KR102158726B1 - DNA methylation marker composition for diagnosis of delayed cerebral ischemia comprising intergenic region of ITPR3 gene upstream - Google Patents

Abstract

The present invention relates to: a composition for diagnosing delayed cerebral ischemia comprising an agent capable of measuring the degree of methylation of a distal intergenic region (IGR) in an upstream of the inositol 1,4,5-trisphosphate receptor 3 (ITPR3) gene; a kit for diagnosing delayed cerebral ischemia comprising the composition; and a method of providing information for diagnosis of delayed cerebral ischemia using the composition and the kit. According to the present invention, the composition for diagnosing delayed cerebral ischemia, the kit for diagnosing delayed cerebral ischemia, and the method of providing information for the diagnosis of delayed cerebral ischemia may be used in predicting or diagnosing the risk of developing delayed cerebral ischemia, which occurs after subarachnoid hemorrhage, by measuring the degree of methylation in the distal IGR in the upstream of the ITPR3 gene.

Description

DNA methylation marker composition for diagnosis of delayed cerebral ischemia comprising intergenic region of ITPR3 gene upstream}

The present invention is a composition for diagnosing delayed ischemia comprising an agent capable of measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene, the composition It relates to a kit for diagnosing delayed ischemia comprising a, and a method of providing information for diagnosing delayed ischemia using the composition and kit.

Subarachnoid hemorrhage (SAH) caused by rupture of a cerebral aneurysm is a life-threatening disease, with a mortality rate of 45% within 30 days of onset. In addition, delayed cerebral ischemia (DCI) can occur within the range of 30 to 40% after subarachnoid hemorrhage, which is associated with a major cause of mortality. Patients with subarachnoid hemorrhage with delayed ischemia are more likely to have various complications such as pneumonia, cardiac arrhythmia, intestinal bleeding and urinary tract infections compared to patients who do not develop delayed ischemia. It can lead to an increase. The onset of this delayed ischemia is affected by a variety of clinical and radiological parameters. The well-known clinical risk factors for delayed ischemia are female gender, smoking, and low clinical grade at hospitalization. High Hunt-Hess-grade (grades IV and V) or World Federation of Neurosurgical Societies (WFNS) grades increase the likelihood of developing delayed ischemia.

Regarding the onset of delayed ischemia, various genetic studies such as single nucleotide polymorphisms (SNPs) or genome-wide association studies (GWAS) have been conducted. However, only about 5-10% of the sensitive genetic variation was observed, suggesting that there are various genetic variations that are not yet known beyond the DNA sequence scale.

As one of the unknown and novel pathways, there are epigenetic mechanisms including DNA methylation, histone modification and non-coding RNA and the like. Among them, DNA methylation is a process in which a methyl group binds to a cytosine nucleotide in front of guanine, and is generally known to inhibit gene transcription. To date, no studies have been conducted to confirm the epigenetic profile of delayed ischemia in patients with subarachnoid hemorrhage.

Accordingly, the present inventors have tried to develop an efficient and easy method for diagnosing the onset of delayed ischemia that occurs after subarachnoid hemorrhage, predicting the risk of onset, and predicting the prognosis. As a result, the methylation level of a specific gene is measured, or the gene expression level is measured. The present invention was completed by developing a diagnostic composition capable of diagnosing or predicting delayed ischemia by measuring.

Republic of Korea Patent Publication No. 10-2019-0008216

A first aspect of the present application, comprising an agent capable of measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene, delayed ischemia It is to provide a diagnostic composition.

A second aspect of the present application is to provide a composition for diagnosing delayed ischemia, including an agent capable of measuring the expression level of ITPR3 (inositol 1,4,5-trisphosphate receptor 3).

A third aspect of the present application is to provide a kit for diagnosing delayed ischemia, including the composition for diagnosing delayed ischemia.

The fourth aspect of the present application includes measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene from a biological sample isolated from an individual. It is to provide a method for providing information for diagnosis of delayed ischemia, including.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.

The first aspect of the present application comprises an agent capable of measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene, delayed ischemia It provides a composition for diagnosis.

As used throughout this specification, the term "delayed cerebral ischemia (DIC)" refers to the occurrence of local neurological disorders (eg, hemiplegia, speech loss, loss of conduct, hemi-blindness or neglect), or the Glasgow coma scale (overall Score or one of its individual components), and the onset of delayed ischemia may be due to a variety of clinical and radiologic parameters, wherein “delayed ischemia” refers to “DIC”, “ It may be named interchangeably with "delayed cerebral ischemia".

The term "ITPR3 (inositol 1,4,5-trisphosphate receptor 3)" used throughout the specification is a protein encoded by the ITPR3 gene, and is known to have a function of a receptor and calcium channel of inositol triphosphate, and ITPR3 The gene may be present in the 33588142th to 33664351th sequence of human chromosome 6. In addition, the upstream region of the ITPR3 gene refers to the 5'region (upstream) of the chromosome in which the ITPR3 gene exists, and specifically, within 10 kb, within 8 kb, or within 5 kb in the 5'direction from the region where the ITPR3 gene exists. It may mean a region, but is not limited thereto.

