KR102585879B1 - Single nucleotide polymorphism markers for determining of probability of skin hydration and use thereof - Google Patents

Abstract

The present invention provides a marker for diagnosing the degree of skin moisturization, including one or more single nucleotide polymorphism markers selected from single nucleotide polymorphism (SNP) markers that can determine the degree of skin moisturization, a probe that can detect the marker, or a probe that can amplify the marker. It relates to a composition containing an agent, a kit or microarray containing the composition, and a method of providing information for diagnosing the level of skin moisture using the marker.
The single nucleotide polymorphism marker of the present invention is a marker that can diagnose the level of skin moisturization for each individual, and can provide information on the exact skin type of the individual, through which the skin characteristics of cosmetic consumers can be scientifically classified. It can be used to develop customized cosmetics for each skin characteristic.

Description

Single nucleotide polymorphism markers for determining probability of skin hydration and use thereof}

The present invention relates to a single nucleotide polymorphism (SNP) marker capable of determining an individual's skin moisturizing state, a composition containing a probe capable of detecting the marker or an agent capable of amplifying the same, and a composition containing the composition. It relates to a kit or microarray and a method of providing information for diagnosis of skin hydration status using the marker.

The degree of moisturization of an individual's skin, that is, the degree to which the skin is moist or dry, is determined by various factors such as genetic factors, endocrine factors, and the environment in which the individual is located. Natural moisturizing factors present in the keratinocytes of the individual's skin It is known to be determined by natural moisturizing factor (NMF), the amount of ceramide, the activity of aquaporin, or the firmness of the tight junction connecting keratinocytes. Among these various factors, genetic factors are known to be the most powerful determinant of the degree of skin hydration.

However, to date, the judgment of an individual's level of moisturization is mainly based on determining the skin condition through a simple skin questionnaire and simple skin test, and this method makes it difficult to obtain complete trust in the information on the individual's skin condition.

For example, the method of measuring the amount of skin moisture using a corneometer simply quantifies the physical state of the skin surface. In this case, the moisture level may vary depending on the measuring program. There is a risk of error occurring in evaluating the test subject's small degree of improvement. In addition, in the case of the tester's visual evaluation and the test subject's questionnaire evaluation, subjective aspects play a large role, making it difficult to objectively and precisely evaluate the test subject's skin condition. Additionally, although these methods can measure the current moisturizing state, there are limitations in predicting an individual's moisturizing state.

Therefore, it can be said that a system that accurately diagnoses the level of skin hydration and provides customized cosmetics based on scientific evidence is almost unheard of.

Against this background, the present inventors identified the genetic characteristics that determine the level of human skin moisturization, developed personalized active ingredients based on this, and made diligent efforts to contribute to the development of customized cosmetics for each skin gene. The present invention was completed by selecting single nucleotide polymorphism markers with positive correlation and confirming a method for diagnosing them.

One purpose of the present invention is to provide a single nucleotide polymorphism (SNP) marker that can determine the degree of skin moisturization.

Another object of the present invention is to provide a composition for diagnosing the level of skin moisturization, which includes a probe capable of detecting the marker for diagnosing the level of skin moisturization or an agent capable of amplifying it.

Another object of the present invention is to provide a kit or microarray for diagnosing the level of skin moisture, including the composition for diagnosing the level of skin moisture.

Another object of the present invention is to provide a method of providing information for diagnosing the level of skin moisture, including the step of confirming the polymorphic site of the single nucleotide polymorphism marker.

As an aspect for achieving the above object, the present invention provides a single nucleotide polymorphism (SNP) marker that can determine the degree of skin moisturization.

In the present invention, the term "polymorphism" refers to the presence of two or more alleles at one genetic locus. Among the polymorphic sites, only a single base differs from person to person, and is referred to as a single nucleotide polymorphism. It is called a (single nucleotide polymorphism, SNP). In the present invention, the term “single nucleotide polymorphism marker” refers to a polynucleotide containing a sequence having a single nucleotide polymorphism, through which the degree of skin moisturization can be determined. Preferred polymorphic markers have two or more alleles with an occurrence frequency of 1% or more, more preferably 10% or 20% or more in the selected population.

In the present invention, the term “allele” refers to several types of one gene that exist at the same genetic locus on a homologous chromosome. Alleles are also used to represent polymorphisms, for example, a SNP has two types of alleles (bialleles).

In the present invention, the term "rs_id" refers to rs-ID, an independent marker assigned to all SNPs initially registered by NCBI, which began accumulating SNP information in 1998. The rs_id refers to the SNP marker of the present invention.

In the present invention, the term "skin moisturization" refers to the degree of skin moisturization of the subject to be measured or diagnosed, and specifically refers to the amount of moisture in the skin. The term "skin moisturization degree" refers to the amount of moisture in the skin due to endogenous or exogenous factors. It means the degree of existence. The single nucleotide polymorphism marker of the present invention can evaluate the degree of skin moisturization of an individual by collecting a sample from the individual for whom the degree of skin moisturization is to be measured.

In a specific embodiment of the present invention, the present inventors classified the level of moisturization of the test subject based on the moisture content measured using Corneometer CM825 (C+K, Germany), a moisture measurement device, and a CM value of 34 or less indicates low moisture content. Dry skin, with a CM value of 78 or higher, was classified as moisturized skin with a lot of moisture.

