KR101497282B1 - Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn's Disease - Google Patents

Abstract

The present invention provides a polynucleotide comprising a single-nucleotide polymorphism (SNP) for the diagnosis of Crohn's disease susceptibility or a complementary polynucleotide thereof, and more particularly, a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 4 A polynucleotide selected from the group consisting of 10 to 50 consecutive DNA sequences comprising the 27th nucleotide (polymorphic site), or a complementary polynucleotide thereof, to a chromosome susceptibility diagnostic marker composition do. The polynucleotide of the present invention or a complementary polynucleotide thereof can be usefully used for diagnosis of Crohn's disease and prediction of Crohn's disease risk as a genetic diagnostic marker of Crohn's disease.

Description

Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn's Disease}

The present invention relates to a polynucleotide marker composition for diagnosing Crohn's disease susceptibility and a method for diagnosing Crohn's disease susceptibility using the same.

Crohn's disease is a type of inflammatory bowel disease and is a chronic recurrent disease. It is common in Jews and Caucasians by race, and relatively rare in Asians. However, in recent years, the incidence rate is increasing in southern Europe, Asian countries including Korea, and other developing countries.

In particular, Crohn's disease is a disease that should be suspected when a young person (late teens to early 20s) shows abdominal pain, diarrhea, weight loss, fever, etc. It is carried out in combination with pathological examinations and the like. However, these methods require experience and skilled techniques, and there are many cases in which it is difficult to differentiate between Crohn's disease and ulcerative colitis, especially in the early onset. On the other hand, gastrointestinal contrast examination and endoscopy, which are central methods of diagnosis, have a defect that causes physical or mental pain to a patient, and therefore, a diagnostic method capable of easily and accurately discriminating Crohn's disease is required.

In other words, many patients suffer from Crohn's disease, but no clear cause or treatment method for this disease has been suggested, and despite many clinical studies, there are many problems that are difficult to answer only with expert judgment or opinion. Therefore, there may be differences in patient care or treatment methods, and in order to reduce these differences, it is required to accurately diagnose Crohn's disease risk. In order to solve this point, Korean Patent Registration No. 10-1159626 discloses an antibody for diagnosing Crohn's disease, but does not disclose any technology for predicting Crohn's disease specifically for Koreans based on genetic information.

Accordingly, the present invention aims to identify Single-Nucleotide Polymorphism (SNP) having a significant relationship with Crohn's disease susceptibility in Koreans, and to use it as a clinical marker for the diagnosis of Crohn's disease susceptibility.

In order to solve the above problems, the present invention is a polynucleotide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site). It provides a marker composition for diagnosing Crohn's disease susceptibility comprising a polynucleotide or a complementary polynucleotide thereof.

In addition, the present invention is one or more polynucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, a polynucleotide consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site) or a complement thereof It provides a Crohn's disease susceptibility diagnostic probe made of red polynucleotides and a DNA microarray chip for Crohn's disease susceptibility diagnostics in which the probes are integrated.

In addition, the present invention is one or more polynucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, a polynucleotide consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site) or a complement thereof It provides a kit for diagnosing Crohn's disease susceptibility comprising a red polynucleotide.

In addition, the present invention is to obtain a nucleic acid sample from the specimen; And detecting the presence of a gene sequence indicating a risk of developing Crohn's disease in the sample, wherein the gene sequence is at least one selected from the group consisting of SEQ ID NOs: 1 to 4, and the 27th base ( It provides a method for providing information for diagnosing Crohn's disease susceptibility, which is 10 to 50 consecutive DNA sequences including polymorphic sites) or a complementary sequence thereof.

The polynucleotide of the present invention or its complementary polynucleotide can be usefully used for diagnosing Crohn's disease and predicting Crohn's disease risk as a genetic diagnostic marker for Crohn's disease.According to the present invention, prior to clinical treatment of inflammatory colitis Patients with high susceptibility to Crohn's disease can be classified early and quickly, and patient-specific treatment can be efficiently performed.