The term "intergenic region (IGR)" used throughout the present specification is a DNA sequence located between a gene and a gene, and may mean a non-toxic part, which is found within a gene. It is different from the short, non-coding site, intron (non-expression site, intron, intragenic region). In humans, the intergenic region occupies a large part of the genome, but it is sometimes known that several intergenic regions can control nearby genes, and most of them have no known function.

According to one embodiment of the present application, the distal intergenic region upstream of the ITPR3 gene of the composition may be within 5 kb from the region in which the ITPR3 gene exists, and specifically, the 33584827 th to 33585071 th sequence of the human chromosome 6 It may be included, but is not limited thereto.

According to one embodiment of the present application, the distal intergenic region upstream of the ITPR3 gene of the composition may include the nucleotide sequence of SEQ ID NO: 1, and specifically, the 85th to the 232th nucleotide sequence of SEQ ID NO: 1 It may be, but is not limited thereto.

The term "methylation" or "DNA methylation" as used throughout the present specification means that a methyl group is attached to a base constituting DNA. For example, whether or not the methylation is a specific CpG (Cytosine It may mean whether methylation occurs in cytosine at the phosphate Guanine) site. In general, when methylation or hypermethylation occurs, the binding of transcription factors may be hindered and the expression of specific genes may be suppressed. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene may increase. have.

In the genomic DNA of mammalian cells, in addition to A, C, G, and T, a fifth base called 5-methylcytosine (5-mC) with a methyl group attached to the fifth carbon of the cytosine ring is present. do. Methylation of 5-methylcytosine occurs only at C of CG dinucleotide (5'-mCG-3') called CpG, and methylation of CpG inhibits the expression of alu or transposon and genome repeats. In addition, since 5-mC of CpG is naturally deaminated to become thymine (T), CpG is a site where most epigenetic changes occur frequently in mammalian cells.

The term "measurement of methylation level" as used throughout the present specification is to measure the methylation level of a CpG site in a specific gene, specifically a distal intergenic region upstream of the ITPR3 gene, methylation specific PCR, for example methylation specific It can be measured through methylation-specific polymerase chain reaction (MSP), real time methylation-specific polymerase chain reaction (PCR), PCR using methylated DNA-specific binding protein, or quantitative PCR. Alternatively, automatic base analysis such as pyro-sequencing, MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis, methylation-sensitive high-resolution melting curve analysis), methylation determination using methylation-sensitive restriction enzymes, DNA chip and bisulfite sequencing It can be measured by a method such as, but is not limited thereto.

According to one embodiment of the present application, "an agent capable of measuring the level of methylation" refers to a molecule that can be used to measure the level of methylation of a specific DNA region, and specifically, for a distal intergenic region upstream of the ITPR3 gene. It may include a primer or probe for performing methylation-specific PCR, but is not limited thereto.

The primers used to measure the methylation level may include a primer specific to the methylated allele sequence of the gene and a primer specific to the unmethylated allele sequence, and the primer is an object to be analyzed for methylation. It may be preferably designed according to the sequence of a specific CpG site, and each methylated primer pair capable of specifically amplifying a cytosine that has not been modified by bisulfite, and a cytosine that is not methylated and thus modified by bisulfite It may be a primer pair that can be specifically amplified.

The term "primer" as used throughout the present specification is a base sequence having a short free 3'hydroxyl group, which can form a base pair with a complementary template, and the template strand copy Refers to a short sequence that functions as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. At this time, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

The probe used to measure the methylation level may refer to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid. The probe may be used in a kit or a prediction method for diagnosing delayed ischemia by measuring the methylation level. The probes of interest can be labeled to detect, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method.

According to the exemplary embodiment of the present disclosure, the primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g. methyl phosphonate, phosphorester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

According to one embodiment of the present application, the agent capable of measuring the methylation level may be a primer set that can be used for methylation-specific PCR, and specifically, a methylation-specific primer set and a non-methylation specific primer set It may be included. In addition, the methylation-specific primer set may include a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 3, and the non-methylation specific primer set is a forward primer of SEQ ID NO: 4 and a forward primer of SEQ ID NO: 5 It may include a reverse primer.

According to an embodiment of the present application, as a result of confirming the methylation level of the distal intergenic region upstream of the ITPR3 gene in patients with delayed ischemia and non-patients using methylation-specific PCR, the methylation level is in patients with delayed ischemia. It was confirmed that it was higher. Therefore, based on the above, the methylation level of the distal intergenic region upstream of the ITPR3 gene, specifically the methylation level of the region containing the nucleotide of SEQ ID NO: 1, was confirmed, and delayed ischemia, specifically delayed ischemia that occurred after subarachnoid hemorrhage. You can diagnose the onset of or predict the risk of developing it.

According to one embodiment of the present application, the composition for diagnosing delayed ischemia may include an agent capable of measuring the level of methylation of a nucleotide comprising SEQ ID NO: 1.

According to one embodiment of the present application, the distal intergenic region upstream of the ITPR3 gene may be included in a marker composition for diagnosing delayed ischemia.

The term "marker" used throughout the specification of the present application means a biomarker and can detect changes in a living organism, thereby objectively measuring the normal or pathological state of the living organism, and the degree of reaction to a drug.

According to one embodiment of the present application, the composition for diagnosing delayed ischemia of the present application may diagnose the onset of delayed lingual ischemia, predict the risk of developing delayed ischemia, or predict the prognosis of delayed ischemia, but is limited thereto. no.