Since the single nucleotide polymorphism marker of the present invention allows accurate measurement of the degree of skin moisturization, it can also provide information about the changed degree of skin moisturization of the skin in contact with the active ingredient. Specifically, for example, a CM value of 34 or less can be judged as dry skin with little moisture, and a CM value of 78 or more can be judged as moisturized skin with a lot of moisture, and this can be done without measuring the skin type of the test subject using a coniometer, etc. , can be measured and diagnosed more precisely using the single nucleotide polymorphism marker of the present invention.

Specifically, the single nucleotide polymorphism marker may be one or more single nucleotide polymorphism markers selected from the single nucleotide polymorphism markers shown in Table 3. More specifically, the single nucleotide polymorphism marker is 1 or more types, 2 or more types, 3 or more types, 4 or more types, 5 or more types, 6 or more types, 7 or more types, and 8 types selected from the single nucleotide polymorphism markers shown in Table 3. or more, 9 or more species, 10 or more species, 11 or more species, 12 or more species, 13 or more species, 14 or more species, 15 or more species, 16 or more species, 17 or more species, 18 or more species, 19 or more species, or 20 or more species. It may be a nucleotide polymorphism marker. The single nucleotide polymorphism marker shown in Table 3 may be used to determine the degree of skin moisturization.

The diagnosis of the degree of skin moisturization by the single nucleotide polymorphism marker of the present invention was determined by measuring the frequency of each marker. Such significance may be characterized by a p-value, such as a p-value of less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001. Specifically, the p-value may be less than 0.01, and more specifically, the p-value may be less than 0.001, but is not limited thereto.

The marker for diagnosing the degree of skin moisturization is a polynucleotide consisting of 5 to 51 consecutive DNA sequences and including the 26th base as a SNP among one or more base sequences selected from the group consisting of SEQ ID NOs: 1 to 20, or a polynucleotide complementary thereto. Containing a polynucleotide, (i) the 26th base of SEQ ID NO: 1 is C or G, (ii) the 26th base of SEQ ID NO: 2 is C or T, (iii) the 26th base of SEQ ID NO: 3 is G or T, (iv) the 26th base of SEQ ID NO: 4 is A or G, (v) the 26th base of SEQ ID NO: 5 is C or T, (vi) the 26th base of SEQ ID NO: 6 is G or T, (vii) the 26th base of SEQ ID NO: 7 is A or G, (viii) the 26th base of SEQ ID NO: 8 is A or G, (ix) the 26th base of SEQ ID NO: 9 is A or C and (x) the 26th base of SEQ ID NO: 10 is T or C, (xi) the 26th base of SEQ ID NO: 11 is A or G, (xii) the 26th base of SEQ ID NO: 12 is G or C, (xiii) the 26th base of SEQ ID NO: 13 is G or A, (xiv) the 26th base of SEQ ID NO: 14 is C or A, (xv) the 26th base of SEQ ID NO: 15 is C or A, (xvi ) The 26th base of SEQ ID NO: 16 is G or A, (xvii) the 26th base of SEQ ID NO: 17 is A or G, (xviii) the 26th base of SEQ ID NO: 18 is A or G, (xix) sequence The 26th base of number 19 is A or G, and (xx) the 26th base of SEQ ID NO: 20 is G or A, which may be a marker for diagnosing the level of skin moisturization.

Specifically, the marker for diagnosing the level of skin moisture is 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more selected from the group consisting of SEQ ID NOs: 1 to 20, Among 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, or 20 base sequences, the 26th base is included as a SNP and consists of 5 to 51 consecutive DNA sequences. It may include a polynucleotide or a polynucleotide complementary thereto.

The present inventors confirmed that the SNP is a marker for diagnosing skin moisturization level through the following verification.

Specifically, the moisturization level of the test subjects was measured as a control group, with a CM value of 34 or less being dry skin with little moisture, and a CM value of 78 or more being moisturizing skin with a lot of moisture. People were classified into the experimental group (case) (Table 2).

Next, genomic DNA (gDNA) was extracted from the saliva of the classified individuals, and the sequence was aligned and compared with the control hg19 human genome reference to classify SNPs with significance in the degree of skin moisturization (Table 3 ). The SNP that can diagnose the level of skin moisturization was first identified by the present inventors.

In another aspect, the present invention provides a composition for diagnosing the level of skin moisturization, including a probe capable of detecting the marker for diagnosing the level of skin moisturization or an agent capable of amplifying the same.

In the present invention, the term "probe capable of detecting a marker for diagnosing the level of skin moisturization" refers to a composition that can diagnose the level of skin moisturization by specifically confirming it through a hybridization reaction with the polymorphic region of the above gene. The specific method of analyzing the same gene is not particularly limited, and may be any gene detection method known in the technical field to which this invention pertains.

In the present invention, the term "agent capable of amplifying a marker for diagnosing the level of skin moisturization" refers to a composition that can diagnose the level of skin moisturization by confirming the polymorphic site of the above gene through amplification, preferably the skin This refers to a primer that can specifically amplify the polynucleotide of a marker for diagnosing the level of moisturization.

