KR20170049768A - Single nucleotide polymorphism markers for determining of skin color and melanism sensitivity and use thereof - Google Patents

Abstract

The present invention relates to a skin color or blackening sensitivity diagnostic marker comprising one or more single base polymorphic markers selected from single base polymorphism (SNP) markers capable of determining skin color and blackening sensitivity, a probe capable of detecting the marker, A kit comprising the composition, or a microarray, and a method for providing information for diagnosis of skin color or blackening sensitivity using the marker.
The single nucleotide polymorphic marker of the present invention is a marker capable of diagnosing the skin color and the blackening sensitivity of each individual, and can give information on the accurate skin type to the individual. Thus, And can be used to develop customized cosmetics according to skin characteristics.

Description

Single nucleotide polymorphism markers for diagnosis of skin color and blackening sensitivity and their use

The present invention relates to a composition comprising a single nucleotide polymorphism (SNP) marker capable of determining the skin color or skin's blackening sensitivity, a probe capable of detecting the marker or an amplifiable agent, And a method of providing information for diagnosis of skin color or blackening sensitivity using the marker.

It is known that human skin color and skin blackening sensitivity are determined by the type of melanin, the amount of melanin, and its distribution, which are controlled by various factors such as the genetic and endocrinological factors of the individual and the environment in which the individual is present. Of these various factors, genetic factors are known to be the most powerful determinant of skin color and skin blackening sensitivity.

However, until now, the judgment of the individual's skin color, etc., mainly grasps skin condition through simple skin test and simple skin test, and it is difficult to obtain complete trust in individual skin condition information.

For example, the method of measuring changes in erythema or skin color using a mexameter and a colorimeter is simply a numerical representation of the physical state of the skin surface. In this case, Since the numerical value can be changed, there is a fear that an error may occur in evaluating the small improvement degree of the testee. In addition, in the case of the visual evaluation of the tester and the evaluation of the questionnaire by the tester, the subjective aspect greatly affects and it is difficult to evaluate the subject's skin condition objectively and precisely.

On the other hand, from the viewpoint of efficacy, effective substances for controlling the skin color of the presently marketed product and for preventing blackening of the skin and compositions containing the same are not intended to be individual, but are universal. Therefore, .

Therefore, there is almost no system to provide a customized cosmetics by precisely diagnosing skin color and skin blackening sensitivity by approaching scientific basis.

Under these circumstances, the inventors of the present invention have made efforts to understand the genetic characteristics of human skin color and UV-induced blackening sensitivity, develop a personalized active ingredient on the basis thereof, and contribute to the development of customized cosmetics for each skin gene , Skin color, and blackening sensitivity, and identifying a method for diagnosing the single nucleotide polymorphism marker, thereby completing the present invention

It is an object of the present invention to provide a single nucleotide polymorphism (SNP) marker capable of determining skin color or blackening sensitivity.

Another object of the present invention is to provide a composition for skin color or blackening sensitivity diagnosis comprising a probe capable of detecting the skin color or blackening sensitivity diagnostic marker or an amplifiable agent.

It is another object of the present invention to provide a skin color or blackening sensitivity diagnostic kit or microarray comprising the skin color or blackening sensitivity diagnostic composition.

It is another object of the present invention to provide a method for providing information for diagnosis of skin color or blackening sensitivity, which comprises identifying a polymorphic site of the single base polymorphism marker.

In one aspect, the present invention provides a single nucleotide polymorphism (SNP) marker capable of determining skin color or blackening sensitivity.

In the present invention, the term " polymorphism " refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base differs from a polymorphism region to a single base polymorphism (single nucleotide polymorphism, SNP). The term " single base polymorphism marker " in the present invention means a polynucleotide comprising a sequence having a single base polymorphism, through which skin color or blackening sensitivity can be determined. Preferred polymorphic markers have two or more alleles exhibiting an incidence of 1% or more, more preferably 10% or 20% or more, in the selected population.

In the present invention, the term " allele " refers to various types of a gene existing at the same gene locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

In the present invention, the term " rs_id " means rs-ID, which is an independent marker assigned to all SNPs initially registered by the NCBI that has started accumulating SNP information since 1998. [ The rs_id indicates the SNP marker of the present invention.

In the present invention, the term "skin color" refers to the skin color of an individual to be measured or diagnosed, and specifically refers to the degree of lightness and darkness of the skin. The term " blackening sensitivity " do. The single base polymorphism marker of the present invention can be used to evaluate skin color or blackening sensitivity of a subject by collecting a sample from an individual to be measured for skin color or blackening sensitivity.

In a specific embodiment of the present invention, the present inventors measured the skin type of the subject by using an ITA (lightness) value and a L ^* (lightness) value based on the ITA (individula typological angle) value of the pigmented region measured using a spectrophotometer And a dark skin with an average L value of 62.72 and an average ITA value of 6.39 and an average L value of 52.07.

Since the single base polymorphism marker of the present invention enables accurate measurement of skin color or blackening sensitivity, information on the changed skin color or blackening sensitivity of the skin contacted with the active ingredient can be given. Specifically, for example, when the L value is 52 or less, it can be judged that the dark skin and the blackening sensitivity are low, and it is possible to use the single base polymorphism marker of the present invention without measuring the skin type of the subject using a spectrophotometer or the like So that it can be measured and diagnosed more precisely.

Specifically, the single nucleotide polymorphism marker may be at least one single nucleotide polymorphism marker selected from the single nucleotide polymorphism markers shown in Table 3. More specifically, the single nucleotide polymorphism markers may include one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight Or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, May be a base polymorphism marker. The single nucleotide polymorphism markers shown in Table 3 above may be used to determine skin color or degree of blackening sensitivity.

Whether or not the skin color or blackening sensitivity of the single nucleotide polymorphic marker of the present invention was diagnosed was determined by measuring the frequency of each marker. Such significance may be characterized by p-values such as less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001. Specifically, the p-value may be less than 0.01, and more specifically, the p-value may be less than 0.001, but is not limited thereto.

