KR20170051748A - Single nucleotide polymorphism markers for determining of probability of skin hydration and use thereof - Google Patents

Abstract

The present invention relates to a marker for diagnosing a degree of skin moisturization including at least one single nucleotide polymorphism (SNP) marker selected among SNP markers capable of determining the degree of skin moisturization, a composition containing a probe capable of detecting the marker or a preparation capable of amplifying the same, a kit or a microarray containing the composition, and a method for providing information for diagnosing the degree of skin moisturization using the marker. The SNP marker of the present invention is capable of diagnosing the degree of skin moisturization for each individual, provides accurate information on skin types for the individual, and thus can be used for developing customized cosmetic products for the types of skin by scientifically classifying the skin type for consumers.

Description

Single nucleotide polymorphism markers for skin moisturizing diagnosis and their use

The present invention relates to a composition comprising a single nucleotide polymorphism (SNP) marker capable of determining a skin moisturizing condition of a person, a probe capable of detecting the marker or an agent capable of amplifying the marker, A kit or a microarray, and a method for providing information for diagnosis of a skin moisturizing state using the marker.

The degree of moisturization of individual skin, that is, the degree to which the skin is moisturized or dried, is determined by various factors such as genetic factors, endocrine factors, and the environment in which the individual is present. the amount of ceramide, the activity of aquaporin, or the firmness of tight junctions connecting the keratinocytes, and the like are known to be determined by natural moisturizing factor (NMF), ceramide amount, and the like. Among these factors, genetic factors are known to be the most powerful determinant of skin moisturizing.

However, until now, the judgment of the degree of moisturizing of individual is mainly to grasp the skin condition through simple skin test and simple skin test, and it is difficult to obtain complete trust in individual skin condition information.

For example, the method of measuring the amount of skin moisturizing using a corneometer simply shows the physical state of the skin surface by numerical values. In this case, the moisture content of the skin may vary depending on the program to be measured There is a possibility that an error may occur in evaluating the small improvement degree of the testee. In addition, in the case of the visual evaluation of the tester and the evaluation of the questionnaire by the tester, the subjective aspect greatly affects and it is difficult to evaluate the subject's skin condition objectively and precisely. In addition, although these methods can measure the current moisturizing condition, there is a limit in predicting the individual moisturizing condition.

Therefore, there is almost no system to provide a customized cosmetics by precisely diagnosing the degree of skin moisturization by approaching scientific basis.

Under these circumstances, the inventors of the present invention have found a genetic characteristic that determines the degree of skin moisturization in humans, developed a personalized active ingredient based on the genetic characteristic, and contributed to the development of customized cosmetics for each skin gene. The present inventors have completed the present invention by identifying a single nucleotide polymorphic marker having a positive correlation

It is an object of the present invention to provide a single nucleotide polymorphism (SNP) marker capable of judging skin moisturizing degree.

Another object of the present invention is to provide a composition for diagnosing skin moisturizing degree, which comprises a probe capable of detecting the skin moisturizing degree diagnostic marker or an agent capable of amplifying the probe.

Yet another object of the present invention is to provide a kit for skin moisturization diagnosis or a microarray comprising the composition for diagnosing skin moisturizing degree.

It is still another object of the present invention to provide a method for providing information for diagnosing skin moisturizing degree, which comprises identifying a polymorphic site of the single nucleotide polymorphic marker.

In one aspect of the present invention, the present invention provides a single nucleotide polymorphism (SNP) marker capable of determining skin moisturizing degree.

In the present invention, the term "polymorphism" refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base differs from a polymorphism region to a single base polymorphism (single nucleotide polymorphism, SNP). The term "single nucleotide polymorphism marker" in the present invention means a polynucleotide comprising a sequence having a single nucleotide polymorphism, through which the degree of skin moisturization can be judged. Preferred polymorphic markers have two or more alleles exhibiting an incidence of 1% or more, more preferably 10% or 20% or more, in the selected population.

In the present invention, the term "allele" refers to various types of a gene existing at the same gene locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In the present invention, the term "rs_id " means rs-ID, which is an independent marker assigned to all SNPs initially registered by the NCBI that has started accumulating SNP information since 1998. [ The rs_id indicates the SNP marker of the present invention.

In the present invention, the term "skin moisturizing" refers to the degree of skin moisturization of an individual to be measured or diagnosed. Specifically, the term " skin moisturizing degree " means that the skin is moisturized It means the degree of existence. The single nucleotide polymorphic marker of the present invention can be used to evaluate the degree of skin moisturization of a subject by collecting a sample from a subject to be skin moisturized.

In one embodiment of the present invention, the present inventors classify the degree of moisturizing of the subject according to the moisture amount measured using a water meter, Corneometer CM825 (C + K, Germany) Dry skin, and CM value> 78 were classified as moisturizing skin.