1 shows a regional association plot for rs6856616 of 4p14. In the above figure, (G) represents the -log ₁₀ P value of GWAS, and (C) represents the synthesized result.
2 shows a regional association plot for rs11195128 of 10q25. In the above figure, (G) represents the -log ₁₀ P value of GWAS, and (C) represents the synthesized result.
3 shows a regional association plot for rs11235667 and rs11235604 of 11q13. In the above figure, (G) represents the -log ₁₀ P value of GWAS, and (C) represents the synthesized result.

The present invention is one or more polynucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, a polynucleotide consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site) or a complementary thereof It provides a marker composition for diagnosing Crohn's disease susceptibility comprising a polynucleotide.

In one embodiment of the present invention, the length of the polynucleotide or its complementary polynucleotide is 8 to 52 nucleotides, 10 to 50 nucleotides, or 20 to 40 nucleotides, but is not limited thereto.

Polymorphism of the present invention refers to a case where two or more alleles exist at a single locus, and a'polymorphic site' refers to a locus in which the allele exists. Among the polymorphic sites, the thing that only a single base differs from person to person is called "single nucleotide polymorphism," that is, single nucleotide polymorphism (SNP).

In another embodiment of the present invention, the allele of the 27th base (polymorphic site) of SEQ ID NO: 1 is C/T; The allele of the 27th base (polymorphic site) of SEQ ID NO: 2 is C/T; The allele of the 27th base (polymorphic site) of SEQ ID NO: 3 is C/T; And the allele of the 27th base (polymorphic site) of SEQ ID NO: 4 may be A/G.

In another embodiment of the present invention, the marker composition may be used to diagnose Crohn's disease susceptibility in Koreans.

The inventors of the present invention attempted to discover a genetic marker related to Crohn's disease susceptibility that is specific to Koreans, and as a result, it was found that the SNPs represented by SEQ ID NOs: 1 to 4 were significant in Crohn's disease susceptibility, and the present invention It was completed (see Examples below).

In another embodiment of the present invention, specific nucleotide sequences of the SNPs of SEQ ID NOs: 1 to 4 are shown in Table 1 below.

Sequence number rs number (ncbi gene bank) Base sequence from 5'- One rs6856616 TTTTATAAGCATTCCCAAGTGAATCT[C/T]AATTTACCTACTGAAAAGCAATAAT 2 rs11195128 AGTCAGAAAAGGTCAACACAGAATAG[C/T]GATATAATCAAAATTACCCTCTACG 3 rs11235604 TTTACCCAACAAGGGCCAAGCAGGCG[C/T]GGGTGTCCCAGGAGCTGAAGAAGGC 4 rs11235667 TGACTAGTTTGGTGAACCAACACTAC[A/G]GAATAAAACAGGCCTCAAGGCAAAA

The position of the SNP in each of the polynucleotides is the 27th base, and alleles that may appear mainly are shown in parentheses.

As a polynucleotide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, a polynucleotide consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site) or a complementary polynucleotide thereof Can be used to diagnose Crohn's disease susceptibility.

The present invention also provides a Crohn's disease susceptibility diagnostic probe comprising the polynucleotide or a complementary polynucleotide thereof that can be used for Crohn's disease susceptibility diagnosis, and a DNA microarray chip for diagnosing Crohn's disease susceptibility in which it is integrated.

The DNA microarray chip for diagnosing Crohn's disease susceptibility of the present invention can be manufactured by a method known to those skilled in the art. More specifically, micropipette using a piezoelectric method to immobilize on a substrate of a DNA chip using a probe for Crohn's disease susceptibility consisting of the polynucleotide or a complementary polynucleotide thereof as a probe DNA molecule ( A micropipetting method or a method using a pin-type spotter may be used, but is not limited thereto.

In addition, the substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not limited thereto. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose film, but is not limited thereto.

The present invention is also one or more polynucleotides selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, a polynucleotide consisting of 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site), or It provides a kit for diagnosing Crohn's disease susceptibility comprising a complementary polynucleotide.

The present invention also comprises the steps of obtaining a nucleic acid sample from the specimen; And detecting the presence of a gene sequence indicating a risk of developing Crohn's disease in the sample. In this case, the gene sequence may be 10 to 50 consecutive DNA sequences including the 27th base (polymorphic site) or a complementary sequence thereof in a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4 or more. have.