The skin color or blackening sensitivity diagnostic marker may be a polynucleotide comprising as a SNP the 26th base out of at least one base sequence selected from the group consisting of SEQ ID NOS: 1 to 19 and consisting of 5 to 51 consecutive DNA sequences, (Ii) the 26 th base of SEQ ID NO: 2 is A or G, (iii) the nucleotide sequence of SEQ ID NO: 3 is 26 or 26, (Iv) the 26th base of SEQ ID NO: 4 is C or G, (v) the 26th base of SEQ ID NO: 5 is T or A, (vi) the 26th base of SEQ ID NO: (Viii) the 26th base of SEQ ID NO: 7 is C or T, (viii) the 26th base of SEQ ID NO: 8 is A or C, Or T, (x) the 26th base of SEQ ID NO: 10 is G or A, (xi) (Xii) the 26th base of SEQ ID NO: 12 is A or G, (xiii) the 26th base of SEQ ID NO: 13 is G or A, (xiv) the base of SEQ ID NO: 14 is T or C, (Xvi) the 26th base of SEQ ID NO: 16 is T or C, (xvii) the 26th base of SEQ ID NO: 17 is T or C, The base is C or A, (xviii) the 26th base of SEQ ID NO: 18 is A or C, and (xix) the 26th base of SEQ ID NO: 19 is C or T .

Specifically, the skin color or blackening sensitivity diagnostic marker may be at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 selected from the group consisting of SEQ ID NOS: Of the nucleotide sequences of SEQ ID NOs: 11 to 12, 13 to 14, 15 to 16, 17 to 18, or 19 out of 19 nucleotide sequences, comprising SNPs of 5 to 51 consecutive DNA sequences , Or a polynucleotide complementary to the polynucleotide.

The skin color or blackening sensitivity diagnostic marker may be a polynucleotide consisting of 5 to 51 consecutive DNA sequences including the 35755658 base, wherein the 35755658th base of human chromosome 6 is G or A; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 10549184 base, wherein the 10549184 base of human chromosome 17 is A or G; A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 125299830 base, wherein the 125299830 base of human chromosome 12 is T or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 21205606 base, wherein the 21205606 base of human chromosome 17 is C or G; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 57924586 base as 57924586 base of human chromosome 15 is T or A; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 9019429 base, wherein 9019429 base of human chromosome 19 is C or T; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 80006504 base, wherein 80006504 base of human chromosome 17 is C or T; A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 131825050 base, wherein the 131825050 base of human chromosome 5 is A or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 135602421 base, wherein the 135602421 base of human chromosome 8 is A or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 18720057 base, wherein the 18720057 base of human chromosome 12 is C or T; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 18747387 base, wherein the 18747387 base of human chromosome 12 is G or A; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the above 18747528 base, wherein 18747528 base of human chromosome 12 is T or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53070145 base, wherein the 53070145 base of human chromosome 12 is A or G; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53071560 base, wherein the 53071560 base of human chromosome 12 is G or A; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53090190 base, wherein the 53090190 base of human chromosome 12 is T or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53091566 base, wherein the 53091566 base of human chromosome 12 is A or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 6679563 base, wherein the 6679563 base of human chromosome 19 is T or C; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 116224940 base, wherein the 116224940 base of human chromosome 1 is C or A; A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 116225180 base, wherein the 116225180 base of human chromosome 1 is A or C; A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 46619071 base, wherein 46619071 base of human chromosome 13 is C or T; And complementary polynucleotides thereof, and at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13 , 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more or 20 polynucleotides.

The present inventors have confirmed through the following proof that the SNP is a skin color or blackening sensitivity diagnostic marker.

Specifically, the degree of skin color or blackening sensitivity was determined based on the ITA value and the L ^* value of the subject's pigmentation region, and 13 subjects having the highest values at the both extremities were selected as the experimental group (case) and 13 subjects having the lowest value as the control group (control) (Table 2).

Next, genomic DNA (gDNA) was extracted from the saliva of the above-mentioned classified individuals, and the SNPs having the significance in skin color or blackening sensitivity were classified by comparing the sequence with the hg19 human genome reference (control group) Table 3). SNPs capable of diagnosing such skin color or degree of blackening sensitivity were first identified by the present inventors.

In another aspect, the present invention provides a composition for skin color or blackening sensitivity diagnosis, which comprises a probe capable of detecting the skin color or blackening sensitivity diagnostic marker or an amplifiable agent.

The term " probe capable of detecting a skin color or blackening sensitivity diagnostic marker "in the present invention refers to a composition capable of diagnosing skin color or blackening sensitivity by specifically hybridizing with a polymorphic site of such a gene And the specific method of such gene analysis is not particularly limited and may be by any gene detection method known in the art to which this invention belongs.

The term " agent capable of amplifying a marker for skin color or blackening sensitivity diagnosis "in the present invention means a composition capable of diagnosing skin color or blackening sensitivity by confirming a polymorphic site of such a gene through amplification, Means a primer capable of specifically amplifying the polynucleotide of the skin color or blackening sensitivity diagnostic marker.

The primers used for the polymorphic marker amplification can be amplified using appropriate conditions in suitable buffers (e.g., four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotides that can serve as the starting point of synthesis. The appropriate length of the primer may vary depending on the purpose of use, and is usually, but not limited to, 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

The term "primer" in the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. PCR amplification can be performed to predict skin type through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The probes or primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution with an equivalent of one or more natural nucleotides, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In another aspect, the present invention provides a skin color or blackening sensitivity diagnostic kit comprising the skin color or blackening sensitivity diagnostic composition.

The kit may be an RT-PCR kit or a DNA chip kit.

The kit of the present invention can diagnose skin color or blackening sensitivity by confirming the SNP polymorphism marker as a skin color or blackening sensitivity diagnostic marker by amplification or by confirming the expression level of SNP polymorphism marker with the expression level of mRNA.