The term "diagnosis" as used throughout the present specification means determining whether delayed ischemia has already occurred in a specific individual.

The term "prediction" as used throughout the present specification determines whether there is a possibility of developing delayed ischemia in a specific individual, or whether the likelihood of developing delayed ischemia is relatively high compared to a large number of unspecified people if there is a possibility of developing it. Means to do.

According to the exemplary embodiment of the present disclosure, the delayed ischemia may occur after subarachnoid hemorrhage, but is not limited thereto.

According to an embodiment of the present application, the distal intergenic region upstream of the ITPR3 gene in a patient with delayed ischemia exhibits a higher methylation level than in a patient without delayed ischemia, the upstream of the ITPR3 gene. It can be seen that the onset of delayed ischemia and the possibility of onset of delayed ischemia can be diagnosed by checking the methylation level of the distal intergenic region.

According to one embodiment of the present application, the methylation level of the distal intergenic region upstream of the ITPR3 gene may be affected by the expression level of DNMT1 and/or the expression level of TET1, and specifically, the distal gene upstream of the ITPR3 gene. Hypermethylation of the liver region may be due to an improvement in the expression level of DNMT1 and/or a decrease in the expression level of TET1.

A second aspect of the present application provides a composition for diagnosing delayed ischemia, including an agent capable of measuring the expression level of ITPR3 (inositol 1,4,5-trisphosphate receptor 3). The content overlapping with the first aspect also applies to the composition for diagnosing delayed ischemia of the second aspect.

According to one embodiment of the present application, the composition is DNMT1 (DNA Methyltransferase 1), TET1 (Ten-eleven translocation methylcytosine dioxygenase 1), TET2 (Ten-eleven translocation methylcytosine dioxygenase 2) and TET3 (Ten-eleven translocation methylcytosine dioxygenase 3) It may be to further include an agent capable of measuring the expression level of one or more selected from the group consisting of, specifically, may be to further include an agent capable of measuring the expression level of DNMT1 and / or TET1.

The term "DNMT1 (DNA Methyltransferase 1)" as used throughout this specification is an enzyme encoded by the DNMT1 gene, which catalyzes the transfer of methyl groups to a specific CpG structure of DNA, a process called DNA methylation, and inherits epigenetic inheritance. It is an enzyme that has the function of maintaining DNA methylation so that the mechanical features are replicated. When methylation is abnormally regulated by the enzyme, it may cause tumors or various developmental abnormalities.

The terms "TET1 (Ten-eleven translocation methylcytosine dioxygenase 1), TET2 (Ten-eleven translocation methylcytosine dioxygenase 2) and TET3 (Ten-eleven translocation methylcytosine dioxygenase 3)" as used throughout the specification are enzymes belonging to the TET family, and all It is an enzyme involved in the DNA methylation process. Specifically, it is known that TET1 and TET2 can convert 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC).

According to an embodiment of the present application, due to the improvement in the expression level of DNMT1 and/or the decrease in the expression level of TET1, the distal intergenic region upstream of the ITPR3 gene is hypermethylated, and thus the expression level of ITPR3 is lowered, thereby delaying it. It was confirmed that sexual ischemia may occur, by confirming at least one selected from the group consisting of the expression level of DNMT1, the expression level of TET1, the distal intergenic region upstream of the ITPR3 gene, the methylation level and the expression level of ITPR3, It is possible to diagnose the onset of delayed ischemia, specifically delayed ischemia caused by subarachnoid hemorrhage, or to predict the risk of onset.

As used throughout the specification, the term "measurement of expression level" is to measure the expression or level of expression of a specific gene or a protein encoded by the gene, specifically, the mRNA of the ITPR3 gene or a protein encoded by the gene It may be to measure the expression level of, and additionally, it may be to measure the expression level of the mRNA of one or more genes selected from the group consisting of DNMT1, TET1, TET2, and TET3 or the protein encoded by the gene, but is limited thereto. It is not.

According to one embodiment of the present application, the method of measuring the mRNA level is reverse transcriptase polymerization (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time reverse transcriptase polymerase reaction (real time quantitative RT). -PCR), quantitative polymerase reaction (quantitative RT-PCR), RNase protection method (RNase protection method), Northern blotting (Nothern blotting) or DNA chip method (DNA chip technology) may be.

According to one embodiment of the present application, the method of measuring the level of the protein is Western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunoassay (RIA), radioimmunoassay (radical immunodiffusion), Ouchterlony immunodiffusion, rocket immunoeletrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence ), immunochromatography, fluorescence activated cell sorter analysis, or protein chip technology.

According to one embodiment of the present application, "an agent capable of measuring the expression level" refers to a molecule that can be used to confirm the expression level of a specific gene or the protein encoded by the gene, and specifically, the It may include a gene or an agent capable of detecting and/or amplifying the protein, but is not limited thereto.

As used throughout the present specification, the term "an agent capable of detecting a specific gene or protein" refers to an agent capable of specifically binding and recognizing the specific gene or protein, or detecting and amplifying, " “An agent capable of amplifying a specific gene or protein” refers to an agent capable of increasing the number of the specific gene or protein by repeating the replication. For example, a polynucleotide containing the gene is specifically amplified. It may mean a capable primer or a probe capable of specifically binding, but is not limited thereto.