Since the single nucleotide polymorphic marker of the present invention can measure an accurate skin moisturizing degree, it can also give information on the changed skin moisturizing degree of the skin contacted with the active ingredient. Specifically, for example, CM value of less than 34 may be judged to be dry skin with a moisture content of less than CM value 78, and more than CM value 78 may be judged to be moisturized skin with a moisture content. , And can be more precisely measured and diagnosed using the single base polymorphism marker of the present invention.

Specifically, the single nucleotide polymorphism marker may be at least one single nucleotide polymorphism marker selected from the single nucleotide polymorphism markers shown in Table 3. More specifically, the single nucleotide polymorphism markers may include one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight Or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, May be a base polymorphism marker. The single nucleotide polymorphic markers shown in Table 3 above may be used to determine the degree of skin moisturization.

The diagnosis of skin moisturizing degree of the single nucleotide polymorphic marker of the present invention was made by measuring the frequency of each marker. Such significance may be characterized by p-values such as less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001. Specifically, the p-value may be less than 0.01, and more specifically, the p-value may be less than 0.001, but is not limited thereto.

The marker for skin moisturizing degree diagnosis is a polynucleotide comprising as a SNP the 26th base out of at least one base sequence selected from the group consisting of SEQ ID NOS: 1 to 20 and consisting of 5 to 51 consecutive DNA sequences, (Ii) the 26th base of SEQ ID NO: 2 is C or T, (iii) the 26th base of SEQ ID NO: 3 is C or G, (Iv) the 26th base of SEQ ID NO: 4 is A or G, (v) the 26th base of SEQ ID NO: 5 is C or T, (vi) the 26th base of SEQ ID NO: 6 is G Or (vii) the 26th base of SEQ ID NO: 7 is A or G, (viii) the 26th base of SEQ ID NO: 8 is A or G, (X) the 26th base of SEQ ID NO: 10 is T or C, (xi) the 26th nucleotide of SEQ ID NO: 11 (Xiii) the 26th base of SEQ ID NO: 12 is G or C, (xiii) the 26th base of SEQ ID NO: 13 is G or A, (xiv) the 26th base of SEQ ID NO: C or A, (xv) the 26th base of SEQ ID NO: 15 is C or A, (xvi) the 26th base of SEQ ID NO: 16 is G or A, (Xix) the 26th base of SEQ ID NO: 19 is A or G, (xx) the 26th base of SEQ ID NO: 18 is G or A, , And a marker for diagnosing the degree of skin moisturization.

Specifically, the skin moisturizing degree diagnosis marker may be at least one selected from the group consisting of SEQ ID NOS: 1 to 20, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, A DNA sequence comprising 5 to 51 consecutive DNA sequences as a SNP among the nucleotide sequences of SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, , Or a polynucleotide complementary to the polynucleotide.

The present inventors have confirmed through the following proof that the above-mentioned SNP is a marker for skin moisturizing degree diagnosis marker.

Specifically, the moisturizing degree of the subject was CM value less than 34, dry skin less than CM value, CM value higher than 78 was moisture sensitive skin, 13 subjects having the highest value of the extremity were control (control), 13 Were classified into experimental groups (Table 2).

Then, genomic DNA (gDNA) was extracted from the saliva of the above-mentioned classified individuals, and the SNPs having the significance in skin moisturizing degree were classified by comparing the sequence with the hg19 human genome reference as a control group (Table 3 ). SNPs capable of diagnosing such degree of skin moisturization were first identified by the present inventors.

In another aspect, the present invention provides a composition for diagnosing skin moisturizing degree, which comprises a probe capable of detecting the skin moisturizing degree diagnostic marker or an agent capable of amplifying the probe.

In the present invention, the term "probe capable of detecting a skin moisturizing diagnostic marker" means a composition capable of diagnosing skin moisturizing degree by specifically hybridizing with a polymorphic site of the above-mentioned gene, The specific method of the same gene analysis is not particularly limited and may be by any gene detection method known in the art to which the present invention belongs.

The term " agent capable of amplifying marker for skin moisturizing degree diagnosis "in the present invention means a composition capable of diagnosing skin moisturizing degree by amplifying the polymorphic site of the above-mentioned gene, Means a primer capable of specifically amplifying the polynucleotide of the marker for the degree of moisturization.

The primers used for the polymorphic marker amplification can be amplified using appropriate conditions in suitable buffers (e.g., four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotides that can serve as the starting point of synthesis. The appropriate length of the primer may vary depending on the purpose of use, and is usually, but not limited to, 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

The term "primer" in the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. PCR amplification can be performed to predict skin type through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The probes or primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution with an equivalent of one or more natural nucleotides, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In another aspect, the present invention provides a skin moisturizing degree diagnostic kit comprising the composition for diagnosing skin moisturization.