As a specific example, in the present invention, the kit for measuring the mRNA expression level of the marker for skin color or blackening sensitivity sensitivity may be a kit containing necessary elements necessary for performing RT-PCR. The RT-PCR kit contains test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentrations), deoxynucleotides (dNTPs), Taq (dNTPs), as well as respective primer pairs specific for the genes of the skin color or darkening sensitivity diagnostic marker Enzymes such as polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control. Also preferably, the kit of the present invention may be a skin color or blackening sensitivity diagnostic kit containing essential elements necessary for carrying out a DNA chip.

DNA chip kits are those in which nucleic acid species are attached in a gridded array on a generally flat solid support plate, typically a glass surface not larger than a slide for a microscope, and nucleic acids are uniformly arranged on the chip surface, Hybridization reaction occurs between the nucleic acid on the surface and the complementary nucleic acid contained in the solution treated on the surface of the chip to enable a mass parallel analysis.

In another aspect, the present invention provides a microarray for skin color or blackening sensitivity diagnosis comprising the polynucleotide of the skin color or blackening sensitivity diagnostic marker.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms.

The probe of the present invention can detect an allele and can be used for diagnosis of skin type and the like. The diagnostic methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 0 C may be suitable for allele-specific probe hybridization.

Immobilization on the substrate of the probe polynucleotide associated with the skin diagnosis of the present invention can also be easily made using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray and detecting The hybridization result can be detected by detecting the generated signal.

In another aspect, the present invention provides a method for amplifying a polynucleotide comprising: (a) amplifying or hybridizing a polymorphic site of the single nucleotide polymorphic marker from DNA obtained from a sample of the isolated individual; And (b) identifying the base of the amplified or hybridized polymorphic site of step (a). ≪ Desc / Clms Page number 2 >

The term "individual" of the present invention means a subject to be tested for diagnosis of skin color or blackening sensitivity. DNA can be obtained from the sample, such as hair, urine, blood, various body fluids, isolated tissues, isolated cells or saliva, but is not limited thereto.

The method of obtaining the genomic DNA of step (a) may be any method known to those skilled in the art.

The amplification of the polymorphic site of the single nucleotide polymorphic marker from the DNA obtained in step (a) or hybridization with the probe may be performed by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. USA 86, 1173 (1989)), self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA).

In order to determine the base of the polymorphic site of step (b), sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specifichybridization, DASH), PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing method, Bio- But are not limited to, the BioRad system, the CEQ and SNPstream system (Beckman), the Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium assay) Do not. One or more of the alleles in a polymorphic marker can be identified, including microsatellite, SNP or other types of polymorphic markers, by such methods or by other methods available to those skilled in the art to which the invention pertains. The base of such a polymorphic site can be determined preferably through a SNP chip.

The term "SNP chip" in the present invention means one of DNA microarrays capable of confirming each base of several hundred thousand SNPs at a time.

The TaqMan method comprises the steps of: (1) designing and constructing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

In the above, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer. The allele-specific PCR means a PCR method in which a DNA fragment in which the SNP is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the SNP is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, In the case where the base at the SNP position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single base polymorphism is located is amplified by a pair of primers, and all nucleotides added to the reaction are deactivated by dephosphorylation, and SNP- specific extension primers, a dNTP mixture, a digoxin nucleotide, a reaction buffer, and a DNA polymerase to perform a primer extension reaction. At this time, the extension primer has a base immediately adjacent to the 5 'direction of the base in which the SNP is located at the 3' terminus, and the nucleic acid having the same base as the dodecoxynucleotide is excluded in the dNTP mixture, and the dodecoxynucleotide indicates the SNP Base type. For example, when dGTP, dCTP and dTTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer in the substituted base is extended by DNA polymerase, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the type of the base representing the SNP by comparing the lengths of the extended primers.

At this time, as a detection method, when the extension primer or the dideoxy nucleotide is fluorescence-labeled, the SNP is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 of ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the didyxin nucleotide are used, the SNP can be detected by measuring the molecular weight using MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The method for providing information for skin color or blackening sensitivity diagnosis is not limited thereto, but it is preferable that at least one of the single nucleotide polymorphic markers among the nucleotide sequences identified in step (b) is a polynucleotide of SEQ ID NO: 1 , When the 26th base is G; In the polynucleotide described in SEQ ID NO: 2, when the 26th base is G; In the polynucleotide of SEQ ID NO: 3, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is G; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T; In the polynucleotide of SEQ ID NO: 6, when the 26th base is C; In the polynucleotide described in SEQ ID NO: 7, when the 26th base is C; In the polynucleotide of SEQ ID NO: 8, when the 26th base is A; In the polynucleotide of SEQ ID NO: 9, when the 26th base is T; In the polynucleotide of SEQ ID NO: 10, when the 26th base is A; In the polynucleotide of SEQ ID NO: 11, when the 26th base is C; In the polynucleotide of SEQ ID NO: 12, when the 26th base is G; In the polynucleotide of SEQ ID NO: 13, when the 26th base is A; In the polynucleotide of SEQ ID NO: 14, when the 26th base is C; In the polynucleotide of SEQ ID NO: 15, when the 26th base is C; 16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is T; In the polynucleotide of SEQ ID NO: 17, when the 26th base is A; 18. The polynucleotide according to SEQ ID NO: 18, wherein the 26th base is C; Or determining that the polynucleotide of SEQ ID NO: 19 is dark skin having an L value of 52 or less and has a low blackening sensitivity when the 26 < th > base is T.