According to one embodiment of the present application, the agent capable of measuring the expression level is a primer pair, a probe or a primer that specifically binds to one or more genes selected from the group consisting of the ITPR3 gene or additionally DNMT1, TET1, TET2 and TET3. It may be an antisense nucleotide or an antibody specific for a protein encoded by the genes, but is not limited thereto.

The primers used to measure the expression level of the gene are appropriate conditions in an appropriate buffer (e.g., 4 different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) and a template under an appropriate temperature. -Instruction It may be a single-stranded oligonucleotide that can serve as a starting point for DNA synthesis, and the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the polynucleotide of the region for measuring the expression level of the gene, but must be sufficiently complementary to hybridize.

According to one embodiment of the present application, the agent capable of measuring the expression level may be a primer set that can be used for quantitative real-time PCR (qPCR) for measuring the expression level of mRNA, and specifically The primer set is a primer set for ITPR3 (a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7), a primer set for DNMT1 (a forward primer of SEQ ID NO: 8 and a reverse primer of SEQ ID NO: 9), a primer for TET1 Set (forward primer of SEQ ID NO: 10 and reverse primer of SEQ ID NO: 11), primer set for TET2 (forward primer of SEQ ID NO: 12 and reverse primer of SEQ ID NO: 13), and primer set for TET3 (forward primer of SEQ ID NO: 14) And it may be one or more selected from the group consisting of (reverse primer of SEQ ID NO: 15), but is not limited thereto.

According to an embodiment of the present application, as a result of confirming the mRNA expression levels of ITPR3, DNMT1, TET1, TET2 and TET3 in patients with delayed ischemia and non-delayed ischemia using quantitative real-time PCR, the mRNA expression level of ITPR3 is delayed. It was confirmed that the mRNA expression level of DNMT1 was lower in patients with ischemia, the mRNA expression level of DNMT1 was higher in patients with delayed ischemia, and the mRNA expression level of TET1 was lower in patients with delayed ischemia. Therefore, based on the above, the mRNA expression levels of ITPR3, DNMT1, TET1, TET2 and TET3 can be checked to diagnose the onset of delayed ischemia, specifically delayed ischemia after subarachnoid hemorrhage, or predict the risk of onset.

A third aspect of the present application provides a kit for diagnosing delayed ischemia, including the composition for diagnosing delayed ischemia. The content overlapping with the first and second aspects also applies to the kit for diagnosing delayed ischemia of the third aspect.

According to one embodiment of the present application, the kit may be a PCR kit, RT-PCR kit, qRT-PCR kit, methylation-specific PCR kit, DNA chip kit, Western blot kit, or ELISA kit, but is limited thereto. no.

According to one embodiment of the present application, the kit may include a polynucleotide, cDNA, mRNA, polypeptide, etc. of the present application, as well as other constituent compositions, solutions, or devices suitable for analysis methods.

According to one embodiment of the present application, the PCT kit may be a kit including essential elements necessary for performing PCR. PCR kits, in addition to polynucleotides, primers, or probes specific for the genes or methylation regions, test tubes or other suitable containers, reaction buffers (various in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymers. Enzymes and enzymes such as reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like.

According to one embodiment of the present application, the DNA chip kit may be a kit including essential elements necessary to perform a DNA chip, and the DNA chip kit is a polynucleotide, primer, or probe specific for the genes or methylation regions. It includes a substrate to which is attached, and the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.

According to one embodiment of the present application, the RT-PCR kit may be a kit including essential elements necessary for performing RT-PCR, and the RT-PCR kit is each specific for the genes or methylation regions. In addition to primers, test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors , DEPC-water, sterile water, and the like.

A fourth aspect of the present application, from a biological sample isolated from the individual, measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene It provides a method for providing information for diagnosing delayed ischemia, including. The content overlapping with the first to third aspects also applies to the method of providing information for the diagnosis of delayed ischemia of the fourth aspect.

According to one embodiment of the present application, the method may include measuring the methylation level of the nucleotide containing SEQ ID NO: 1 from a biological sample isolated from the individual, and specifically, the 85th to 232 of SEQ ID NO: 1 It may include the step of measuring the level of methylation of the th nucleotide.

According to one embodiment of the present application, the diagnosis of delayed ischemia herein may be diagnosing the onset of delayed ischemia, predicting the risk of developing delayed ischemia, or diagnosing the prognosis of delayed ischemia, and the delayed ischemia is It may have occurred after subarachnoid hemorrhage, but is not limited thereto.

The term "individual" as used throughout the present specification refers to all organisms that develop or are likely to develop delayed ischemia, and specific examples include mice, monkeys, cows, pigs, mini pigs, livestock, humans, etc. It may include mammals and farmed fish, but is not limited thereto.

As used throughout the specification, the term "sample" refers to a substance derived from an individual who develops or is likely to develop delayed ischemia, and specifically, tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, It may include urine, and the like, but is not limited thereto. In addition, a gene sample may be obtained from these samples, and the gene sample may include a nucleic acid, for example, DNA, mRNA, or cDNA synthesized from mRNA, from which the level of DNA methylation or the expression of a specific gene/protein As long as the level can be ascertained, the type is not limited thereto.