In another embodiment of the present invention, as the 27th base,

C for SEQ ID NO: 1, T for SEQ ID NO: 2, T for SEQ ID NO: 3, and G for SEQ ID NO: 4 may be used.

In the step of obtaining a nucleic acid sample from a specimen, the nucleic acid can be isolated from all cells such as blood, skin cells, mucous membrane cells, and hair to be diagnosed. The nucleic acid may be DNA or RNA, preferably DNA. A method of extracting a nucleic acid from the cell is not particularly limited, and a technique known in the art or a commercially available nucleic acid extraction kit may be used. For example, a phenol/chloroform extraction method and a protease K treatment method can be used.

Kits for DNA or RNA extraction can be purchased from Qiagen, Inc, and Stratagene. When RNA is extracted and used above, cDNA can be prepared and used through reverse transcription.

In the step of detecting the presence of a gene sequence indicating a risk of developing Crohn's disease in a sample, gene sequence analysis may be performed. For sequencing, all methods known in the art may be used, and specifically, but not limited thereto, using an automatic sequence analyzer, pyrosequencing, PCR-RELP method (restriction fragment length polymorphism), PCRSSCP method (single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method, Any one or more selected from known methods such as rolling circle amplification (RCA) method, high resolution melting (HRM) method, primer extension method, southern blot hybridization method, and dot hybridization method may be used.

If the presence of a gene sequence indicating the risk of developing Crohn's disease is confirmed from the sample of the sample, the sample can be diagnosed as having a high risk of developing Crohn's disease.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely describe the present invention to those of ordinary skill in the art.

< Experimental example >

The following experimental examples are intended to provide experimental examples commonly applied to each of the examples according to the present invention.

1. Subject of experiment

A case-control study was conducted with 2,311 Crohn's disease (CD) patients and 2,442 control patients. All subjects were Koreans.

Of the 2,311 Crohn's disease patients, 1,519 were recruited from the IBD Clinic of Asan Hospital, and 792 were recruited from the Korean Research Network on Crohn's disease. The diagnosis of Crohn's disease was performed according to standard clinical, radiological, endoscopy, and histopathological criteria. Patients with medium-stage colitis were excluded.

Of the control patients, 732 healthy volunteers were recruited from Ulsan University Hospital and Asan Hospital for cloning cohort 1, and 720 healthy volunteers who visited the health examination center of Seoul National University Hospital were recruited for cloning cohort 2. The National University Hospital recruited 257 healthy applicants. All samples were collected according to a protocol approved by the Institutional Review Board.

2. Genotyping And analysis

533 Crohn's disease patients were genotyped using the Illumina OmniExpress array. For control, 800 known genotyping data analyzed on the Illumina Omni1-Quad array were used. SNPs on Y and mitochondrial chromosomes were excluded from the analysis. For quality control, call rate is significant deviation is P <1 × 10 by less than 95%, minor allele frequency (MAF ) is <0.01, Hardy-Weinberg equilibrium in the control ^group-5 of SNP was excluded. Similarly, samples with a genotype ratio of 96% or less were then removed. Of the 533 cases and 800 control samples, only 558,194 SNPs of the autosomal and 13,044 SNPs of the X chromosome, which were common in both OmniExpress and Omni1-Quad arrays, were subject to further quality control.

The potential genetic relatedness of 1,333 GWAS samples was analyzed using PLINK 1.07 software based on pair-wise identity. For each of the first relative pairs identified, samples with low genotype call rates were removed. A total of 66 samples (1 case and 65 controls) were removed by sample replication and/or gene intimacy. Subsequently, a method based on principal-component analysis (PCA) was used to detect population outliers and stratification in the software package EIGENSTRAT 3.0. All SNPs with five distinct regions of long-range LD, including the HLA region of chromosome 6, inversion of chromosomes 8 and 5, and two regions of chromosome 11, were excluded from PCA. For the initial PCA, all 1,267 samples (532 cases and 735 controls) were analyzed with 194 reference samples from the International HapMap Project, as a result of which two outliers were detected. As a result of SNP and sample quality control analysis, genotyping data of 571,238 SNPs of 532 cases and 733 controls were used for GWAS analysis.