Further, in the polynucleotide of SEQ ID NO: 1, when the 26th base is A; In the polynucleotide of SEQ ID NO: 2, when the 26th base is A; In the polynucleotide of SEQ ID NO: 3, when the 26th base is C; In the polynucleotide described in SEQ ID NO: 4, when the 26th base is C; In the polynucleotide described in SEQ ID NO: 5, when the 26th base is A; In the polynucleotide of SEQ ID NO: 6, when the 26th base is T; In the polynucleotide described in SEQ ID NO: 7, when the 26th base is T; In the polynucleotide of SEQ ID NO: 8, when the 26th base is C; In the polynucleotide of SEQ ID NO: 9, when the 26th base is C; In the polynucleotide of SEQ ID NO: 10, when the 26th base is G; In the polynucleotide of SEQ ID NO: 11, when the 26th base is T; In the polynucleotide of SEQ ID NO: 12, when the 26th base is A; In the polynucleotide of SEQ ID NO: 13, when the 26th base is G; In the polynucleotide of SEQ ID NO: 14, when the 26th base is T; In the polynucleotide of SEQ ID NO: 15, when the 26th base is A; In the polynucleotide of SEQ ID NO: 16, when the 26th base is C; In the polynucleotide of SEQ ID NO: 17, when the 26th base is C; In the polynucleotide of SEQ ID NO: 18, when the 26th base is A; Or determining that the polynucleotide of SEQ ID NO: 19 is a bright skin having an L value of more than 52 when the 26th base is C, and that the blackening sensitivity is high.

Furthermore, when the single nucleotide polymorphism marker of at least one out of the nucleotide sequences identified in step (b) is G, the 35755658th base of human chromosome 6 is G; Human 10549184 base of chromosome 17 is G; Human 125299830 base of chromosome 12 is T; Human 21205606 base of chromosome 17 is G; Human 57924586 base of chromosome 15 is T; The 9019429 base of human chromosome 19 is C; The 80006504 base of human chromosome 17 is C; Human 131825050 base of chromosome 5 is A; The 135602421 base of human chromosome 8 is A; The 18720057th base of human chromosome 12 is T; When human 18747387 base of chromosome 12 is A; Human 18747528 base of chromosome 12 is C; Human 53070145 base of chromosome 12 is G; Human 53071560 base of chromosome 12 is A; Human 53090190 base of chromosome 12 is C; Human 53091566 base of chromosome 12 is C; The 6679563th base of human chromosome 19 is T; When the 116224940 base of human chromosome 1 is A; The 116225180 base of human chromosome 1 is C; Or if the human 46619071 base of chromosome 13 is T, it is determined that the L value is darker than 52 and that the blackness sensitivity is low.

When at least one single base polymorphism marker among the nucleotide sequences identified in the step (b) is A, the 35755658th base of human chromosome 6 is A; When human 10549184 base of chromosome 17 is A; Human 125299830 base of chromosome 12 is C; Human 21205606 base of chromosome 17 is C; The 57924586th base of human chromosome 15 is A; The 9019429 base of human chromosome 19 is T; The 80006504 base of human chromosome 17 is T; Human 131825050 base of chromosome 5 is C; Human 135602421 base of chromosome 8 is C; Human 18720057 base of chromosome 12 is C; Human 18747387 base of chromosome 12 is G; When human 18747528 base of chromosome 12 is T; The 53070145 base of human chromosome 12 is A; Human 53071560 base of chromosome 12 is G; Human 53090190 base of chromosome 12 is T; The 53091566 base of human chromosome 12 is A; The 6679563th base of human chromosome 19 is C; The 116224940 base of human chromosome 1 is C; When the 116225180 base of human chromosome 1 is A; Or if the human 46619071 base of chromosome 13 is C, it is determined that the L value is greater than 52 and that the skin has a high blackening sensitivity.

The nucleotide sequence identified in step (b) may include at least one selected from the nucleotide sequences of SEQ ID NOS: 1 to 19, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 , 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, or 18 or more Base polymorphism markers, or one or more selected from among 20 SNPs specified by the positions on the human chromosome, two or more, three or more, four or more, five or more, six or more, seven More than 8 species, more than 9 species, more than 10 species, more than 11 species, more than 12 species, more than 13 species, more than 14 species, more than 15 species, more than 16 species, more than 17 species, more than 18 species, more than 19 species Or 20 single base polymorphism markers.

The single nucleotide polymorphic marker of the present invention is a marker capable of diagnosing the skin color or blackening sensitivity of each individual, and can give information on the accurate skin type to the individual. Thus, And can be used to develop customized cosmetics according to skin characteristics.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified in various forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example  1: color of skin or Blackening  Classification by sensitivity and gene sampling

The present inventors conducted an experiment for about 300 healthy female subjects aged 30 to 50 years in order to establish criteria for judging skin color or blackening sensitivity by gene type and develop a personalized active ingredient (Table 1 ).

Clinical characteristics of the subjects Number of samples 300 Age (mean ± SD) 40.54 + - 4.34 female ( % ) 100% Smoking history ( % ) One% Skin Cancer History % ) 0%

If you are pregnant or breastfeeding or planning to become pregnant within 6 months, (2) you have used a skin contour containing steroids for at least one month to treat skin diseases, (3) you have not taken six months ⑤ If you have sensitive or sensitive skin, ⑤ If you have skin abnormalities such as dots, acne, erythema and capillary dilatation on the test site. ⑥ If you use the same or similar cosmetics or medicines (Eg, asthma, diabetes, hypertension, etc.), (9) have atopic dermatitis, and (9) have atopic dermatitis. ⑩ Other cases where the test was deemed difficult by the tester's decision, were excluded from the tester.

Then, 13 subjects with the highest values at the extremes were selected as the experimental group (cases) and 13 subjects with the lowest values were selected based on the ITA (Individual typological angle) and L ^* (lightness) Were selected as a control (Table 2).