The kit may be an RT-PCR kit or a DNA chip kit.

The kit of the present invention can diagnose the degree of skin moisturization by confirming the SNP polymorphism marker, which is a marker for skin moisturization degree diagnosis, or confirming the expression level of the SNP polymorphism marker with the mRNA expression level.

As a specific example, in the present invention, the kit for measuring the level of mRNA expression of the marker for skin moisturizing degree diagnosis may be a kit containing essential elements necessary for performing RT-PCR. The RT-PCR kit includes a test tube or other appropriate container, a reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), a Taq polymer Enzymes such as lyase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control. Also preferably, the kit of the present invention may be a skin moisturizing degree diagnostic kit containing essential elements necessary for carrying out a DNA chip.

DNA chip kits are those in which nucleic acid species are attached in a gridded array on a generally flat solid support plate, typically a glass surface not larger than a slide for a microscope, and nucleic acids are uniformly arranged on the chip surface, Hybridization reaction occurs between the nucleic acid on the surface and the complementary nucleic acid contained in the solution treated on the surface of the chip to enable a mass parallel analysis.

In another aspect, the present invention provides a microarray for diagnosing skin moisturizing degree comprising a polynucleotide of the marker for skin moisturizing degree diagnosis.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms.

The probe of the present invention can detect an allele and can be used for diagnosis of skin type and the like. The diagnostic methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 0 C may be suitable for allele-specific probe hybridization.

Immobilization on the substrate of the probe polynucleotide associated with the skin diagnosis of the present invention can also be easily made using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray and detecting The hybridization result can be detected by detecting the generated signal.

In another aspect, the present invention provides a method for amplifying a polynucleotide comprising: (a) amplifying or hybridizing a polymorphic site of the single nucleotide polymorphic marker from DNA obtained from a sample of the isolated individual; And (b) identifying the base of the amplified or hybridized polymorphic site of step (a).

The term "individual" of the present invention means a person to be tested for diagnosis of skin moisturizing degree. DNA can be obtained from the sample, such as hair, urine, blood, various body fluids, isolated tissues, isolated cells or saliva, but is not limited thereto.

The method of obtaining the genomic DNA of step (a) may be any method known to those skilled in the art.

The amplification of the polymorphic site of the single nucleotide polymorphic marker from the DNA obtained in step (a) or hybridization with the probe may be performed by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. USA 86, 1173 (1989)), self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA).

In order to determine the base of the polymorphic site of step (b), sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specifichybridization, DASH), PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio- But are not limited to, the BioRad system, the CEQ and SNPstream system (Beckman), the Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium assay) Do not. One or more of the alleles in a polymorphic marker can be identified, including microsatellite, SNP or other types of polymorphic markers, by such methods or by other methods available to those skilled in the art to which the invention pertains. The base of such a polymorphic site can be determined preferably through a SNP chip.

The term "SNP chip" in the present invention means one of DNA microarrays capable of confirming each base of several hundred thousand SNPs at a time.

The TaqMan method comprises the steps of: (1) designing and constructing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

In the above, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer. The allele-specific PCR means a PCR method in which a DNA fragment in which the SNP is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the SNP is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, In the case where the base at the SNP position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single base polymorphism is located is amplified by a pair of primers, and all nucleotides added to the reaction are deactivated by dephosphorylation, and SNP- specific extension primers, a dNTP mixture, a digoxin nucleotide, a reaction buffer, and a DNA polymerase to perform a primer extension reaction. At this time, the extension primer has a base immediately adjacent to the 5 'direction of the base in which the SNP is located at the 3' terminus, and the nucleic acid having the same base as the dodecoxynucleotide is excluded in the dNTP mixture, and the dodecoxynucleotide indicates the SNP Base type. For example, when dGTP, dCTP and dTTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer in the substituted base is extended by DNA polymerase, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the type of the base representing the SNP by comparing the lengths of the extended primers.