Primers used for amplification of the polymorphic marker are template-directed DNA under appropriate conditions (e.g., four different nucleoside triphosphates and DNA, a polymerizer such as RNA polymerase or reverse transcriptase) in an appropriate buffer and appropriate temperature. It may be a single-stranded oligonucleotide that can act as a starting point for synthesis. The appropriate length of the primer may vary depending on the purpose of use, and is not limited thereto, but may typically be 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize to the template.

In the present invention, the term "primer" is a base sequence having a short free 3' terminal hydroxyl group, which can form a base pair with a complementary template and serves as a starting point for copying the template strand. It refers to a short sequence that functions as a point. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. By performing PCR amplification, skin type can be predicted by whether or not the desired product is produced. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art.

The probe or primer of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsation,” substitution of one or more homologs of the native nucleotide, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidate, carbamate, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).

In another aspect, the present invention provides a kit for diagnosing the level of skin moisturization, including the composition for diagnosing the level of skin moisturization.

The kit may be an RT-PCR kit or a DNA chip kit.

The kit of the present invention can diagnose the degree of skin moisturization by confirming the SNP polymorphism marker, which is a marker for diagnosing the degree of skin moisturization, through amplification, or by checking the expression level of mRNA for the expression level of the SNP polymorphism marker.

As a specific example, in the present invention, a kit for measuring the mRNA expression level of a marker for diagnosing skin moisturization may be a kit containing the essential elements required to perform RT-PCR. The RT-PCR kit consists of a test tube or other suitable container, reaction buffer (pH and magnesium concentration varying), deoxynucleotides (dNTPs), Taq-polymer, and a test tube or other suitable container, in addition to each primer pair specific for the gene of a diagnostic marker for skin moisturization. It may include enzymes such as enzymes and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterilized water, etc. It may also include a pair of primers specific to the gene used as a quantitative control. Also preferably, the kit of the present invention may be a kit for diagnosing the level of skin moisturization that includes the essential elements necessary to perform a DNA chip.

A DNA chip kit is a device in which nucleic acid species are attached in a gridded array to a generally flat solid support plate, typically a glass surface no larger than a microscope slide. Nucleic acids are uniformly arranged on the chip surface, forming a DNA chip. It is a tool that enables massively parallel analysis by causing multiple hybridization reactions between the nucleic acids on the chip and the complementary nucleic acids contained in the solution treated on the chip surface.

In another aspect, the present invention provides a microarray for diagnosing the level of skin moisturization including polynucleotides of the marker for diagnosing the level of skin moisturization.

The microarray may include DNA or RNA polynucleotides. The microarray consists of a conventional microarray except that the probe polynucleotide includes the polynucleotide of the present invention.

Methods for manufacturing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid. The probe of the present invention is an allele-specific probe, in which a polymorphic site is present among nucleic acid fragments derived from two members of the same species, and hybridizes to the DNA fragment derived from one member, but does not hybridize to the fragment derived from the other member. . In this case, hybridization conditions must be sufficiently stringent to ensure that only one of the alleles hybridizes, as there is a significant difference in hybridization strength between alleles. This can lead to good hybridization differences between different allelic forms.

The probe of the present invention can be used in a skin type diagnosis method by detecting alleles. The diagnostic method includes detection methods based on hybridization of nucleic acids such as Southern blot, and in the method using a DNA chip, it may be provided in a form pre-bound to the substrate of the DNA chip. The hybridization can usually be performed under stringent conditions, for example, at a salt concentration of 1 M or less and a temperature of 25° C. or higher.

For example, conditions of 5 x SSPE (750mM NaCl, 50mM Na Phosphate, 5mM EDTA, pH 7.4) and 25 to 30° C. may be suitable for allele-specific probe hybridization.

The process of immobilizing the probe polynucleotide associated with the skin diagnosis of the present invention on a substrate can also be easily manufactured using this conventional technology. Additionally, hybridization of nucleic acids and detection of hybridization results on microarrays are well known in the art. The detection may be performed, for example, by labeling a nucleic acid sample with a labeling material capable of generating a detectable signal, including a fluorescent substance, such as Cy3 and Cy5, and then hybridizing it on a microarray and extracting the labeling material from the labeling material. Hybridization results can be detected by detecting the generated signal.

In another aspect, the present invention includes the steps of (a) amplifying the polymorphic site of the single nucleotide polymorphism marker from DNA obtained from a sample of an isolated individual or hybridizing it with a probe; and (b) confirming the base of the amplified or hybridized polymorphic site in step (a).

As used herein, the term “individual” refers to a test subject for diagnosing the level of skin moisturization. DNA can be obtained from samples such as hair, urine, blood, various body fluids, separated tissues, separated cells, or saliva, but is not limited thereto.

Any method known to those skilled in the art can be used to obtain genomic DNA in step (a).

Any method known to those skilled in the art can be used to amplify the polymorphic site of the single nucleotide polymorphism marker from the DNA obtained in step (a) or hybridize it with a probe. For example, target nucleic acid can be amplified through PCR and purified. In addition, ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), self-sustaining sequence cloning (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA) can be used.