Bright
( Experimental group ) Dark (control) P-value Number of samples 13 13 Age, mean ± SD 38.5 ± 0.5 41.7 ± 4.7 0.110 Clinical score wrinkle 3.69 ± 1.70 4.08 ± 1.71 0.570 Bright Skin color Brightness ^* ) 66.58 ± 1.72 63.72 + - 2.76 <0.001 The degree of redness ^* ) 6.55 ± 1.22 9.03 + - 2.21 <0.002 Yellow degree (b ^* ) 16.98 ± 1.62 17.46 ± 1.98 0.509 ITA  ° 44.29 + - 3.89 33.70 + - 6.77 <0.001 Dark Skin color Brightness ^* ) 62.72 ± 1.11 52.07 ± 1.26 <0.001 ^ The degree of redness ^* ) 9.76 ± 1.76 13.31 ± 1.81 <0.001 Yellow degree (b ^* ) 15.85 ± 1.79 18.31 ± 2.23 0.005 ITA  ° 38.86 + - 2.44 6.39 ± 3.89 <0.001 Skin hydration (a.u.) 62.22 + - 11.30 54.65 ± 11.05 0.097

P-value: significance by individual t-test (p <0.05), ^: Mann-Whitney test.

The ITA value reflects the whiteness of the skin. The ITA value can be calculated using the L ^* value indicating the skin brightness and the b ^* value (melanization parameter) indicating the degree of melanin. The ITA value calculation formula is as follows. In particular, the larger the ITA ° value, the brighter the skin color.

ITA [deg.] = [Arc tan (L ^* - 50) / b ^* ] x 180 /

L ^* : Brightness factor; brightness

b ^* : color factor; Blue-Yellow

The skin color (L ^* , a ^* , b ^* ) was measured using a Minolta spectrophotometer (CM2600d, Minolta, Japan). The skin of the bright area and the skin of the dark area were repeatedly measured and their average values were calculated. Skin measurement data were statistically analyzed by independent t-test (P <0.05) and Mann-Whitney test using SPSS software (Ver. 22.0).

Example  2. From saliva  DNA sampling

Twenty-six saliva samples were collected through Example 1. The saliva was collected twice, and the first saliva was collected after the subject was fasted one hour before harvesting, and the second saliva was obtained immediately after the morning wake.

High purity genomic DNA (gDNA) was extracted from the saliva of the subject using an Oragene® saliva kit. Then, an intact gDNA band having an OD 260/280> 1.7, 10 ng / ㎕ or more in a 1 x TAE 1% agarose gel was identified, and a gene analysis experiment was conducted.

Example  3. Whole genome sequencing.

50 ng of the gDNA isolated in Example 2 was used for target amplification according to the manual of Ion AmpliSeq Exome kit (Life Technologies).

The Ion Torrent adapter-ligated library was then constructed according to the Ion AmpliSeq ™ Library 2.0 (Life Technologies) protocol (Part # 4475345 Rev. B). Each of the amplicons was partially digested primer sequences and ligated to Ion Torrent adapters P1 and A using DNA ligase.

Then, the library was separated using an AMPure bead (Beckman Coulter). Library Quantification Kit (LifeTechnologies) and Agilent High Sensitivity DNA Kit (Agilent Technologies) were used to evaluate the quantity and quality of each of the separate libraries.

Emulsion PCR was performed using Ion PI Template OT2 200 kit v2 and OneTouch 2 instrument (Life Technologies). Enrichment of template-positive ion spheres (ISP) on the Ion PI chip was performed using the Ion OneTouch ES enrichment system (Life Technologies). Ion PI chips were prepared and loaded according to the manual. We used the Ion Torrent platform-specific pipeline software (Torrent Suite v4.0) to align sequences with the hg19 human genome reference, perform target-region coverage analysis, and filter and remove poor signal reads.

Example  4. Bioinformatics analysis and statistical processing

Sequence alignment with human genome reference (hg19) was performed using TMAP (Torrent Suite version: 4.0.2).

Base quality recalibration, indel realignment and variant calling were performed using GATK (Genome Analysis Toolkit, version: 2.3.9). Variations were annotated using the SnpEff program (http://snpeff.sourceforge.net/) (ref. Snpeff) and the databases of the 1000 Genomes Project and NCBI dbSNP. We also analyzed all possible non-synonymous single-nucleotide variants (nsSNVs) in the whole-exome region using the dbNSFP database (https://sites.google.com/site/ jpopgen / dbNSFP) (ref. DbNSFP).

In order to filter the short read, if the quality scorer was less than 9 at the window size of 30, one base pair at the end of the short read sequence was removed. After SNP calling, heterozygous SNPs with a depth of < 10 and homozygous SNPs with a depth of < 5 were filtered.

SNPs with minor allele frequency (MAF) of <5% and SNPs with a call rate of <95% were tested for SNP quality control using the PLINK program (http://pngu.mgh.harvard.edu/) ~ purcell / plink) (Ver 1.07) (ref. plink). After SNP filtering, we analyzed the relationship between skin color and SNP that passed through filtering using logistic regression additive model (one degree of freedom).

As a result, a total of 387 SNPs showed high significance, and CLPSL1, MYH3, SCARB1, MAP2K3, MYZAP, MUC16, GPS1, IRF1, ZFAT, PIK3C2G, PIK3C2G, PIK3C2G, KRT1, KRT77, C3, VANGL1 and ZC3H1 The top 20 SNPs present in the gene were selected (Table 3). The flanking sequences of the above 20 genes are shown in Table 4. &lt; tb &gt; &lt; TABLE &gt;