At this time, as a detection method, when the extension primer or the dideoxy nucleotide is fluorescence-labeled, the SNP is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 of ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the didyxin nucleotide are used, the SNP can be detected by measuring the molecular weight using MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The method for providing information for diagnosing the skin moisturizing degree is not limited thereto, but it is preferable that at least one of the single nucleotide polymorphic markers among the nucleotide sequences identified in the step (b) is a polynucleotide of SEQ ID NO: 1 The second base is C; In the polynucleotide described in SEQ ID NO: 2, when the 26th base is C; In the polynucleotide of SEQ ID NO: 3, when the 26th base is G; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is A; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is C; In the polynucleotide of SEQ ID NO: 6, when the 26th base is T; In the polynucleotide of SEQ ID NO: 7, when the 26th base is A; In the polynucleotide of SEQ ID NO: 8, when the 26th base is A; In the polynucleotide of SEQ ID NO: 9, when the 26th base is C; In the polynucleotide of SEQ ID NO: 10, when the 26th base is T; In the polynucleotide of SEQ ID NO: 11, when the 26th base is A; In the polynucleotide of SEQ ID NO: 12, when the 26th base is G; In the polynucleotide of SEQ ID NO: 13, when the 26th base is A; In the polynucleotide of SEQ ID NO: 14, when the 26th base is C; In the polynucleotide of SEQ ID NO: 15, when the 26th base is A; 16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is A; In the polynucleotide of SEQ ID NO: 17, when the 26th base is G; In the polynucleotide of SEQ ID NO: 18, when the 26th base is G; In the polynucleotide of SEQ ID NO: 19, when the 26th base is A; Or determining that the degree of skin moisture is low when the 26th base is A in the polynucleotide of SEQ ID NO: 20. Specifically, it can be judged based on the CM value evaluated according to the method according to an embodiment of the present invention.

Further, in the polynucleotide described in SEQ ID NO: 1, when the 26th base is G; In the polynucleotide described in SEQ ID NO: 2, when the 26th base is T; In the polynucleotide of SEQ ID NO: 3, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is G; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T; In the polynucleotide of SEQ ID NO: 6, when the 26th base is G; In the polynucleotide of SEQ ID NO: 7, when the 26th base is G; In the polynucleotide of SEQ ID NO: 8, when the 26th base is G; In the polynucleotide of SEQ ID NO: 9, when the 26th base is A; In the polynucleotide of SEQ ID NO: 10, when the 26th base is C; In the polynucleotide of SEQ ID NO: 11, when the 26th base is G; In the polynucleotide of SEQ ID NO: 12, when the 26th base is C; In the polynucleotide of SEQ ID NO: 13, when the 26th base is G; In the polynucleotide of SEQ ID NO: 14, when the 26th base is A; In the polynucleotide of SEQ ID NO: 15, when the 26th base is C; In the polynucleotide of SEQ ID NO: 16, when the 26th base is G; In the polynucleotide of SEQ ID NO: 17, when the 26th base is A; In the polynucleotide of SEQ ID NO: 18, when the 26th base is A; In the polynucleotide of SEQ ID NO: 19, when the 26th base is G; Or determining that the degree of skin moisture is high if the 26th base is G in the polynucleotide of SEQ ID NO: 20. Specifically, it can be judged based on the CM value evaluated according to the method according to an embodiment of the present invention.

The nucleotide sequence identified in step (b) may include at least one selected from the nucleotide sequences of SEQ ID NOS: 1 to 20, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 , 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more or 20 Lt; RTI ID = 0.0 > polymorphism < / RTI >

The single nucleotide polymorphic marker of the present invention is a marker capable of diagnosing the skin moisturizing condition for each individual, and can give information on the accurate skin type to the individual, thereby scientifically classifying the skin characteristics of the cosmetic consumer It can be used to develop customized cosmetics for each skin type.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified in various forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example  1: classification according to skin moisturizing degree and gene sampling

The present inventors conducted experiments on 300 healthy female women aged 30 to 50 years to establish criteria for judging skin moisturizing degree by gene type and to develop a personalized active ingredient (Table 1).

Clinical characteristics of the subjects Number of samples 300 Age (mean ± SD) 40.54 + - 4.34 female ( % ) 100% Smoking history ( % ) One% Skin Cancer History % ) 0%

If you are pregnant or breastfeeding or planning to become pregnant within 6 months, (2) you have used a skin contour containing steroids for at least one month to treat skin diseases, (3) you have not taken six months ⑤ If you have sensitive or sensitive skin, ⑤ If you have skin abnormalities such as dots, acne, erythema and capillary dilatation on the test site. ⑥ If you use the same or similar cosmetics or medicines (Eg, asthma, diabetes, hypertension, etc.), (9) have atopic dermatitis, and (9) have atopic dermatitis. ⑩ Other cases where the test was deemed difficult by the tester's decision, were excluded from the tester.

Next, the degree of moisturizing of the subject was classified based on the amount of moisture measured using a moisture meter, Corneometer CM825 (C + K, Germany) In a lot of moisturizing skin, 13 subjects with the highest bipolar values were selected as controls and 13 subjects with the lowest values were selected as cases (Table 2).