3. Imputation

For imputation analysis, unentered genotypes were attributed to GWAS samples using the Asian reference panel (JPT + CHB) of the 1,000 Genome Project Database via IMPUTE (v2.0). Among the genotypes attributed, SNPs with a genotype probability <90%, an imputation certainty <80%, MAF <5%, and a genotype with a loss rate> 10% were excluded from further analysis. A total of 5,093,133 attributed SNPs passed quality control and were used for association analysis together with 571,238 genotyping SNPs.

4. Replication

Genotyping for evaluation was performed with iPLEX on a matrix-assisted laser desorption/ionization time-of-flight MassARRAY platform (Sequenom, San Diego, CA, USA). The evaluation of rs773024, rs9654389, rs1393820, rs753988 and rs6475004 was performed using the TaqMan SNP genotyping assay.

5. Variance and risk analysis

The degree of gene variance explained by each of the Crohn's disease risk traits is So HC, Gui AH, Cherny SS, et al. Evaluating the heritability explained by known susceptibility variants: a survey of ten complex diseases. It was measured under the liability threshold model by the algorithm shown in Genet Epidemiol 2011;35:310-7.

This model presents latent continuous liability, which is generally estimated to be distributed with an average of 0 and a variance of 1. The inventors of the present invention estimated the incidence of Crohn's disease in Koreans to be 0.0112%. To calculate the degree of heredity explained by a single strain, the allele frequency, odds ratio (OR), and disease prevalence were used. In addition, the inventors of the present invention calculated a genetic risk score using a simple risk allele count. Subject subjects were classified according to their genetic risk based on 9 risk strains, and their association with Crohn's disease was determined using logistic regression analysis.

6. Statistical Analysis

In the GWAS stage, single marker association analysis was performed with the Cochran-Armitage trend test. SNPs on the X chromosome were analyzed by considering sex as a covariate using a logistic regression model. To evaluate the overall significance of genome-wide association and the potential impact of population stratification, a quantile-quantile plot was generated using R (2.13.1). The potential impact of population stratification was also evaluated by calculating the genomic control inflation factor. A Manhattan plot of -log ₁₀ P was generated using Haploview (v4.2). Replication analysis was performed by analyzing each of the two subsequent samples separately, and then analyzing the combined samples of all patients and controls together. Association analysis of the bound samples was performed using Cochran-Mantel-Haenszel stratification analysis. The Breslow-Day test was used to evaluate the heterogeneity between ORs for different sample cohorts. The inventors of the present invention measured the degree of independence for a plurality of associations observed in the MHC region by hierarchical conditional logistic regression analysis.

The power analysis of GWAS samples to detect 140 Crohn's disease susceptibility sites of the previously reported Caucasian race was performed using the Quanto software package (Version 1.2.4, http://hydra.usc.edu/gxe/). . Of each reported SNP, the detectability at a set P value of 0.05 was calculated based on the reported OR and the allele frequency in the Korean population.

7. Cis - eQTL And bioinformatics analysis

For cis-eQTL (expression quantitative trait locus) analysis, public data from the Genevar (GENe Expression VARiation) eQTL browser was applied. Cis association between SNPs at three new locations and expression of adjacent genes were measured in primary fibroblasts, T-cells, skin, adipose and lymphoblastic cell lines.

For prediction of the evolutionarily conservation of functional variants, PhastCons46wayPlacental and PhyloP scores (± 5000 bp window) were obtained from the UCSC Genome Browser. Predicting the possible effects of amino acid substitutions on protein function is SIFT (sorting intolerant from tolerant) (http://sift.jcvi.org) and PolyPhen-2 (polymorphism phenotyping v2) ( http://genetics.bwh.harvard.edu /pph2 ) algorithm. SIFT and PolyPhen-2 predictions of “Deleterious” and/or “Probably/Possible damaging” were judged to predict their effect on protein function. For the analysis of the intergenic region, the ENCODE project data of the UCSC Genome Browser was used to investigate the ChiP sequencing (ChiP-seq), histone alteration data, and the SNP effect of the transcription factor binding site.