Top 20 SNP Summary Chr . Position Func . Gene rs  Number frq . (Case: Control) Alleles (A / B) RA OR P chr6 35755658 syn CLPSL1 rs12211728 0/10/3; 0/2 / 11 G / A G 18.33 0.004052 chr17 10549184 intron MYH3 rs2239933 0/2 / 11; 1/9 / 3 A / G G 0.05934 0.004929 chr12 125299830 intron SCARB1 rs4765615 2/9 / 2; 0/3 / 10 T / C T 15.92 0.005198 chr17 21205606 intron MAP2K3 rs2305871 0/1 / 12; 0/9 /4 C / G G 0.03704 0.006101 chr15 57924586 intron MYZAP rs2733593 7/5 / 1; 0/5 /8 T / A T 15.94 0.008458 chr19 9019429 intron MUC16 rs881877 4/7 / 2; 0/4 / 9  C / T C 10.25 0.00911 chr17 80006504 up GPS1 rs1128009 6/5 / 2; 0/5 /8 C / T C 8.08 0.00933 chr5 131825050 intron IRF1 . 0/10/3; 0/3 / 10 A / C A 11.11 0.009694 chr8 135602421 intron ZFAT rs3739426 3/8 / 2; 0/4 / 9 A / C A 10.67 0.009868 chr12 18720057 intron PIK3C2G rs11044189 0/2 / 11; 0/9 /4 C / T T 0.08081 0.009929 chr12 18747387 intron PIK3C2G rs12827507 0/2 / 11; 0/9 /4 G / A A 0.08081 0.009929 chr12 18747528 intron PIK3C2G rs11044211 0/2 / 11; 0/9 /4 T / C C 0.08081 0.009929 chr12 53070145 syn KRT1 rs936958 0/2 / 11; 0/9 /4 A / G G 0.08081 0.009929 chr12 53071560 intron KRT1 rs2741158 0/2 / 11; 0/9 /4 G / A A 0.08081 0.009929 chr12 53090190 syn KRT77 rs7138818 0/2 / 11; 0/9 /4 T / C C 0.08081 0.009929 chr12 53091566 non_syn (missense) KRT77 rs1567759 0/2 / 11; 0/9 /4 A / C C 0.08081 0.009929 chr19 6679563 intron C3 rs2277983 7/5 / 1; 1/5 / 7  T / C T 7 0.01005 chrl 116224940 intron VANGL1 rs10754330 0/4 / 9; 2/9 /2 C / A A 0.08953 0.01026 chrl 116225180 intron VANGL1 rs10923177 0/4 / 9; 2/9 /2 A / C C 0.08953 0.01026 CHR13 46619071 intron ZC3H13 rs3736943 0/4 / 9; 2/9 /2 C / T T 0.08953 0.01026

Abbreviation: Chr., Chromosome; Func, SNP function (fuction); Frq, frequency; RA, risk allele; OR, odds ratio.

See NCBI build 37 for genome location.

In the experimental group-control analysis, the p-value was calculated using logistic regression.

In Alleles (A / B), A represents minor allele and B represents major allele.

RA is a base that appears mainly in dark skin color.

Gene rs  Number Alleles (A / B) RA                       Flanking sequence SEQ ID NO: CLPSL1 rs12211728 G / A G GTCTTTCCCAGGTGTTCTTTGGCCA [G / A] TATAGAGCGTGTCCCTGCCTGCGGA SEQ ID NO: 1 MYH3 rs2239933 A / G G CGCTCTGGCATGGAAAGGGCAGCAC [A / G] TCAGTCAGTTGGCCCCAGTGATGGA SEQ ID NO: 2 SCARB1 rs4765615 T / C T CCTTCGCCAAGTCTGTCCCTCCCGC [T / C] GCCTGCCCACTGCAGGACATGGTGT SEQ ID NO: 3 MAP2K3 rs2305871 C / G G CAGGGCTGGGCCTCTGCCTATGCAC [C / G] TAGGACCCCCCGCCAGCCCACCCAG SEQ ID NO: 4 MYZAP rs2733593 T / A T ATGTGCAGTGGAAGCTGCCAATTCC [T / A] CTGGGCCCTGCAAAAGCTGTCGTTC SEQ ID NO: 5 MUC16 rs881877  C / T C AGACTATTATGAGGTCTGCTGCATA [C / T] GGGCATGAGCTGGGCCTGTCTTTGG SEQ ID NO: 6 GPS1 rs1128009 C / T C GCCAGGTGCCTGCATCTCACTGGTG [C / T] GGCCGTGGCACCTGAGGGAGCCCAC SEQ ID NO: 7 IRF1 . A / C A ZFAT rs3739426 A / C A TTCACAGCTTCATCCCTTTTTATTT [A / C] TATATAGTGCAGTTAATGTAAAACA SEQ ID NO: 8 PIK3C2G rs11044189 C / T T AACTATTTTATATTTTATTCGTGAG [C / T] GTGGTGGTTTATGTCTGTAATGCCA SEQ ID NO: 9 PIK3C2G rs12827507 G / A A GTAATAATGAATAGCAGTAACAAAT [G / A] TAAGAAATAAAAAATATTATGTTT SEQ ID NO: 10 PIK3C2G rs11044211 T / C C GGTAAGTAAATTTGTCATTATATTA [T / C] GTACAGTGATTTTCAAAATAATTGG SEQ ID NO: 11 KRT1 rs936958 A / G G TTGTGTTCATCAGCTCCTGGTAGTC [A / G] CGCAGCAGGCGGGCCAGGTCTTCCT SEQ ID NO: 12 KRT1 rs2741158 G / A A GGAACAAGGGACATCATGAAGGCAC [G / A] TTCTCTCCAGGGCAGGTCCCTCTCA SEQ ID NO: 13 KRT77 rs7138818 T / C C CGACAAAGTCATTCTCGCTGCCAGT [T / C] CTCTTGTTGATTTCATCCTCATACC SEQ ID NO: 14 KRT77 rs1567759 A / C C AAATCCACCTGCCTCCGCAGGTCAC [A / C] GATGTAGTTCTCCAAGAGGGGCTCC SEQ ID NO: 15 C3 rs2277983  T / C T GATAAGGGCCTCCCTCCAAAGACCA [T / C] GCCTGGGAGGCCCAGATCCCCAGTT SEQ ID NO: 16 VANGL1 rs10754330 C / A A AGGATTTTTCGTTTAGGACCTGCTT [C / A] TTCAGTGAAAAAGCTTTGCATTAAT SEQ ID NO: 17 VANGL1 rs10923177 A / C C GGGCACAGTTGGGTGACTATTTAAG [A / C] TTCATGGTACGTTTGGTTCGACTTC SEQ ID NO: 18 ZC3H13 rs3736943 C / T T CCATCTTCTAATAGTACATGAACAA [C / T] ACAAAGTTCTCAGTTTACCTTCTAT SEQ ID NO: 19