Among the above methods, determining the base of the polymorphic site in step (b) includes sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele-specific hybridization. DASH), PCR extension assay, SSCP, PCR-RFLP assay or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio-Plex systems (BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technologies (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g., Illumina GoldenGate and Infinium assays). No. By the above methods or other methods available to those skilled in the art to which the present invention pertains, one or more alleles in a polymorphic marker, including microsatellites, SNPs or other types of polymorphic markers, can be identified. Determination of the base of such a polymorphic site can preferably be performed using a SNP chip.

In the present invention, the term “SNP chip” refers to a DNA microarray that can identify each base of hundreds of thousands of SNPs at once.

The TaqMan method includes (1) designing and producing primers and TaqMan probes to amplify the desired DNA fragment; (2) labeling probes of different alleles with FAM dye and VIC dye (Applied Biosystems); (3) using the DNA as a template and performing PCR using the primers and probes; (4) After the above PCR reaction is completed, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; and (5) determining the genotypes of the polynucleotides of step (1) from the analysis results.

In the above, sequencing analysis can be performed using a conventional method for determining a base sequence, or can be performed using an automated genetic analyzer. In addition, allele-specific PCR refers to a PCR method that amplifies the DNA fragment where the SNP is located using a primer set including a primer designed with the base where the SNP is located as the 3' end. The principle of the method is, for example, when a specific base is substituted from A to G, PCR is performed by designing a primer containing A as the 3' terminal base and a reverse primer capable of amplifying a DNA fragment of an appropriate size. When performing the reaction, if the base at the SNP position is A, the amplification reaction is performed normally and a band at the desired position is observed, and if the base is replaced by G, the primer can complement the template DNA, but 3 ' It takes advantage of the fact that the amplification reaction is not performed properly due to the failure of complementary bonds at the terminal end. DASH can be performed by a conventional method, preferably by the method by Prince et al.

Meanwhile, in the PCR extension analysis, a DNA fragment containing the base where the single nucleotide polymorphism is located is first amplified with a pair of primers, and then all nucleotides added to the reaction are inactivated by dephosphorylation, followed by SNP-specific extension primers, This is accomplished by performing a primer extension reaction by adding dNTP mixture, dideoxynucleotide, reaction buffer, and DNA polymerase. At this time, the extension primer uses the base immediately adjacent in the 5' direction of the base where the SNP is located as the 3' end, and the dNTP mixture excludes nucleic acids having the same base as the dideoxynucleotide, and the dideoxynucleotide represents the SNP. It is selected from one of the base types. For example, when there is a substitution from A to G and a mixture of dGTP, dCTP and dTTP and ddATP are added to the reaction, the primer is extended by DNA polymerase at the base where the substitution occurred, and after a few bases, A The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at that position, so that the type of base representing the SNP can be determined by comparing the lengths of the extended primers.

At this time, the detection method is to detect the SNP by detecting fluorescence using a genetic analyzer (e.g., ABI's Model 3700, etc.) used for general base sequence determination in the case of fluorescently labeled extension primers or dideoxynucleotides. When using unlabeled extension primers and dideoxynucleotides, the SNP can be detected by measuring the molecular weight using matrix assisted laser desorption ionization-time of flight (MALDI-TOF) technique.

The method of providing information for diagnosing the level of skin moisturization is not limited to this, but among the base sequences identified in step (b), one or more single nucleotide polymorphism markers are present in the polynucleotide shown in SEQ ID NO: 1, 26 When the first base is C; In the polynucleotide shown in SEQ ID NO: 2, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 3, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 4, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 5, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 6, when the 26th base is T; In the polynucleotide shown in SEQ ID NO: 7, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 8, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 9, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 10, when the 26th base is T; In the polynucleotide shown in SEQ ID NO: 11, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 12, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 13, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 14, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 15, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 16, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 17, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 18, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 19, when the 26th base is A; Alternatively, in the polynucleotide shown in SEQ ID NO: 20, when the 26th base is A, it may include the step of determining that the level of skin moisture is low. Specifically, it may be determined based on the CM value evaluated according to the method according to an embodiment of the present invention.

Additionally, in the polynucleotide shown in SEQ ID NO: 1, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 2, when the 26th base is T; In the polynucleotide shown in SEQ ID NO: 3, when the 26th base is T; In the polynucleotide shown in SEQ ID NO: 4, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 5, when the 26th base is T; In the polynucleotide shown in SEQ ID NO: 6, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 7, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 8, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 9, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 10, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 11, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 12, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 13, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 14, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 15, when the 26th base is C; In the polynucleotide shown in SEQ ID NO: 16, when the 26th base is G; In the polynucleotide shown in SEQ ID NO: 17, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 18, when the 26th base is A; In the polynucleotide shown in SEQ ID NO: 19, when the 26th base is G; Alternatively, in the polynucleotide shown in SEQ ID NO: 20, when the 26th base is G, it may include a step of determining that the level of skin moisture is high. Specifically, it may be determined based on the CM value evaluated according to the method according to an embodiment of the present invention.

The base sequence confirmed in step (b) is one or more types, two or more types, three or more types, four or more types, five or more types, six or more types, seven or more types selected from the base sequences consisting of SEQ ID NOs: 1 to 20. , 8 or more species, 9 or more species, 10 or more species, 11 or more species, 12 or more species, 13 or more species, 14 or more species, 15 or more species, 16 or more species, 17 or more species, 18 or more species, 19 or more species, or 20 or more species. It may include a single nucleotide polymorphism marker of the species.