< Example 1> Nucleotide targeting Koreans Marker Establish

As a result of quality check and Imputation, 102 SNPs at 85 sites of 521 Crohn's disease patient group and 732 control group (replica cohort 1) were used for further analysis. Of these, 98 SNPs were successfully genotyped, and the two previously reported genes and the genes at the new location showed statistical significance in the evaluation analysis after Bonferroni correction ( TNFSF15 locus rs6478109 (combined P = 2.14 x 10 ^-44 ), BTNL2( (butyrophilinlike protein 2) Of intron 1 rs10947261 (combined P = 2.67 x 10 ^-10 ), and rs6856616 of 4p14 (combined P = 1.78 x 10 ^-8 )

In addition, in order to confirm the new susceptibility loci of Crohn's disease, 27 SNPs at position 25 of 1,258 Crohn's disease patient group and 977 control group (cloning cohort 2) were cloned and confirmed.

As a result of comprehensive verification, 9 SNPs ( rs76418789 , rs6856616 , rs10947261 , rs9271366 , rs751728, rs2149085 , rs394522 , rs11195128 , rs11235667 ) of 6 positions (3 new + 3 previously known positions) were genetically significant associations ( P <5 x 10 ^-8 ). Among them, 4 SNPs at the new 3-position are shown in Table 2 below.

a: chromosome; b: Risk Allele Frequency; c: P value obtained through the Cochrane-Armitage trend test; d: OR (odd ratio), CI (confidence interval); e: synthesized P value (Pcmh) and synthesized OR value calculated by Cochran-Mantel-Haenszel (CMH) test statistic; f: Asymptotic P value of Breslow-Day (BD) test for heterogeneity of OR

Among them, the new SNP showing the strongest association signal is rs6856616 of the 4p14 denture. (OR = 1.43, 95% CI = 1.31-1.57, combined P = 3.60 x 10 ^-14 ) was confirmed (see Table 2 and Figure 1). This is TBC1D1 (TBC1 domain family, member 1) (~184 kb telomeric) and KLF3 (Kruppel-like factor 3) (~341 kb centromeric). TBC1D1 Is a gene associated with obesity regulation and glucose metabolism in skeletal muscle, KLF3 Is a gene that plays an important role in the inhibition of transcription, hematopoiesis, B cell differentiation, and IL-17 mediated adipogenesis.

In addition, rs11195128 at the 10q25 position (OR = 1.42, 95% CI = 1.28-1.58, combined P = 1.55 x 10 ^-10 ) was also identified as a new position with high correlation (see Table 2 and FIG. 2). It is located in a quintile without the established coding gene, but downstream of the novel antisense RNA RP11-525A16.1. SMNDC1 (survival motor neuron domain containing 1) and DUSP5 (dual specificity phosphatase 5) genes are located in rs11195128, 121.4 kb centromeric and 71.5 kb telomeric, respectively. SMNDC1 Constitutes a spleosome complex, and its overexpression causes apoptosis. DUSP 5 is an extracellular signal-regulating kinase 1/2 (ERK1/2)-specific phosphatase, expressed in both thymocytes and T cells, and in combination with IL-2, IL-7 and IL-15 on TCR signals. Is activated by It is also associated with M-CSF signaling, myeloid cell differentiation, and T-cell differentiation.

11q13, FCHSD2 Rs11235667 (OR = 1.46, 95% CI = 1.28-1.66, combined P = 7.15 x 10 ^-9 ) of the ~10.5 kb region of the gene was also identified as a highly correlated new location (see Table 2 and FIG. 3). rs11235667 is FCHSD2 , ATG16L2 And STARD10 in an LD (linkage disequilibrium) region of ~430 kb. FCHSD2 (FCH and double SH3 domains) have two SH3 domains and a double helix domain linked to a C-terminal PDZ-binding motif, and interact with guanylate kinase at the epithelial junction. ATG16L2 (autophagy related 16-like 2) is homologous to ATG16L1 , which is known as a risk gene for Crohn's disease. ATG16L1 is associated with autophagy and Paneth cell secretions containing antimicrobial peptides. ATG16L1 And ATG16L2 All have 7 WD repeats and double helix structures.