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the spirit and scope of the present invention as defined by the appended claims.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Single nucleotide polymorphism markers for determining skin          color and melanism sensitivity and use thereof <130> KPA150683-KR <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs12211728 <400> 1 gtctttccca ggtgttcttt ggccartata gagcgtgtcc ctgcctgcgg a 51 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2239933 <400> 2 cgctctggca tggaaagggc agcacrtcag tcagttggcc ccagtgatgg a 51 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs4765615 <400> 3 ccttcgccaa gtctgtccct cccgcygcct gcccactgca ggacatggtg t 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2305871 <400> 4 cagggctggg cctctgccta tgcacstagg accccccgcc agcccaccca g 51 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2733593 <400> 5 atgtgcagtg gaagctgcca attccwctgg gccctgcaaa agctgtcgtt c 51 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs881877 <400> 6 agactattat gaggtctgct gcataygggc atgagctggg cctgtctttg g 51 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1128009 <400> 7 gccaggtgcc tgcatctcac tggtgyggcc gtggcacctg agggagccca c 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3739426 <400> 8 ttcacagctt catccctttt tatttmtata tagtgcagtt aatgtaaaac a 51 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11044189 <400> 9 aactatttta tattttattc gtgagygtgg tggtttatgt ctgtaatgcc a 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs12827507 <400> 10 gtaataatga atagcagtaa caaatrtaag aaataaagaa atattatgtt t 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs11044211 <400> 11 ggtaagtaaa tttgtcatta tattaygtac agtgattttc aaaataattg g 51 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs936958 <400> 12 ttgtgttcat cagctcctgg tagtcrcgca gcaggcgggc caggtcttcc t 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2741158 <400> 13 ggaacaaggg acatcatgaa ggcacrttct ctccagggca ggtccctctc a 51 <210> 14 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs7138818 <400> 14 cgacaaagtc attctcgctg ccagtyctct tgttgatttc atcctcatac c 51 <210> 15 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs1567759 <400> 15 aaatccacct gcctccgcag gtcacmgatg tagttctcca agaggggctc c 51 <210> 16 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs2277983 <400> 16 gataagggcc tccctccaaa gaccaygcct gggaggccca gatccccagt t 51 <210> 17 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10754330 <400> 17 aggatttttc gtttaggacc tgcttmttca gtgaaaaagc tttgcattaa t 51 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs10923177 <400> 18 gggcacagtt gggtgactat ttaagmttca tggtacgttt ggttcgactt c 51 <210> 19 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rs3736943 <400> 19 ccatcttcta atagtacatg aacaayacaa agttctcagt ttaccttcta t 51

Claims (14)