The single nucleotide polymorphism marker of the present invention is a marker that can diagnose the skin moisturizing condition for each individual, and can provide information on the exact skin type of the individual, through which the skin characteristics of cosmetic consumers can be scientifically classified. It can be used to develop customized cosmetics for each skin characteristic.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the embodiments according to the present invention may be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Example 1: Classification and gene collection according to skin moisturization level

The present inventors conducted an experiment on about 300 healthy female subjects aged 30 to 50 to establish standards for determining the degree of skin moisturization by gene type and develop personalized active ingredients (Table 1).

Clinical characteristics of the test subject sample size 300 Age (mean ± SD) 40.54 ± 4.34 female ( % ) 100% Smoking history ( % ) One% History of skin cancer ( % ) 0%

At this time, ① if you are pregnant, lactating, or planning to become pregnant within 6 months, ② if you have used a dermatological agent containing steroids for more than 1 month to treat a skin disease, ③ if less than 6 months have passed since participating in the same test. ④ If you have sensitive or hypersensitive skin; ⑤ If you have skin abnormalities such as moles, acne, erythema, or telangiectasia in the test area; ⑥ If you have used the same or similar cosmetics or medicines in the test area within 3 months of starting the test ⑦ If you have received a treatment (skin peeling, Botox, other skin care) on the test area or plan to do so within 6 months, ⑧ If you have a chronic wasting disease (asthma, diabetes, high blood pressure, etc.), ⑨ If you have atopic dermatitis, and ⑩ Other cases where the test was deemed difficult by the main investigator were excluded from the test subjects.

Next, the level of moisturization of the test subject was classified based on the moisture content measured using Corneometer CM825 (C+K, Germany), a moisture measurement device. A CM value of 34 or less was classified as low moisture skin, and a CM value of 78 or higher was skin with low moisture. With highly moisturized skin, 13 people with the highest values of both extremes were selected as the control group, and 13 people with the lowest values were selected as the experimental group (case) (Table 2).

High Moisturizing (Control) Low moisturizing ( experimental group ) p -value sample size 13 13 Age, mean ± SD 40.1±4.1 40.4±4.9 0.863 clinical score wrinkle 4.31±1.38 4.23±1.36 0.887 Pigmentation 2.85±1.28 2.69±1.18 0.762^ Skin Hydration (a.u.) 78.14±2.50 34.10±3.85 <0.001^ bright area
skin color Brightness (L ^* ) 64.59±2.55 61.90±2.53 0.012 redness (a ^* ) 8.02±1.92 9.19±1.52 0.169^ yellow degree (b ^* ) 18.25±1.15 16.62±1.98 0.017 ITA ° 38.41±4.90 35.30±4.78 0.115 dark area
skin color
Brightness (L ^* ) 59.82±2.35 56.86±3.03 0.010 redness (a ^* ) 10.47±1.76 11.88±1.64 0.045 yellow degree (b ^* ) 18.95±1.57 17.44±2.45 0.077 ITA ° 27.37±6.64 20.92±8.49 0.041

p -value: significance by individual t-test (p<0.05), ^: Mann-Whitney test.

The degree of wrinkles of the test subject is based on the visual assessment criteria of the Cosmetics Evaluation Method (KFDA standard), and the highest level of wrinkles is determined by visual assessment by an expert after taking a photo (facial stage DM3, Minolta, Japan). Classification was based on the value (7 points) and lowest value (2 points). The grades of skin with many wrinkles and skin with few wrinkles were measured repeatedly and the average value was calculated.

The ITA value reflects the whiteness of the skin and can be calculated using the L ^* value, which indicates skin brightness, and the b ^* value (melanization parameter), which indicates the degree of melanin. The formula for calculating the ITA ° value is as follows. In particular, the larger the ITA ° value, the brighter the skin color ( ITA ° = [Arc tan(L ^* - 50)/b ^* ] x 180/π), L ^* : brightness factor; Brightness, b ^* : color factor; blue-yellow). The skin color (L ^* , a ^* , b ^* ) was measured using a Minolta spectrophotometer (CM2600d, Minolta, Japan). The measurements were repeated on the skin in light areas and the skin in dark areas, and the average value was calculated. Skin measurement data were statistically processed using independent t-test ( p < 0.05) and Mann-Whitney test using SPSS software (Ver 22.0).

Example 2. from saliva DNA collection

Saliva from 26 people who had been classified through Example 1 was collected. Saliva was collected twice. The first saliva was collected after the test subject fasted 1 hour before collection, and the second saliva was collected by the test subject immediately after waking up in the morning.

High purity genomic DNA (gDNA) was extracted from the test subject's saliva using the Oragene® saliva kit. Next, a genetic analysis experiment was performed after confirming an intact gDNA band with OD 260/280 > 1.7 and 10 ng/μl or more in a 1 x TAE 1% agarose gel.

Example 3. Whole genome sequencing

50 ng of gDNA isolated in Example 2 was used for target amplification according to the manual of the Ion AmpliSeq Exome kit (LifeTechnologies).