The inventors of the present invention later described the Koreans' FCHSD2 , ATG16L2 And it was confirmed in STARD10 close SNP. This is rs11235604 present in ATG16L2, and together with rs11235667 ( r ² = 0.96) It was present in the LD region, and showed strong significance and a strong association with Crohn's disease (OR = 1.61, combined P = 2.44 x 10 ^-12 , see Table 2, Fig. 3). The variant causes an amino acid substitution at position 220 at the N-terminus of the double helix region (substitution of basic arginine with non-polar tryptophan). The UCSC Genome Browser database was searched to measure the conservation of rs11235604 between species, and the PhyloP and PhastCons scores were 0.12 and 0.13, respectively, indicating that the mutation was evolutionarily conserved. In of rs11235604 using SIFT and PolyPhen-2 silico The evaluation showed deleterious and benign results, respectively. The above results strongly suggest that rs11235604 associated with 11q13 is a causal variant associated with disease.

< Example 2> Caucasian Comparison with race data

In order to confirm whether the new SNP is also applied to the Caucasian race, three new locations in the GWAS dataset were investigated from IIBDGC (CD dataset: 21102463, UC dataset: 21297633). The dataset consisted of 5,956 Crohn's disease (CD) patient group, 6,945 UC, and 21,770 control group. Referring to Table 3 below, two SNPs among the three positions, rs6856616 (OR = 1.15, P = 3.47 x 10 ^-4 ) of 4p14 and rs11195128 (OR = 1.09, P = 7.16 x 10 ^-4 ) of 10q25 are UC and Along with IBD, there was a consistent association with Crohn's disease of the Caucasian race.

a: chromosome; b: Risk Allele Frequency; c: OR (odd ratio), d: Cochran-Mantel-Haenszel (CMH) synthesized P value calculated by test statistic (Pcmh)

On the other hand, rs11235667 of 11q13 appeared in a monomorphic form in the Caucasian race, and all 10 SNPs related to it were found to have little association, and the association with 11q13 was found to be less in the Caucasian race.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it will be apparent that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> University of Ulsan Foundation For Industry Cooperation <120> Polynucleotide Marker Composition for Diagnosis of Susceptibility to Crohn's Disease <130> ADP-2014-0440 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <400> 1 ttttataagc attcccaagt gaatctyaat ttacctactg aaaagcaata at 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <400> 2 agtcagaaaa ggtcaacaca gaatagygat ataatcaaaa ttaccctcta cg 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <400> 3 tttacccaac aagggccaag caggcgyggg tgtcccagga gctgaagaag gc 52 <210> 4 <211> 52 <212> DNA <213> Homo sapiens <400> 4 tgactagttt ggtgaaccaa cactacrgaa taaaacaggc ctcaaggcaa aa 52

Claims (8)

A polynucleotide consisting of 10 to 50 consecutive DNA sequences comprising a polymorphic marker having a 27th base of SEQ ID NO: 2 or a complementary polynucleotide thereof. delete The method according to claim 1,
Wherein the marker composition is used for diagnosing Crohn's disease susceptibility in Korean. A polynucleotide consisting of 10 to 50 contiguous DNA sequences comprising a polymorphic marker having a 27th base of SEQ ID NO: 2 or a complementary polynucleotide thereof. A DNA microarray chip for diagnosis of susceptibility to Crohn disease in which the probe for susceptibility to Crohn disease is integrated. A polynucleotide consisting of 10 to 50 contiguous DNA sequences comprising a polymorphic marker having the 27th base of SEQ ID NO: 2 or a complementary polynucleotide thereof. Obtaining a nucleic acid sample from the sample; And detecting the presence of a gene sequence exhibiting a risk of Crohn's disease in the sample, wherein the gene sequence comprises 10 to 50 contiguous DNA sequences comprising a polymorphic marker wherein the 27th base of SEQ ID NO: 2 is T, Lt; / RTI &gt; is a complementary sequence. delete

Images