According to the exemplary embodiment of the present disclosure, the individual may be a human, and specifically, may be a Korean or Asian, but is not limited thereto.

According to one embodiment of the present application, in order to perform risk prediction or diagnosis of the individual, further comprising the step of analyzing non-genetic information, wherein the non-genetic information is sex, age, hypertension, diabetes, It may be one or more selected from the group consisting of hyperlipidemia and smoking.

According to an embodiment of the present disclosure, the method comprises the steps of measuring the methylation level of a distal intergenic region upstream of the ITPR3 gene from a biological sample isolated from a control; And comparing the methylation levels of the individual and the control group.

As used throughout the specification, the term "control group" refers to a general individual who does not develop delayed ischemia, a non-delayed ischemia patient group, a non-patient group, and a general individual who does not develop delayed ischemia after subarachnoid hemorrhage. I can.

According to an embodiment of the present disclosure, the method further comprises diagnosing the individual as having onset of delayed ischemia or predicting the risk of developing at a high level when the methylation level of the individual is higher than the methylation level of the control group. It may be included.

The fifth aspect of the present application provides a method for providing information for diagnosis of delayed ischemia, comprising measuring the expression level of ITPR3 (inositol 1,4,5-trisphosphate receptor 3) from a biological sample isolated from an individual. do. The content overlapping with the first to fourth aspects also applies to the method of providing information for the diagnosis of delayed ischemia of the fifth aspect.

According to one embodiment of the present application, the method comprises the steps of measuring the expression level of ITPR3 from a biological sample isolated from a control; And comparing the expression levels of ITPR3 of the individual and the control group.

According to one embodiment of the present application, the method is for diagnosing the individual as having onset of delayed ischemia or predicting the risk of developing a high level when the expression level of ITPR3 of the individual is lower than the expression level of ITPR3 of the control group. It may be to further include a step.

According to one embodiment of the present application, the method comprises DNMT1 (DNA Methyltransferase 1), TET1 (Ten-eleven translocation methylcytosine dioxygenase 1), TET2 (Ten-eleven translocation methylcytosine dioxygenase 2) and TET3 (Ten-eleven translocation methylcytosine dioxygenase 3). It may be to further include the step of measuring the expression level of one or more selected from the group consisting of, specifically, may be to further include the step of measuring the expression level of DNMT1 and / or TET1.

According to one embodiment of the present application, the method comprises the steps of measuring one or more expression levels selected from the group consisting of DNMT1, TET1, TET2 and TET3 from a biological sample isolated from a control; And comparing the expression level of the genes and/or proteins of the individual and the control.

According to one embodiment of the present application, the method is for diagnosing the individual as having onset of delayed ischemia or predicting the risk of developing a high level when the expression level of DNMT1 of the individual is higher than the expression level of DNMT1 of the control group. It may be to further include a step.

According to one embodiment of the present application, the method is for diagnosing the individual as developing delayed ischemia or predicting the risk of developing a high level when the expression level of TET1 of the individual is lower than the expression level of TET1 of the control group. It may be to further include a step.

According to the composition for diagnosing delayed ischemia, the kit for diagnosing delayed ischemia, and the method for providing information for diagnosing delayed ischemia of the present invention, the delay occurring after subarachnoid hemorrhage by measuring the methylation level of the distal intergenic region upstream of the ITPR3 gene It can be used to predict or diagnose the risk of developing sexual ischemia.

1 is a diagram showing the nucleotide sequence of the distal intergenic region located upstream of the ITPR3 gene and the location of the primers used for methylation-specific PCR.
Figure 2 shows the result of methylation-specific PCR analysis of the distal intergenic region located on the upstream of the ITPR3 gene, where A is an intergenic region on the upstream of the ITPR3 gene using a methylated or methylated or non-methylated specific primer set. As a result of performing methylation-specific PCR for, patients with delayed ischemia showed higher levels of methylation than those who did not, B shows lower levels of ITPR3 mRNA expression in patients with delayed ischemia. (M: primer specific for methylated allele, U: primer specific for non-methylated allele).
3 is a diagram showing the mRNA expression levels of DNMT1 (A), TET 1 (B), TET2 (C) and TET3 (D) according to delayed ischemia after subarachnoid hemorrhage (*: statistically significant, NS: non-specific).
4 is a diagram showing the correlation between delayed ischemia occurring after subarachnoid hemorrhage and hypermethylation of a distal intergenic region located upstream of the ITPR3 gene.

Hereinafter, the present application will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present application is not limited to these Examples and Experimental Examples.

Example 1: Cohort collection

The cohort to carry out the present application was derived from the Stroke Database (2015-2019) of Chuncheon Sacred Heart Hospital, and for database collection, patients with acute stroke including hemorrhagic and ischemic events were recruited based on clinical symptoms and radiographic examination, Among these, adult patients (over 18 years of age) with subarachnoid hemorrhage due to cerebral aneurysm rupture were analyzed. In addition, patients with vertebral, anatomical, traumatic, and infectious aneurysms, and infectious aneurysms were excluded.

The present application is a discovery step using a genome-scale DNA methylation profile (step 1) and a replication step (step 2) using methylation specific PCR for development of epigenetic candidate markers, two steps. Performed with. In the discovery phase, identification of susceptible epigenetic markers was performed in 40 patients with subarachnoid hemorrhage from September 2016 to October 2017. In addition, in the cloning stage, we compared the overall methylation levels in 42 patients with subarachnoid hemorrhage from September 2017 to October 2018 and 5 normal controls who underwent brain imaging for headache.