Next, an Ion Torrent adapter-ligated library was created according to the Ion AmpliSeq™ Library kit 2.0 (Life Technologies) protocol (Part #4475345 Rev. B). Each amplicons were made with partially digest primer sequences and linked to Ion Torrent adapters P1 and A using DNA ligase.

Next, the library was separated using AMPure beads (Beckman Coulter). The quantity and quality of each isolated library were evaluated using the Library Quantification kit (LifeTechnologies) and the Agilent High Sensitivity DNA kit (Agilent Technologies).

Emulsion PCR was performed using the Ion PI Template OT2 200 Kit v2 and OneTouch 2 instrument (Life Technologies). Enrichment of template-positive Ion Sphere Particles (ISP) on the Ion PI chip was performed using the Ion OneTouch ES enrichment system (Life Technologies). Ion PI chip was prepared and loaded according to the manual. The sequence was aligned with the hg19 human genome reference using Ion Torrent platform-specific pipeline software (Torrent Suite v4.0), target-region coverage analysis was performed, and poor signal reads were filtered and removed.

Example 4. Bioinformatics analysis and statistical processing

Sequence alignment with the human genome reference (hg19) was performed using TMAP (Torrent Suite version: 4.0.2).

Base quality recalibration, indel realignment, and variant calling were performed using GATK (Genome Analysis Toolkit, version: 2.3.9). Variants were annotated using the SnpEff program (http://snpeff.sourceforge.net/) (ref. snpeff) and the databases of the 1000 Genomes Project and NCBI dbSNP. In addition, all possible nsSNVs (non-synonymous single-nucleotide variants) in the whole-exome region were analyzed using the dbNSFP database (https://sites.google.com/site/jpopgen/dbNSFP) (ref. dbNSFP).

To filter short reads, if the average quality scorer was less than 9 at a window size of 30, 1 base pair at the end of the short read sequence was removed. After SNP calling, heterozygous SNPs with depth < 10 and homozygous SNPs with depth < 5 were filtered.

In addition, SNPs with minor allele frequency (MAF) <5% and SNPs with call rate <95% were analyzed using the PLINK program (http://pngu.mgh.harvard.edu/) for SNP quality control. ~purcell/plink) (Ver 1.07) (ref. plink) was used to filter. After SNP filtering, the relationship between the filtered SNPs and skin color was analyzed using an additive model (one degree of freedom) of logistic regression.

As a result, a total of 387 SNPs showed high significance, among which were present in ZNF100, OR10K2, TMEM235, PRCP, TIPIN, CFH, PIDD, CFH, AMER3, NAALADL2, EXOC2, KHDC1, LMBR1, TELO2, RAB31, and SNRPA genes. The top 20 SNPs with highest significance were displayed (Table 3). The flanking sequences of the top 20 genes are shown in Table 4.

Top 20 SNPs Chr . Position Func . Gene rs Number Alleles (A/B) R.A. RAF OR P Case Control chr19 21950337 5'UTR ZNF100 rs10412066 C/G C 0.46 0.12 40 0.002741 chr1 158389659 down OR10K2 rs58605957 C/T C 0.38 0.08 18.33 0.004052 chr1 158390252 syn OR10K2 rs12239443 G/T G 0.38 0.08 18.33 0.004052 chr1 158390501 syn OR10K2 rs34616883 A/G A 0.38 0.08 18.33 0.004052 chr17 76230729 syn TMEM235 rs11077350 C/T C 0.46 0.12 17.09 0.004652 chr11 82560312 intron PRCP rs10792653 G/T T 0.88 0.5 0.06282 0.005198 chr15 66644563 intron TIPIN rs9806130 A/G A 0.46 0.15 27 0.006101 chr1 196682947 syn CFH rs2274700 A/G A 0.58 0.15 22.48 0.007674 chr11 804212 syn PIDD rs7104785 A/C C 0.88 0.62 0.09 0.009694 chr1 196642072 intron CFH rs551397 T/C T 0.54 0.15 10.67 0.009868 chr1 196642233 missense CFH rs800292 A/G A 0.54 0.15 10.67 0.009868 chr2 131520178 missense AMER3 rs77687733 G/C G 0.35 0.08 12.38 0.009929 chr3 175164937 intron NAALADL2 rs79180420 G/A A H 0.65 0.08081 0.009929 chr6 619600 intron EXOC2 rs1150856 C/A C 0.35 0.08 12.38 0.009929 chr6 73952103 intron KHDC1 rs6453660 C/A A 0.92 0.65 0.08081 0.009929 chr6 73952118 intron KHDC1 rs6453661 G/A A 0.92 0.65 0.08081 0.009929 chr7 156480633 intron LMBR1 rs3757433 A/G G 0.92 0.65 0.08081 0.009929 chr16 1552570 intron TELO2 rs58893598 A/G G 0.92 0.65 0.08081 0.009929 chr18 9775372 intron RAB31 rs6506697 A/G A 0.42 0.15 12.38 0.009929 chr19 41263403 syn SNRPA rs2230694 G/A A 0.92 0.65 0.08081 0.009929

Summary abbreviations: Chr., chromosome; Func, SNP function; Frq, frequency; RA, risk allele; OR, error ratio (odds ratio).

For genome location, refer to NCBI build 37.