Moisturizing High (Control) Low Moisturizing ( Experimental group ) p -value Number of samples 13 13 Age, mean ± SD 40.1 ± 4.1 40.4 ± 4.9 0.863 Clinical score wrinkle 4.31 ± 1.38 4.23 ± 1.36 0.887 Pigmentation 2.85 ± 1.28 2.69 ± 1.18 0.762 ^ Skin hydration (a.u.) 78.14 + - 2.50 34.10 ± 3.85 <0.001 ^ Bright
Skin color Brightness ^* ) 64.59 + - 2.55 61.90 + - 2.53 0.012 The degree of redness ^* ) 8.02 ± 1.92 9.19 ± 1.52 0.169 ^ Yellow degree (b ^* ) 18.25 + 1.15 16.62 ± 1.98 0.017 ITA  ° 38.41 + - 4.90 35.30 ± 4.78 0.115 Dark
Skin color
Brightness ^* ) 59.82 + - 2.35 56.86 ± 3.03 0.010 The degree of redness ^* ) 10.47 ± 1.76 11.88 ± 1.64 0.045 Yellow degree (b ^* ) 18.95 ± 1.57 17.44 ± 2.45 0.077 ITA  ° 27.37 + - 6.64 20.92 8.49 0.041

p-value : significance by individual t-test (p <0.05), ^: Mann-Whitney test.

The degree of wrinkle of the subject was determined by a visual inspection by a specialist after the photography (facial stage DM3, Minolta, Japan) based on the visual assessment of the cosmetic evaluation method (KFDA standard) Value (7 points) and lowest value (2 points). Grades of wrinkled skin and less wrinkled skin were repeatedly measured and their mean values were calculated.

The ITA value reflects the whiteness of the skin. The ITA value can be calculated using the L ^* value indicating the skin brightness and the b ^* value (melanization parameter) indicating the degree of melanin. The ITA value calculation formula is as follows. In particular, the larger the value of ITA °, the brighter the skin color (ITA ° = [Arc tan (L ^* - 50) / b ^* ] x 180 / π), L ^* : Brightness factor; Brightness, b ^* : color factor; Blue - yellow). The skin color (L ^* , a ^* , b ^* ) was measured using a Minolta spectrophotometer (CM2600d, Minolta, Japan). The skin of the bright area and the skin of the dark area were repeatedly measured and their average values were calculated. Skin measurement data were statistically treated by independent t-test ( p <0.05) and Mann-Whitney test using SPSS software (Ver. 22.0).

Example  2. From saliva  DNA sampling

Twenty-six saliva samples were collected through Example 1. The saliva was collected twice, and the first saliva was collected after the subject was fasted one hour before harvesting, and the second saliva was obtained immediately after the morning wake.

High purity genomic DNA (gDNA) was extracted from the saliva of the subject using an Oragene® saliva kit. Then, an intact gDNA band having an OD 260/280> 1.7, 10 ng / ㎕ or more in a 1 x TAE 1% agarose gel was identified, and a gene analysis experiment was conducted.

Example  3. Whole genome sequencing.

50 ng of the gDNA isolated in Example 2 was used for target amplification according to the manual of Ion AmpliSeq Exome kit (Life Technologies).

The Ion Torrent adapter-ligated library was then constructed according to the Ion AmpliSeq ™ Library 2.0 (Life Technologies) protocol (Part # 4475345 Rev. B). Each of the amplicons was partially digested primer sequences and ligated to Ion Torrent adapters P1 and A using DNA ligase.

Then, the library was separated using an AMPure bead (Beckman Coulter). Library Quantification Kit (LifeTechnologies) and Agilent High Sensitivity DNA Kit (Agilent Technologies) were used to evaluate the quantity and quality of each of the separate libraries.

Emulsion PCR was performed using Ion PI Template OT2 200 kit v2 and OneTouch 2 instrument (Life Technologies). Enrichment of template-positive ion spheres (ISP) on the Ion PI chip was performed using the Ion OneTouch ES enrichment system (Life Technologies). Ion PI chips were prepared and loaded according to the manual. We used the Ion Torrent platform-specific pipeline software (Torrent Suite v4.0) to align sequences with the hg19 human genome reference, perform target-region coverage analysis, and filter and remove poor signal reads.

Example  4. Bioinformatics analysis and statistical processing

Sequence alignment with human genome reference (hg19) was performed using TMAP (Torrent Suite version: 4.0.2).

Base quality recalibration, indel realignment and variant calling were performed using GATK (Genome Analysis Toolkit, version: 2.3.9). Variations were annotated using the SnpEff program (http://snpeff.sourceforge.net/) (ref. Snpeff) and the databases of the 1000 Genomes Project and NCBI dbSNP. We also analyzed all possible non-synonymous single-nucleotide variants (nsSNVs) in the whole-exome region using the dbNSFP database (https://sites.google.com/site/ jpopgen / dbNSFP) (ref. DbNSFP).