The present application is to develop a marker through an epigenetic pattern associated with delayed ischemia that occurs after subarachnoid hemorrhage, which is a novel neurological change associated with vasospasm (e.g., motor disorders, sensory changes, aphasia and Consciousness disorder). Nimodipine (20 μg/kg/hour; Samjin Pharmaceutical, Seoul, Korea) was administered intravenously for 2 weeks, followed by oral nimodipine to prevent vasospasm. Cerebrovascular spasms were monitored daily by TCD, followed by catheter angiography. In addition, a clinical review of sex, age, family history of hypertension, diabetes, hyperlipidemia, smoking and subarachnoid hemorrhage, and radiographic data (aneurysm location, size, H-H (Hunt-Hess) grade and Fisher grade) were conducted. This study was approved by the institutional audit committee (No. 2016-3 and 2017-9).

Example 2: Extraction and quantitative analysis of genomic DNA

In order to extract genomic DNA (gDNA), a whole blood sample was centrifuged at 3000 g for 4 minutes at room temperature to obtain a smoke film, and the smoke film fraction sample was stored at -80°C. gDNA was extracted from the smoke film using the FlexiGene DNA kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The concentration and purity of the extracted gDNA were confirmed by measuring the absorbance ratio (A260/A280) using a UV spectrophotometer Biospectrophotometer (Eppendorf, Hamburg, Germany).

Example 3: Bisulfite conversion of genomic DNA & Infinium methylation assay at the discovery stage

To perform the Infinium MethylationEPIC assay, genomic DNA was treated with sodium bisulfite using the EZ-96 DNA methylation kit (Zymo Research, CA, USA) according to the manufacturer's instructions. DNA methylation was quantified using Infinium MethylationEPIC (EPIC) BeadChip (Illumina, CA, USA).

Potentially present raw quality probes in the raw data were filtered using the minfi package (version 1.24.0.). First, samples with an insignificant mean detection P-value (> 0.05) were excluded, and then minfi performed various standardized pretreatments for Illumina methylated microarrays, and detected P-values greater than 0.01 in one or more samples. The having probe was removed. Finally, any probes related to sex chromosomes and cross-reactions were also filtered. To report the methylation level, the beta and M-values were calculated using the methylated and non-methylated signals.

Example 4: hydrogen sulfite modification (Bisulfite modification) and methylation-specific PCR in the replication step (Methylation-specific PCR)

Using the EpiTect Bisulfite Kit (Qiagen, Hilden, Germany), hydrogen sulfite modification was performed on about 2 μg of DNA according to the manufacturer's instructions. Briefly explaining the above process, gDNA was mixed with a hydrogen sulfite mix and a DNA protection buffer, and then converted into a SimpliAmp Thermal cycler (Thermo Fisher Scientific, MA, USA). The conversion cycling conditions are as follows: 95°C, 5 minutes, 60°C, 25 minutes 95°C, 5 minutes, 60°C, 85 minutes, 95°C, 5 minutes, and 60°C, 175 minutes. Finally, hydrogen sulfite-modified DNA was collected using 20 μl of EB buffer to collect hydrogen sulfite-modified DNA.

In order to confirm the methylation status of the intergenic region (IGR) upstream of ITPR3, methylation-specific PCR (MSP) was performed using the hydrogen sulfite-modified DNA collected above. A schematic diagram of a region in which the methylation level is measured by methylation-specific PCR is shown in FIG. 1.

In addition, the sequence of the primers for performing methylation-specific PCR, the size of the PCR product, and the target region amplified by PCR are shown in Table 1, and PCR reactions for both non-methylated and methylated primers were performed under the following conditions. It was carried out in 45 cycles: 95°C, 15 seconds, 55°C, 15 seconds and 72°C, 30 seconds, using 1.25 U Taq (iTaq, Intron Biotechnology, Seoul, Korea), final volume 20 μl. The PCR product obtained by the above reaction was subjected to electrophoresis on a 3% agarose gel and analyzed by visualizing it in UV.

Primer name Primer sequence (5'→ 3') PCR product
Size (bp) location ^c Sequence number IGR-UF ^a TGTGGGGTTTGGTAGGATATG 146 Chr6:33,584,912
-33,585,058 2 IGR-UR CTTTAAAAACAAAAAAACAAACACA 3 IGR-MF ^b GTGTGGGGTTTGGTAGGATAC 148 Chr6:33,584,915
-33,585,063 4 IGR-MR ACTTTAAAAACGAAAAAACAAACG 5

*a: U represents the primer for the unmethylated allele.

*b: M represents the primer for the methylated allele

*c: The primer position of qPCR represents the base from the start codon. The first nucleotide of the start codon is defined as position 1.

Example 5: Quantitative real-time PCR

To measure the gene expression level, quantitative real-time PCR (qPCR) was performed using Power SYBR Green PCR master Mix (Thermo Fisher Scientific, MA, USA). The qPCR primer sequences are shown in Table 2 below, and the PCR reaction was performed in 45 cycles under the following conditions: 94°C, 15 seconds, 55°C, 30 seconds and 70°C, 30 seconds, Rotor-Gene Q (Qiagen, Hilden, Germany) used.