In experimental group-control group analysis, p-value is calculated using logistic regression.

In Alleles (A/B), A represents the minor allele and B represents the major allele.

RA is a base that mainly appears in skin with low moisture content.

Gene rs Number Alleles (A/B) Flanking sequence ZNF100 rs10412066 C/G forward CCCTAGGAGCAGAAGACACAGAGAA[C/G]TGAGAGCAAACCTGGAGCTCCGGCT (SEQ ID NO: 1) OR10K2 rs58605957 C/T forward TCAGGTGATCCACCTGTCTCAGCT[C/T]CCAAAATGCTGGGATTACAGTCGTG (SEQ ID NO: 2) OR10K2 rs12239443 G/T forward GTCCCATACACACCCCATGTCCCAT[G/T]AGCACTGAGTAGGCAGTGGGTTAC (SEQ ID NO: 3) OR10K2 rs34616883 A/G forward AGTACATGGGGATATGAAGGGGCCCT[A/G]TCCAGGACAATGGTGGAAATGATGA (SEQ ID NO: 4) TMEM235 rs11077350 C/T forward CCCTGAGCCTGGTCCTTCTCGTGTG[C/T]GGCTGGATCTGCGGCCTGCTCAGCT (SEQ ID NO: 5) PRCP rs10792653 G/T forward TCTAAAAGTACTGGTCAACAGATG[G/T]CTTTACAGATCATTTATTCTTCACA (SEQ ID NO: 6) TIPIN rs9806130 A/T forward TCCTGACTCTGGTGAAACAAACCAC[A/G]ATTCAGTATTACTGTACTTAAATGA (SEQ ID NO: 7) CFH rs2274700 A/T forward CATATTCCTAGTTTGCATTGATATTT[A/G]GCTTTTTCTTTTAAGGCATATGTAT (SEQ ID NO: 8) PIDD rs7104785 A/C reverse TGCACCTGTGTGTCCAGCAGCCTCT[G/T]CAGCTGCTGCAGTGGAATTCTTGC (SEQ ID NO: 9) CFH rs551397 T/C reverse TAAAAACAAAATAAGTGCATAAAGT[A/G]TCTATTTAAATGTACAGTATATTTA (SEQ ID NO: 10) CFH rs800292 A/G reverse TCCCCTTCCTGCATACCATTATTA[C/T]ATTTCCAAGAGATCTATATCCAGGG (SEQ ID NO: 11) AMER3 rs77687733 G/C forward AAGACTGAGGACTTGGCCTCGCTGG[C/G]GGCCGAGGGGAAAAGCCTGCCCTCC (SEQ ID NO: 12) NAALADL2 rs79180420 G/A forward TAAACTTACCAGTCATAATTTAAAT[A/G]CTTATTACAGATAACTTTTCCTTAA (SEQ ID NO: 13) EXOC2 rs1150856 C/A reverse TTATACTGGATACTTAGTGATACCT[G/T]TTCCATTTTTGTCATAATAACCATT (SEQ ID NO: 14) KHDC1 rs6453660 C/A forward AAAACTGAGAAGACAAGGATGAAGA[A/C]GGGGACGTGGGCAAAGGCCACTCAC (SEQ ID NO: 15) KHDC1 rs6453661 G/A forward AGGATGAAGAAGGGGACGTGGGCAA[A/G]GGCCACTCACCGAAGATGAGCTCCT (SEQ ID NO: 16) LMBR1 rs3757433 A/G reverse ATTACATCTTCAGCTATTTAGTTTC[C/T]CAAATTTGTAAAACCTTAGAGGTCA (SEQ ID NO: 17) TELO2 rs58893598 A/G forward GGCCTTGCTGGGGTGGGTGGCTCC[A/G]GCCCTGTGAGCCTCGGTGAGGGCCTC (SEQ ID NO: 18) RAB31 rs6506697 A/G forward ACTATTGGGTAAGTTCCTGTATGTC[A/G]TTCTCCTTCGCGTTGCTTCCTTTCA (SEQ ID NO: 19) SNRPA rs2230694 G/A forward TGCAGGGTTTCCCTTTCTATGACAA[A/G]CCTATGGTGAGCATTGCGGGTACGG (SEQ ID NO: 20)