In order to filter the short read, if the quality scorer was less than 9 at the window size of 30, one base pair at the end of the short read sequence was removed. After SNP calling, heterozygous SNPs with a depth of < 10 and homozygous SNPs with a depth of < 5 were filtered.

SNPs with minor allele frequency (MAF) of <5% and SNPs with a call rate of <95% were tested for SNP quality control using the PLINK program (http://pngu.mgh.harvard.edu/) ~ purcell / plink) (Ver 1.07) (ref. plink). After SNP filtering, we analyzed the relationship between skin color and SNP that passed through filtering using logistic regression additive model (one degree of freedom).

As a result, a total of 387 SNPs showed high significance and existed in ZNF100, OR10K2, TMEM235, PRCP, TIPIN, CFH, PIDD, CFH, AMER3, NAALADL2, EXOC2, KHDC1, LMBR1, TELO2, RAB31 and SNRPA genes (Table 3). The flanking sequences of the above 20 genes are shown in Table 4. &lt; tb &gt; &lt; TABLE &gt;

Top 20 SNPs Chr . Position Func . Gene rs  Number Alleles (A / B) RA RAF OR P Case Control chr19 21950337 5'UTR ZNF100 rs10412066 C / G C 0.46 0.12 40 0.002741 chrl 158389659 down OR10K2 rs58605957 C / T C 0.38 0.08 18.33 0.004052 chrl 158390252 syn OR10K2 rs12239443 G / T G 0.38 0.08 18.33 0.004052 chrl 158390501 syn OR10K2 rs34616883 A / G A 0.38 0.08 18.33 0.004052 chr17 76230729 syn TMEM235 rs11077350 C / T C 0.46 0.12 17.09 0.004652 chr11 82560312 intron PRCP rs10792653 G / T T 0.88 0.5 0.06282 0.005198 chr15 66644563 intron TIPIN rs9806130 A / G A 0.46 0.15 27 0.006101 chrl 196682947 syn CFH rs2274700 A / G A 0.58 0.15 22.48 0.007674 chr11 804212 syn PIDD rs7104785 A / C C 0.88 0.62 0.09 0.009694 chrl 196642072 intron CFH rs551397 T / C T 0.54 0.15 10.67 0.009868 chrl 196642233 missense CFH rs800292 A / G A 0.54 0.15 10.67 0.009868 chr2 131520178 missense AMER3 rs77687733 G / C G 0.35 0.08 12.38 0.009929 chr3 175164937 intron NAALADL2 rs79180420 G / A A H 0.65 0.08081 0.009929 chr6 619600 intron EXOC2 rs1150856  C / A C 0.35 0.08 12.38 0.009929 chr6 73952103 intron KHDC1 rs6453660 C / A A 0.92 0.65 0.08081 0.009929 chr6 73952118 intron KHDC1 rs6453661 G / A A 0.92 0.65 0.08081 0.009929 chr7 156480633 intron LMBR1 rs3757433 A / G G 0.92 0.65 0.08081 0.009929 chr16 1552570 intron TELO2 rs58893598  A / G G 0.92 0.65 0.08081 0.009929 chr18 9775372 intron RAB31 rs6506697 A / G A 0.42 0.15 12.38 0.009929 chr19 41263403 syn SNRPA rs2230694 G / A A 0.92 0.65 0.08081 0.009929

Abbreviations: Chr., Chromosome; Func, SNP function (fuction); Frq, frequency; RA, risk allele; OR, odds ratio.

See NCBI build 37 for genome location.

In the experimental group-control analysis, the p-value was calculated using logistic regression.

In Alleles (A / B), A represents minor allele and B represents major allele.

RA is the predominant base in low-moisturizing skin.