Primer name Primer sequence (5'→ 3') PCR product
Size (bp) location Sequence number ITPR3-F CTGAGGAGAACCCCAGTTACA 154 1231-1385 6 ITPR3-R TCAAAGAGAGAGGCGATGTCA 7 DNMT1-F GGGAACCAAGCAAGAAGTGAA 149 382-531 8 DNMT1-R CTTGTAATCCTGGGGCTAGGT 9 TET1-F CAGAACCTAAACCACCCGTG 141 713-854 10 TET1-R TGCTTCGTAGCGCCATTGTAA 11 TET2-F GATAGAACCAACCATGTTGAGGG 95 497-592 12 TET2-R TGGAGCTTTGTAGCCAGAGGT 13 TET3-F TCCAGCAACTCCTAGAACTGAG 169 1082-1251 14 TET3-R AGGCCGCTTGAATACTGACTG 15 Actin-F GTGCTATCCCTGTACGCCTC 270 499-769 16 Actin-R GGCCATCTCTTGCTCGAAGT 17

Example 7: Statistical Analysis

Descriptive analysis is expressed using the number of subjects (percentages) of individual and categorical variables, and the mean is expressed as standard deviation. To identify the differentially methylated probe and the differentially methylated region between the two groups, ChAMP ver 2.9.10 was used. Differentially methylated probes satisfying the above conditions (deltabeta, logFC> 0.25 and adj. pval <0.05) were selected by the default option of the champ.DMP function. In addition, using the ProbeLasso method of champ.DMP function, differentiated methylated regions were determined. To compare the methylation profiles between groups, a scatterplot for probe methylation values and box plots for genomic features of each group were generated by the R script. The relative intensity of methylation was expressed as the median value with the interquartile range. Relative methylation strength was calculated as the methylation degree divided by the combined strength of methylated and unmethylated, and then the strength value was additionally divided by the albumin strength used as a reference value. Data on relative methylation degree and mRNA expression were compared using the Mann-Whitney U test. P-value <0.05 was considered statistically significant, and the analysis was performed using MedCalc software (Medcalc, Mariakerke, Belgium).

Experimental Example 1: Confirmation of the clinical characteristics of the cohort group

The clinical characteristics of the cohorts participating in the experiment of the present application described in Example 1 are listed in Table 3 below. Specifically, in delayed ischemia, there were no significant differences according to female sex, hypertension, diabetes, hyperlipidemia, and smoking. However, patients with subarachnoid hemorrhage in the discovery stage tended to be younger than those in the replication stage.

In the discovery stage, a higher HH grade was observed more frequently in delayed ischemia than in non-delayed ischemia, but it was not statistically significant (p=0.311), and coil embolization was performed in most patients (80%). Of the 13 patients with delayed ischemia, 2 (15.4%) underwent chemical angiogenesis to reverse cerebrovascular spasm.

For the cloning stage, higher H-H grades and Fisher grades appeared in patients with delayed ischemia, but were not statistically significant (p=0.124 and p=0.115, respectively).

In addition, most of the aneurysms (81%) were located in the anterior cerebral circulation.

* DCI: delayed cerebral ischemia, HH: Hunt and Hess

Experimental Example 2: Methylation-specific PCR results and ITPR3 mRNA expression level confirmation

To determine whether the mRNA expression level of ITPR3 in patients with delayed ischemia is affected by hypermethylation of the selected distal intergenic region (IGR) upstream of ITPR3, the methylation status and the same site as annotated in the Infinium MethylationEPIC assay and The expression level of the ITPR3 gene was measured using methylation-specific PCR and qRT-PCR, respectively, at the replication stage including 42 subarachnoid hemorrhage patients.

As a result, in the case of subarachnoid hemorrhage patients with delayed ischemia, the degree of methylation in the intergenic region located upstream of ITPR3 was higher than that of patients without delayed ischemia (FIG. 2A ). More specifically, in patients with delayed ischemia, the relative intensity of methylation was significantly increased than in patients without delayed ischemia (DCI: 0.941 [0.857-0.984] vs. non-DCI: 0.670 [0.543-0.761]; p. <0.001).

In addition, as a result of comparing the mRNA expression level of ITRP3 according to delayed ischemia, patients with subarachnoid hemorrhage with delayed ischemia showed significantly lower ITPR3 mRNA expression than those without delayed ischemia (DCI: 0.039 [ 0.030-0.045] vs. non-DCI: 0.047 [0.038-0.064]; p=0.0328) (Fig. 2B).

Experimental Example 3: Confirmation of the relationship between delayed ischemia and DNMT1, TET1, TET2 and TET3

As a result of comparing the mRNA expression levels of DNMT1, TET1, TET2, and TET3 according to delayed ischemia, patients with subarachnoid hemorrhage with delayed ischemia showed higher DNMT1 mRNA expression than those without delayed ischemia ( DCI: 0.0014 [0.0010-0.0029] vs. Non-DCI: 0.0002 [0.00006-0.00097]; p<0.001) (FIG. 3A), in the case of TET1, patients without delayed ischemia were higher than those with delayed ischemia. mRNA levels were shown (non-DCI: 0.077 [0.072-0.088] vs. DCI: 0.071 [0.064-0.079]; p=0.040) (Fig. 3B).