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. In this regard, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed as including the meaning and scope of the patent claims described below rather than the detailed description above, and all changes or modified forms derived from the equivalent concept thereof are included in the scope of the present invention.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Single nucleotide polymorphism markers for determining of probability of skin hydration and use thereof <130> KPA151120-KR <160> 20 <170>CopatentIn 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10412066 <400> 1 ccctaggagc agaagacaca gagaastgag agcaaacctg gagctccggct 51 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs58605957 <400> 2 tcaggtgatc cacctgtctc agcctyccaa aatgctggga ttacagtcgt g 51 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs12239443 <400> 3 gtcccataca caccccatgt cccatkagca ctgagtagcg cagtgggtta c 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs34616883 <400> 4 agtacatggg gatatgaagg gccctrtcca ggacaatggt ggaaatgatg a 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11077350 <400> 5 ccctgagcct ggtccttctc gtgtgyggct ggatctgcgg cctgctcagc t 51 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10792653 <400> 6 tctaaaaagt actggtcaac agatgkcttt acagatcatt tattcttcac a 51 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223>rs9806130 <400> 7 tcctgactct ggtgaaaacaa accacrattc agtattactg tacttaaatg a 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2274700 <400> 8 catatcctag tttgcattga tatttrgctt tttcttttaa ggcatatgta t 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs7104785 <400> 9 tgcacctgtg tgtccagcag cctctkcagc tgctgcaggt ggaattcttg c 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs551397 <400> 10 taaaaacaaa ataagtgcat aaagtrtcta tttaaatgta cagtatattt a 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs800292 <400> 11 tctcccttcc tgcataccat tattayattt ccaagagatc tatatccagg g 51 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs77687733 <400> 12 aagactgagg acttggcctc gctggsggcc gaggggaaaa gcctgccctc c 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs79180420 <400> 13 taaacttacc agtcataatt taaatrctta ttacagataa cttttcctta a 51 <210> 14 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1150856 <400> 14 ttatactgga tacttagtga tacctkttcc atttttgtca taataaccat t 51 <210> 15 <211> 51 <212> DNA <213> Artificial Sequence <220> <223>rs6453660 <400> 15 aaaactgaga agacaaggat gaagamgggg acgtgggcaa aggccactca c 51 <210> 16 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6453661 <400> 16 aggatgaaga aggggacgtg ggcaarggcc actcaccgaa gatgagctcc t 51 <210> 17 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3757433 <400> 17 attacatctt cagctattta gtttcycaaa tttgtaaaac cttagaggtc a 51 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs58893598 <400> 18 ggcctctgct ggggtgggtg gctccrgccc tgtgagcctc ggtgaggcct c 51 <210> 19 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6506697 <400> 19 actattgggt aagttcctgt atgtcrttct ccttcgcgtt gcttcctttc a 51 <210> 20 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2230694 <400> 20 tgcagggttt ccctttctat gacaarccta tggtgagcat tgcgggtacg g 51

Claims (11)

A polynucleotide containing the 26th base of the base sequence of SEQ ID NO: 1 as a single nucleotide polymorphism (SNP) site and consisting of 5 to 51 consecutive DNA sequences, or a single nucleotide polymorphism marker that is a polynucleotide complementary to the polynucleotide A composition for diagnosing the level of skin moisture, comprising a probe capable of detecting or an agent capable of amplifying it.
The method of claim 1, wherein the composition for diagnosing the level of skin moisturization includes the 26th base as a single nucleotide polymorphism site among one or more base sequences selected from the group consisting of SEQ ID NOs: 8 to 20, and is composed of 5 to 51 consecutive DNA sequences. A composition for diagnosing the level of skin moisturization, further comprising a probe capable of detecting a single nucleotide polymorphism marker that is a polynucleotide or a polynucleotide complementary thereto, or an agent capable of amplifying the same.
According to claim 1 or 2,
(i) the 26th base of SEQ ID NO: 1 is C or G,
(ii) the 26th base of SEQ ID NO: 8 is A or G,
(iii) the 26th base of SEQ ID NO: 9 is A or C,
(iv) the 26th base of SEQ ID NO: 10 is T or C,
(v) the 26th base of SEQ ID NO: 11 is A or G,
(vi) the 26th base of SEQ ID NO: 12 is G or C,
(vii) the 26th base of SEQ ID NO: 13 is G or A,
(viii) the 26th base of SEQ ID NO: 14 is C or A,
(ix) The 26th base of SEQ ID NO: 15 is C or A,
(x) The 26th base of SEQ ID NO: 16 is G or A,
(xi) The 26th base of SEQ ID NO: 17 is A or G,
(xii) the 26th base of SEQ ID NO: 18 is A or G,
(xiii) the 26th base of SEQ ID NO: 19 is A or G;
(xiv) the 26th base of SEQ ID NO: 20 is G or A,
Composition for diagnosing skin moisturization level.
A kit for diagnosing the level of skin moisture containing the composition of claim 1 or 2.
The kit for diagnosing the level of skin moisture according to claim 4, wherein the kit is an RT-PCR kit or a DNA chip kit.
A microarray for diagnosing the level of skin moisture containing the polynucleotide of claim 1 or 2.
(a) amplifying the polymorphic site of the single nucleotide polymorphism marker of claim 1 or 2 from DNA obtained from a sample of an isolated individual or hybridizing it with a probe; and
(b) A method of providing information for diagnosing the level of skin moisture, including the step of confirming the base of the amplified or hybridized polymorphic site in step (a).
The method of claim 7, wherein in the polynucleotide shown in SEQ ID NO: 1 among the base sequences confirmed in step (b), if the 26th base is C, the diagnosis of skin moisturization level comprising the step of determining that the skin is dry. How to provide information for.
The method of claim 7, wherein in the polynucleotide shown in SEQ ID NO: 1 among the base sequences confirmed in step (b), if the 26th base is G, the level of skin moisturization comprising the step of determining that the skin is moist. How to provide information for diagnosis.
The method of claim 7, wherein the sample is hair, urine, blood, various body fluids, separated tissue, separated cells, or saliva.
The method of claim 7, wherein the amplification and confirmation of the polymorphic site is performed using a SNP chip.