0.35 0.08 12.38 0.009929

Abbreviations: Chr., Chromosome; Func, SNP function (fuction); Frq, frequency; RA, risk allele; OR, odds ratio.

See NCBI build 37 for genome location.

In the experimental group-control analysis, the p-value was calculated using logistic regression.

In Alleles (A / B), A represents minor allele and B represents major allele.

RA is a base that is predominant in wrinkled skin.

gene rs  Number                     Flanking sequence SETDB1 rs2124952 forward AGAGAACAAAAATAACACAATACAC [A / T] TGTACCCAAGGTTGCTCAGTGTGGC (SEQ ID NO: 1) CERS2 rs11204750 forward CCAGCTCTCACTATGCCTTCTTACC [A / C] CTTGCCTTTGGTTCCCCATATACCA (SEQ ID NO: 2) CERS2 rs6656535 forward CAGGTAAAATGTGAATCTCCAGCTG [G / T] CAGAGGAAGCAGAAATGGCTAGGTC (SEQ ID NO: 3) CERS2 rs59988025 forward AGGTAAAATGTGAATCTCCAGCTGG [C / T] AGAGGAAGCAGAAATGGCTAGGTCA (SEQ ID NO: 4) SETDB1 rs752376 forward CAACAGGGGAAGGCATGAGGGTAGG [C / T] TGGCATGCTTACAGCTCAAAGAAGT (SEQ ID NO: 5) TCEB1 rs55903314 forward TCCTCCAAATTCATATGTTGAAGTC [G / T] TAACCCCTTGTACCACAGAATGTGG (SEQ ID NO: 6) KRT40 rs75202326 forward AATTCCTGCTTACCCTTTTCTAGCT [A / G] TGTGACCACTGGCAAATTATTTAGC (SEQ ID NO: 7) CD300LF rs35489971 forward TGTTGTTGGACCGGTGATTTGAGTG [A / G] CAATGGAGTAGCCTGGAAAACACAA (SEQ ID NO: 8) ACER1 rs72981971 forward AAGCTGAGCGTCATGTGGAAATACA [C / T] GGAGAACAGGCCTGCAGCGGCAAGG (SEQ ID NO: 9) PLEK rs2070171 forward AGGAAGGCCTCATGATTGCTTCATC [A / G] CTGCTCAATGAGGGGTATCTGCAGC (SEQ ID NO: 10) OR4C6 rs11230600 forward TGTAAGCCCCTGCACTACACGATCA [C / T] CATGAGTCCACGGGTGTGCTGCCTA (SEQ ID NO: 11) OR5T2 rs3919907 reverse CCCTTGAGTCATGGTGTTGTTCATT [A / C] TTTTTGTCATAATATGAACTGTAAC (SEQ ID NO: 12) GPR101 rs1190736 forward GACAAGTAGCGATCCACTGACACCA [A / C] GACAATGGTGTTGACGCTGGCGAAG (SEQ ID NO: 13) MRPS30 rs3747479 forward GCCGCCACGGCTACAGAAACGACCT [C / G] CCAAGACGTCGCGGCGACCCCCGTC (SEQ ID NO: 14) TOMM34 rs6073572 forward GAGCCCGGGAGAAGCTGTAAGGAAA [C / T] AGGCAGGGACTGACTTTCACAAACA (SEQ ID NO: 15) EFHD2 rs3765372 forward GGGGCTGCAGCCGACCGCCCTGCTC [C / T] GGCCCCAGTGTGGTGGGCGAGGGTG (SEQ ID NO: 16) TNFRSF11A rs17069895 forward TGATTTACCGGGATTTGTTTTTCAA [C / T] TGCGTAAAATTAAAGAATCTTACT (SEQ ID NO: 17) TTLL12 rs138945 forward GTCACCTCCTCTGTGCCAAGACATG [A / C] GTGCCCATCAGAGGGGGTGACGGGA (SEQ ID NO: 18) PADI4 rs1748032 reverse AGTTAACACGGAATACGTGGGACAG [A / G] CCAGCATTTGCCCCATCACCACAAG (SEQ ID NO: 19) HORMAD1 rs1336900 forward TAACTCTTGAAATACACTTACACTT [A / G] TATAATGCTCCTGTTCATCTTCTAC (SEQ ID NO: 20)