In addition, subarachnoid hemorrhage patients with delayed ischemia showed slightly higher TET2 mRNA expression than patients without delayed ischemia, but were not statistically significant (DCI: 0.033 [0.027-0.041] vs non-DCI. : (0.028 [0.026-0.034]; p=0.304) (Fig. 3C), for TET3, there was no significant difference between the two groups (DCE: 0.077 [0.071-0.083] vs. non-DCI: 0.081 [0.071-0.092] ; p=0.813) (Fig. 3D).

Summarizing the above results, there is a correlation between hypermethylation of the distal intergenic region on the ITPR3 upstream and the onset of delayed ischemia, and the first brain injury caused by subarachnoid hemorrhage is the intergenic region through increased DNMT1 expression and decreased TET1 expression. It can be seen that it increases the methylation state of

In addition, endothelin B (ET _B ) receptors in vascular smooth muscle cells are upregulated by the reduced mRNA expression of ITPR3, and as a result, it can be seen that delayed ischemia may occur simultaneously with cerebrovascular spasm (Fig. 4). ).

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts are included in the scope of the present invention.

<110> Industry Academic Cooperation Foundation, Hallym University <120> DNA methylation marker composition for diagnosis of delayed cerebral ischemia comprising intergenic region of ITPR3 gene upstream <130> 1 <160> 17 <170> KoPatentIn 3.0 <210> 1 <211> 245 <212> DNA <213> Homo sapiens <400> 1 gtgtctgctt gaaggtgagt gtggtggcca taggcatagg ggaagcgcca gaaacggacc 60 ctcttcctgt agaacttctt aggggtgtgg ggcctggcag gacacgggac acattttgag 120 ggactgctgg agtcagactg cctgggttca aatgccagtt ctaacatgct gagccgtgcg 180 atgggtggca gcttgctcaa cctctctgcg tctgtttcct cgtctttaaa gtgggaatat 240 aatag 245 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IGR-UF <400> 2 tgtggggttt ggtaggatat g 21 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IGR-UR <400> 3 ctttaaaaac aaaaaaacaa acaca 25 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IGR-MF <400> 4 gtgtggggtt tggtaggata c 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IGR-MR <400> 5 actttaaaaa cgaaaaaaca aacg 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ITPR3-F <400> 6 ctgaggagaa ccccagttac a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ITPR3-R <400> 7 tcaaagagag aggcgatgtc a 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNMT1-R <400> 8 gggaaccaag caagaagtga a 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNMT1-R <400> 9 cttgtaatcc tggggctagg t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TET1-F <400> 10 cagaacctaa accacccgtg 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TET1-R <400> 11 tgcttcgtag cgccattgta a 21 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TET2-F <400> 12 gatagaacca accatgttga ggg 23 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TET2-R <400> 13 tggagctttg tagccagagg t 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TET3-F <400> 14 tccagcaact cctagaactg ag 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TET3-R <400> 15 aggccgcttg aatactgact g 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin-F <400> 16 gtgctatccc tgtacgcctc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Actin-R <400> 17 ggccatctct tgctcgaagt 20

Claims (11)

Subarachnoid, comprising an agent capable of measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene containing the nucleotide of SEQ ID NO: 1 A composition for diagnosing delayed ischemia that occurs after bleeding.
delete The method of claim 1,
The composition is a composition for diagnosing delayed ischemia that occurs after subarachnoid hemorrhage, which can measure the methylation level of the 85th to 232th nucleotides of SEQ ID NO: 1.
delete A composition for diagnosing delayed ischemia that occurs after subarachnoid hemorrhage, comprising an agent capable of measuring the expression level of ITPR3 (inositol 1,4,5-trisphosphate receptor 3).
The method of claim 5,
DNMT1 (DNA Methyltransferase 1), TET1 (Ten-eleven translocation methylcytosine dioxygenase 1), TET2 (Ten-eleven translocation methylcytosine dioxygenase 2) and TET3 (Ten-eleven translocation methylcytosine dioxygenase 3) A composition for diagnosing delayed ischemia that occurs after subarachnoid hemorrhage, which further comprises an agent capable of.
A kit for diagnosing delayed ischemia that develops after subarachnoid hemorrhage, comprising the composition of claim 1 or 5.
Measuring the methylation level of the distal intergenic region (IGR) upstream of the ITPR3 (inositol 1,4,5-trisphosphate receptor 3) gene containing the nucleotide of SEQ ID NO: 1 from the biological sample isolated from the individual A method for providing information for diagnosis of delayed ischemia occurring after subarachnoid hemorrhage comprising a.
The method of claim 8, wherein the method
Measuring the methylation level of the distal intergenic region upstream of the ITPR3 gene containing the nucleotide of SEQ ID NO: 1 from the biological sample isolated from the control; And
Comparing the methylation levels of the subject and the control;
The method of providing information for diagnosing delayed ischemia that occurs after subarachnoid hemorrhage is further comprising a.
The method of claim 9, wherein the method
When the methylation level of the subject is higher than the methylation level of the control group, determining that the subject has developed delayed ischemia or predicting the risk of developing at a high level. Information provision method for the diagnosis of delayed ischemia.
delete

Images