Gene rs  Number Alleles (A / B) Flanking sequence ZNF100 rs10412066 C / G forward CCCTAGGAGCAGAAGACACAGAGAA [C / G] TGAGAGCAAACCTGGAGCTCCGGCT (SEQ ID NO: 1) OR10K2 rs58605957 C / T forward TCAGGTGATCCACCTGTCTCAGCCT [C / T] CCAAAATGCTGGGATTACAGTCGTG (SEQ ID NO: 2) OR10K2 rs12239443 G / T forward GTCCCATACACACCCCATGTCCCAT [G / T] AGCACTGAGTAGCGCAGTGGGTTAC (SEQ ID NO: 3) OR10K2 rs34616883 A / G forward AGTACATGGGGATATGAAGGGCCCT [A / G] TCCAGGACAATGGTGGAAATGATGA (SEQ ID NO: 4) TMEM235 rs11077350 C / T forward CCCTGAGCCTGGTCCTTCTCGTGTG [C / T] GGCTGGATCTGCGGCCTGCTCAGCT (SEQ ID NO: 5) PRCP rs10792653 G / T forward TCTAAAAAGTACTGGTCAACAGATG [G / T] CTTTACAGATCATTTATTCTTCACA (SEQ ID NO: 6) TIPIN rs9806130 A / T forward TCCTGACTCTGGTGAAACAAACCAC [A / G] ATTCAGTATTACTGTACTTAAATGA (SEQ ID NO: 7) CFH rs2274700 A / T forward CATATCCTAGTTTGCATTGATATTT [A / G] GCTTTTTCTTTTAAGGCATATGTAT (SEQ ID NO: 8) PIDD rs7104785 A / C reverse TGCACCTGTGTGTCCAGCAGCCTCT [G / T] CAGCTGCTGCAGGTGGAATTCTTGC (SEQ ID NO: 9) CFH rs551397 T / C reverse TAAAAACAAAATAAGTGCATAAAGT [A / G] TCTATTTAAATGTACAGTATATTTA (SEQ ID NO: 10) CFH rs800292 A / G reverse TCTCCCTTCCTGCATACCATTATTA [C / T] ATTTCCAAGAGATCTATATCCAGGG (SEQ ID NO: 11) AMER3 rs77687733 G / C forward AAGACTGAGGACTTGGCCTCGCTGG [C / G] GGCCGAGGGGAAAAGCCTGCCCTCC (SEQ ID NO: 12) NAALADL2 rs79180420 G / A forward TAAACTTACCAGTCATAATTTAAAT [A / G] CTTATTACAGATAACTTTTCCTTAA (SEQ ID NO: 13) EXOC2 rs1150856 C / A reverse TTATACTGGATACTTAGTGATACCT [G / T] TTCCATTTTTGTCATAATAACCATT (SEQ ID NO: 14) KHDC1 rs6453660 C / A forward AAAACTGAGAAGACAAGGATGAAGA [A / C] GGGGACGTGGGCAAAGGCCACTCAC (SEQ ID NO: 15) KHDC1 rs6453661 G / A forward AGGATGAAGAAGGGGACGTGGGCAA [A / G] GGCCACTCACCGAAGATGAGCTCCT (SEQ ID NO: 16) LMBR1 rs3757433 A / G reverse ATTACATCTTCAGCTATTTAGTTTC [C / T] CAAATTTGTAAAACCTTAGAGGTCA (SEQ ID NO: 17) TELO2 rs58893598 A / G forward GGCCTCTGCTGGGGTGGGTGGCTCC [A / G] GCCCTGTGAGCCTCGGTGAGGCCTC (SEQ ID NO: 18) RAB31 rs6506697 A / G forward ACTATTGGGTAAGTTCCTGTATGTC [A / G] TTCTCCTTCGCGTTGCTTCCTTTCA (SEQ ID NO: 19) SNRPA rs2230694 G / A forward TGCAGGGTTTCCCTTTCTATGACAA [A / G] CCTATGGTGAGCATTGCGGGTACGG (SEQ ID NO: 20)

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the spirit and scope of the present invention as defined by the appended claims.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Single nucleotide polymorphism markers for determining of          probability of skin hydration and use thereof <130> KPA151120-KR <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10412066 <400> 1 ccctaggagc agaagacaca gagaastgag agcaaacctg gagctccggct 51 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs58605957 <400> 2 tcaggtgatc cacctgtctc agcctyccaa aatgctggga ttacagtcgt g 51 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs12239443 <400> 3 gtcccataca caccccatgt cccatkagca ctgagtagcg cagtgggtta c 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs34616883 <400> 4 agtacatggg gatatgaagg gccctrtcca ggacaatggt ggaaatgatg a 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11077350 <400> 5 ccctgagcct ggtccttctc gtgtgyggct ggatctgcgg cctgctcagc t 51 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10792653 <400> 6 tctaaaaagt actggtcaac agatgkcttt acagatcatt tattcttcac a 51 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs9806130 <400> 7 tcctgactct ggtgaaacaa accacrattc agtattactg tacttaaatg a 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2274700 <400> 8 catatcctag tttgcattga tatttrgctt tttcttttaa ggcatatgta t 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs7104785 <400> 9 tgcacctgtg tgtccagcag cctctkcagc tgctgcaggt ggaattcttg c 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs551397 <400> 10 taaaaacaaa ataagtgcat aaagtrtcta tttaaatgta cagtatattt a 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs800292 <400> 11 tctcccttcc tgcataccat tattayattt ccaagagatc tatatccagg g 51 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs77687733 <400> 12 aagactgagg acttggcctc gctggsggcc gaggggaaaa gcctgccctc c 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs79180420 <400> 13 taaacttacc agtcataatt taaatrctta ttacagataa cttttcctta a 51 <210> 14 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1150856 <400> 14 ttatactgga tacttagtga tacctkttcc atttttgtca taataaccat t 51 <210> 15 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6453660 <400> 15 aaaactgaga agacaaggat gaagamgggg acgtgggcaa aggccactca c 51 <210> 16 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6453661 <400> 16 aggatgaaga aggggacgtg ggcaarggcc actcaccgaa gatgagctcc t 51 <210> 17 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3757433 <400> 17 attacatctt cagctattta gtttcycaaa tttgtaaaac cttagaggtc a 51 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs58893598 <400> 18 ggcctctgct ggggtgggtg gctccrgccc tgtgagcctc ggtgaggcct c 51 <210> 19 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs6506697 <400> 19 actattgggt aagttcctgt atgtcrttct ccttcgcgtt gcttcctttc a 51 <210> 20 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2230694 <400> 20 tgcagggttt ccctttctat gacaarccta tggtgagcat tgcgggtacg g 51