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the spirit and scope of the present invention as defined by the appended claims.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Single nucleotide polymorphism markers for determining of          probability of skin wrinkle and use thereof <130> KPA151119-KR <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2124952 <400> 1 agagaacaaa aataacacaa tacacwtgta cccaaggttg ctcagtgtgg c 51 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11204750 <400> 2 ccagctctca ctatgccttc ttaccmcttg cctttggttc cccatatacc a 51 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6656535 <400> 3 caggtaaaat gtgaatctcc agctgkcaga ggaagcagaa atggctaggt c 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs59988025 <400> 4 aggtaaaatg tgaatctcca gctggyagag gaagcagaaa tggctaggtc a 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs752376 <400> 5 caacagggga aggcatgagg gtaggytggc atgcttacag ctcaaagaag t 51 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs55903314 <400> 6 tcctccaaat tcatatgttg aagtcktaac cccttgtacc acagaatgtg g 51 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs75202326 <400> 7 aattcctgct tacccttttc tagctrtgtg accactggca aattatttag c 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs35489971 <400> 8 tgttgttgga ccggtgattt gagtgrcaat ggagtagcct ggaaaacaca a 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs72981971 <400> 9 aagctgagcg tcatgtggaa atacayggag aacaggcctg cagcggcaag g 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2070171 <400> 10 aggaaggcct catgattgct tcatcrctgc tcaatgaggg gtatctgcag c 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11230600 <400> 11 tgtaagcccc tgcactacac gatcaycatg agtccacggg tgtgctgcct a 51 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3919907 <400> 12 cccttgagtc atggtgttgt tcattmtttt tgtcataata tgaactgtaa c 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1190736 <400> 13 gacaagtagc gatccactga caccamgaca atggtgttga cgctggcgaa g 51 <210> 14 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3747479 <400> 14 gccgccacgg ctacagaaac gacctsccaa gacgtcgcgg cgacccccgt c 51 <210> 15 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6073572 <400> 15 gagcccggga gaagctgtaa ggaaayaggc agggactgac tttcacaaac a 51 <210> 16 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3765372 <400> 16 ggggctgcag ccgaccgccc tgctcyggcc ccagtgtggt gggcgagggt g 51 <210> 17 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs17069895 <400> 17 tgatttaccg ggatttgttt ttcaaytgcg taaaattaaa gaatctttac t 51 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs138945 <400> 18 gtcacctcct ctgtgccaag acatgmgtgc ccatcagagg gggtgacggg a 51 <210> 19 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1748032 <400> 19 agttaacacg gaatacgtgg gacagrccag catttgcccc atcaccacaa g 51 <210> 20 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1336900 <400> 20 taactcttga aatacactta cacttrtata atgctcctgt tcatcttcta c 51

Claims (11)

A marker for detecting skin wrinkle formation sensitivity comprising at least one single nucleotide polymorphism marker selected from single nucleotide polymorphism (SNP) markers shown in Table 3.
The skin wrinkle production sensitivity marker according to claim 1, wherein the marker for skin wrinkle formation sensitivity diagnosis comprises at least one of the at least one base sequence selected from the group consisting of SEQ ID NOS: 1 to 20, wherein the 26th base is SNP and comprises 5 to 51 consecutive DNA sequences Polynucleotide, or polynucleotide complementary thereto,
(i) the 26th base of SEQ ID NO: 1 is A or T,
(ii) the 26th base of SEQ ID NO: 2 is A or C,
(iii) the 26th base of SEQ ID NO: 3 is T or G,
(iv) the 26th base of SEQ ID NO: 4 is T or C,
(v) the 26th base of SEQ ID NO: 5 is T or C,
(vi) the 26th base of SEQ ID NO: 6 is G or T,
(vii) the 26th base of SEQ ID NO: 7 is G or A,
(viii) the 26th base of SEQ ID NO: 8 is A or G,
(ix) the 26th base of SEQ ID NO: 9 is C or T,
(x) the 26th base of SEQ ID NO: 10 is A or G,
(xi) the 26th base of SEQ ID NO: 11 is C or T,
(xii) the 26th base of SEQ ID NO: 12 is T or G,
(xiii) the 26th base of SEQ ID NO: 13 is A or C,
(xiv) the 26th base of SEQ ID NO: 14 is G or C,
(xv) the 26 &lt; th &gt; base of SEQ ID NO: 15 is C or T,
(xvi) the 26th base of SEQ ID NO: 16 is T or C,
(xvii) the 26th base of SEQ ID NO: 17 is T or C,
(xviii) the 26th base of SEQ ID NO: 18 is C or A,
(xix) the 26th base of SEQ ID NO: 19 is C or T,
(xx) the 26 &lt; th &gt; base of SEQ ID NO: 20 is A or G
Markers for skin wrinkle formation sensitivity diagnosis.
A composition for diagnosing skin wrinkle formation sensitivity comprising a probe capable of detecting a marker for skin wrinkle formation sensitivity diagnosis of claim 1 or 2 or an agent capable of amplifying the same.
A kit for the diagnosis of skin wrinkle formation sensitivity comprising the composition of claim 3.
5. The kit for diagnosing skin wrinkle formation sensitivity according to claim 4, wherein the kit is an RT-PCR kit or a DNA chip kit.
A microarray for skin wrinkle formation sensitivity diagnosis comprising the polynucleotide of claim 1 or 2.
(a) amplifying or hybridizing a polymorphic site of the single base polymorphic marker of claim 1 or 2 from a DNA obtained from a sample of a separated individual; And
(b) identifying the base of the amplified or hybridized polymorphic site of step (a).
8. The method according to claim 7, wherein at least one single base polymorphism marker among the nucleotide sequences identified in step (b)
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 2, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 7, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 14, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is C;
16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is T;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 18, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 19, when the 26th base is C; or
Wherein the polynucleotide of SEQ ID NO: 20 is judged to be highly susceptible to wrinkle formation when the 26th base is A. A method for providing information for diagnosis of skin wrinkle formation sensitivity,
8. The method according to claim 7, wherein at least one single base polymorphism marker among the nucleotide sequences identified in step (b)
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 2, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is C;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 7, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 14, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is T;
16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is C;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is T;
18. The polynucleotide according to SEQ ID NO: 18, wherein the 26th base is C;
In the polynucleotide described in SEQ ID NO: 19, when the 26th base is T; or
20. A method of providing information for diagnosis of skin wrinkle formation sensitivity, comprising the step of judging that the polynucleotide of SEQ ID NO: 20 has low wrinkle production sensitivity when the 26th base is G.
8. The method of claim 7, wherein the sample is hair, urine, blood, various body fluids, isolated tissue, isolated cells or saliva.
8. The method of claim 7, wherein amplification and identification of the polymorphic site utilizes a SNP chip.