A skin color or blackening sensitivity diagnostic marker comprising one or more single nucleotide polymorphism markers selected from single nucleotide polymorphism (SNP) markers shown in Table 3.
The skin color or blackening sensitivity diagnostic marker according to claim 1, wherein the marker for skin color or blackening sensitivity diagnosis comprises at least 26 of the at least one base selected from the group consisting of SEQ ID NOS: 1 to 19 as a SNP and 5 to 51 consecutive DNA sequences Or a polynucleotide complementary thereto,
(i) the 26th base of SEQ ID NO: 1 is G or A,
(ii) the 26th base of SEQ ID NO: 2 is A or G,
(iii) the 26th base of SEQ ID NO: 3 is T or C,
(iv) the 26th base of SEQ ID NO: 4 is C or G,
(v) the 26th base of SEQ ID NO: 5 is T or A,
(vi) the 26th base of SEQ ID NO: 6 is C or T,
(vii) the 26th base of SEQ ID NO: 7 is C or T,
(viii) the 26th base of SEQ ID NO: 8 is A or C,
(ix) the 26th base of SEQ ID NO: 9 is C or T,
(x) the 26th base of SEQ ID NO: 10 is G or A,
(xi) the 26 &lt; th &gt; base of SEQ ID NO: 11 is T or C,
(xii) the 26th base of SEQ ID NO: 12 is A or G,
(xiii) the 26th base of SEQ ID NO: 13 is G or A,
(xiv) the 26 th base of SEQ ID NO: 14 is T or C,
(xv) the 26th base of SEQ ID NO: 15 is A or C,
(xvi) the 26th base of SEQ ID NO: 16 is T or C,
(xvii) the 26th base of SEQ ID NO: 17 is C or A,
(xviii) the 26th base of SEQ ID NO: 18 is A or C, and
(xix) the 26th base of SEQ ID NO: 19 is C or T,
Skin color or blackening sensitivity diagnostic marker.
The marker according to claim 1, wherein the marker for skin color or blackening sensitivity diagnosis is a polyline of 5 to 51 consecutive DNA sequences comprising the 35755658 base, wherein the 35755658 base of human chromosome 6 is G or A. Nucleotides;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 10549184 base, wherein the 10549184 base of human chromosome 17 is A or G;
A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 125299830 base, wherein the 125299830 base of human chromosome 12 is T or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 21205606 base, wherein the 21205606 base of human chromosome 17 is C or G;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 57924586 base as 57924586 base of human chromosome 15 is T or A;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 9019429 base, wherein 9019429 base of human chromosome 19 is C or T;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 80006504 base, wherein 80006504 base of human chromosome 17 is C or T;
A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 131825050 base, wherein the 131825050 base of human chromosome 5 is A or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 135602421 base, wherein the 135602421 base of human chromosome 8 is A or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 18720057 base, wherein the 18720057 base of human chromosome 12 is C or T;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 18747387 base, wherein the 18747387 base of human chromosome 12 is G or A;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the above 18747528 base, wherein 18747528 base of human chromosome 12 is T or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53070145 base, wherein the 53070145 base of human chromosome 12 is A or G;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53071560 base, wherein the 53071560 base of human chromosome 12 is G or A;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53090190 base, wherein the 53090190 base of human chromosome 12 is T or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 53091566 base, wherein the 53091566 base of human chromosome 12 is A or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 6679563 base, wherein the 6679563 base of human chromosome 19 is T or C;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 116224940 base, wherein the 116224940 base of human chromosome 1 is C or A;
A polynucleotide consisting of 5 to 51 consecutive DNA sequences comprising the 116225180 base, wherein the 116225180 base of human chromosome 1 is A or C;
A polynucleotide consisting of 5-51 consecutive DNA sequences comprising the 46619071 base, wherein 46619071 base of human chromosome 13 is C or T; And at least one polynucleotide selected from the group consisting of complementary polynucleotides thereof.
Skin color or blackening sensitivity diagnostic marker.
A composition for skin color or blackening sensitivity diagnosis comprising a probe or an amplifiable agent capable of detecting a skin color or blackening sensitivity diagnostic marker according to any one of claims 1 to 3.
A skin color or blackening sensitivity diagnostic kit comprising the composition of claim 4.
6. The kit for diagnosing skin color or darkening sensitivity according to claim 5, wherein the kit is an RT-PCR kit or a DNA chip kit.
A microarray for skin color or blackening sensitivity diagnosis comprising the polynucleotide of any one of claims 1 to 3.
(a) amplifying or hybridizing a polymorphic site of the single base polymorphic marker of any one of claims 1 to 3 from a DNA obtained from a sample of a separated individual; And
(b) identifying a base of the amplified or hybridized polymorphic site of step (a).
9. The method according to claim 8, wherein, in the nucleotide sequence identified in step (b), at least one single-
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 2, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is G;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is C;
In the polynucleotide described in SEQ ID NO: 7, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 14, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is C;
16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is T;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is A;
18. The polynucleotide according to SEQ ID NO: 18, wherein the 26th base is C; or
In the polynucleotide of SEQ ID NO: 19, when the 26th base is T,
And determining that the L value is darker than 52 and that the blackness sensitivity is low. &Lt; Desc / Clms Page number 20 &gt;
9. The method according to claim 8, wherein, in the nucleotide sequence identified in step (b), at least one single-
In the polynucleotide described in SEQ ID NO: 1, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 2, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 3, when the 26th base is C;
In the polynucleotide described in SEQ ID NO: 4, when the 26th base is C;
In the polynucleotide described in SEQ ID NO: 5, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 6, when the 26th base is T;
In the polynucleotide described in SEQ ID NO: 7, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 8, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 9, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 10, when the 26th base is G;
In the polynucleotide of SEQ ID NO: 11, when the 26th base is T;
In the polynucleotide of SEQ ID NO: 12, when the 26th base is A;
In the polynucleotide of SEQ ID NO: 13, when the 26th base is G;
14. The polynucleotide according to SEQ ID NO: 14, wherein the 26th base is T;
In the polynucleotide of SEQ ID NO: 15, when the 26th base is A;
16. The polynucleotide according to SEQ ID NO: 16, wherein the 26th base is C;
In the polynucleotide of SEQ ID NO: 17, when the 26th base is C;
In the polynucleotide of SEQ ID NO: 18, when the 26th base is A; or
In the polynucleotide of SEQ ID NO: 19, when the 26th base is C,
And determining that the black value is high because the L value is greater than 52. The method of claim &lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt;
9. The method according to claim 8, wherein, in the nucleotide sequence identified in step (b), at least one single-
The 35755658th base of human chromosome 6 is G;
Human 10549184 base of chromosome 17 is G;
Human 125299830 base of chromosome 12 is T;
Human 21205606 base of chromosome 17 is G;
Human 57924586 base of chromosome 15 is T;
The 9019429 base of human chromosome 19 is C;
The 80006504 base of human chromosome 17 is C;
Human 131825050 base of chromosome 5 is A;
The 135602421 base of human chromosome 8 is A;
The 18720057th base of human chromosome 12 is T;
When human 18747387 base of chromosome 12 is A;
Human 18747528 base of chromosome 12 is C;
Human 53070145 base of chromosome 12 is G;
Human 53071560 base of chromosome 12 is A;
Human 53090190 base of chromosome 12 is C;
Human 53091566 base of chromosome 12 is C;
The 6679563th base of human chromosome 19 is T;
When the 116224940 base of human chromosome 1 is A;
The 116225180 base of human chromosome 1 is C; or
When human 46619071 base of chromosome 13 is T,
And determining that the L value is darker than 52 and that the blackness sensitivity is low. &Lt; Desc / Clms Page number 20 &gt;
9. The method according to claim 8, wherein, in the nucleotide sequence identified in step (b), at least one single-
The 35755658th base of human chromosome 6 is A;
When human 10549184 base of chromosome 17 is A;
Human 125299830 base of chromosome 12 is C;
Human 21205606 base of chromosome 17 is C;
The 57924586th base of human chromosome 15 is A;
The 9019429 base of human chromosome 19 is T;
The 80006504 base of human chromosome 17 is T;
Human 131825050 base of chromosome 5 is C;
Human 135602421 base of chromosome 8 is C;
Human 18720057 base of chromosome 12 is C;
Human 18747387 base of chromosome 12 is G;
When human 18747528 base of chromosome 12 is T;
The 53070145 base of human chromosome 12 is A;
Human 53071560 base of chromosome 12 is G;
Human 53090190 base of chromosome 12 is T;
The 53091566 base of human chromosome 12 is A;
The 6679563th base of human chromosome 19 is C;
The 116224940 base of human chromosome 1 is C;
When the 116225180 base of human chromosome 1 is A; or
When human 46619071 base of chromosome 13 is C,
And determining that the black value is high because the L value is greater than 52. The method of claim &lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt;
9. The method of claim 8, wherein the sample is hair, urine, blood, various body fluids, isolated tissue, isolated cells or saliva.
9. The method of claim 8, wherein amplification and identification of the polymorphic site utilizes a SNP chip.