Claims (11)

A marker for skin moisturizing degree diagnosis comprising at least one single base polymorphic marker selected from single nucleotide polymorphism (SNP) markers shown in Table 3.
The marker for skin moisturizing degree diagnosis according to claim 1, wherein the marker for skin moisturizing degree diagnosis comprises at least one of at least one base sequence selected from the group consisting of SEQ ID NOS: 1 to 20, a polynucleotide comprising 5 to 51 consecutive DNA sequences, Nucleotides, or polynucleotides complementary thereto,
(i) the 26th base of SEQ ID NO: 1 is C or G,
(ii) the 26th base of SEQ ID NO: 2 is C or T,
(iii) the 26th base of SEQ ID NO: 3 is G or T,
(iv) the 26th base of SEQ ID NO: 4 is A or G,
(v) the 26th base of SEQ ID NO: 5 is C or T,
(vi) the 26th base of SEQ ID NO: 6 is G or T,
(vii) the 26th base of SEQ ID NO: 7 is A or G,
(viii) the 26th base of SEQ ID NO: 8 is A or G,
(ix) the 26th base of SEQ ID NO: 9 is A or C,
(x) the 26th base of SEQ ID NO: 10 is T or C,
(xi) the 26th base of SEQ ID NO: 11 is A or G,
(xii) the 26th base of SEQ ID NO: 12 is G or C,
(xiii) the 26th base of SEQ ID NO: 13 is G or A,
(xiv) the 26th base of SEQ ID NO: 14 is C or A,
(xv) the 26th base of SEQ ID NO: 15 is C or A,
(xvi) the 26th base of SEQ ID NO: 16 is G or A,
(xvii) the 26th base of SEQ ID NO: 17 is A or G,
(xviii) the 26th base of SEQ ID NO: 18 is A or G,
(xix) the 26 &lt; th &gt; base of SEQ ID NO: 19 is A or G
(xx) the 26 &lt; th &gt; base of SEQ ID NO: 20 is G or A,
Marker for skin moisturizing degree diagnosis.
A composition for diagnosing skin moisturizing degree, comprising a probe capable of detecting the marker for skin moisturizing degree diagnosis of claim 1 or 2 or an agent capable of amplifying the probe.
A kit for diagnosing the degree of skin moisturization comprising the composition of claim 3.
The kit for diagnosing skin moisturization according to claim 4, wherein the kit is an RT-PCR kit or a DNA chip kit.
A microarray for skin moisturizing degree diagnosis comprising the polynucleotide of claim 1 or 2.
(a) amplifying or hybridizing a polymorphic site of the single base polymorphic marker of claim 1 or 2 from a DNA obtained from a sample of a separated individual; And
(b) identifying a base of the amplified or hybridized polymorphic site of step (a).
8. The method according to claim 7, wherein at least one single base polymorphism marker among the nucleotide sequences identified in step (b)
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is C;
In the polynucleotide described in SEQ ID NO: 2, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is A;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 7, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 14, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is A;
16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is A;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 18, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 19, when the 26th base is A; or
20. A method for providing information for diagnosis of skin moisturizing degree, comprising the step of judging that the polynucleotide of SEQ ID NO: 20 is dry skin when the 26th base is A.
8. The method according to claim 7, wherein at least one single base polymorphism marker among the nucleotide sequences identified in step (b)
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 2, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 7, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 14, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 16, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 18, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 19, when the 26th base is G; or
20. A method for providing information for diagnosis of skin moisturizing degree, comprising the step of judging that the polynucleotide of SEQ ID NO: 20 is a moist skin when the 26th base is G.
8. The method of claim 7, wherein the sample is hair, urine, blood, various body fluids, isolated tissue, isolated cells or saliva.
8. The method of claim 7, wherein amplification and identification of the polymorphic site utilizes a SNP chip.