KR101582723B1 - Genetic marker for predicting a risk of developing colorectal cancer and use thereof - Google Patents

Abstract

The present invention relates to a method for identifying a specific single nucleotide polymorphism (SNP) nucleotide having a significant correlation with the risk of developing a colorectal cancer and thereby predicting the risk of developing colon cancer, a polynucleotide, a polypeptide, an antibody Or cDNA, and a microarray and kit comprising the same.

Description

Genetic markers for predicting risk of colorectal cancer and its use

The present invention relates to a method for identifying a specific single nucleotide polymorphism (SNP) nucleotide having a significant correlation with the risk of developing a colorectal cancer and thereby predicting the risk of developing colon cancer, a polynucleotide, a polypeptide, an antibody Or cDNA, and a microarray and kit comprising the same.

The structure of the large intestine is from the end of the small intestine to the anus, which is about 1.5m in length. The large intestine consists of ascending, traversing, descending, sigmoid colon, rectum, and anus. The main function of the colon is to digest the remaining food from the small intestine and absorb the water and electrolyte, and to discharge the remaining residue.

Colorectal cancer is a malignant tumor of the ascending colon, transverse colon, descending colon, sigmoid colon, and rectal mucosa. It is composed of adenocarcinoma, adenocarcinoma, and adenocarcinoma, including adenocarcinoma, lymphoma, sarcoma and squamous cell carcinoma. The incidence of colorectal cancer in Korea is as follows: ascending colon and s-colon are 25% and 20%, respectively.

In Korea, colorectal cancer was not a common disease before the 1970s, but it is now increasing due to changes in Westernized diet. According to the National Census of Statistics (National Approval Statistics No. 10154) and the Ministry of Health and Welfare Cancer Registration Statistics (National Approval Statistics No. 11744), among the 10 years from 2000 to 2010, the incidence of colorectal cancer was 21.8 out of 100,000 41.5, the mortality rate has almost doubled from 8.8 to 15.4 out of 100,000, and is still increasing. Surgery is the most effective treatment for colorectal cancer, like other cancers of the gastrointestinal system. The survival rate is 70 to 90% at the early stage of stage I to stage 3, but is 15% at stage 4.

The major risk factors for colorectal cancer can be divided into two major categories. The first is environmental factors, which are known to be due to aging, excessive meat intake, lack of fiber intake, lack of vitamin intake, lack of calcium intake, lack of exercise, drinking and smoking. It is known that APC, KRAS, P53, MLH1, MSH2, INK4A and SMAD4 are involved in several stages of cancer development and metastasis.

On the other hand, in humans, there is a mutation of about once per 1000 bases. This is referred to as SNP (single nucleotide polymorphism), 5% polymorphism as common polymorphism, and 1-5% polymorphism as rare polymorphism. Currently, a number of experimental techniques have been developed to analyze whole human sequences. Among them, a genome-wide association study (GWAS) has been used in many disease studies to date.

GWAS generally assumes that common disease is associated with a common variant, which seems to be a problem of 'missing heritability' in this study. The 'lost permittivity' is a phenomenon in which individual genes can not explain all the phenotypes of diseases or behaviors, and the disease is determined by a combination of all genotypes. In recent years, gene-environment interactions and gene-gene interactions have been widely used to supplement this.

However, in the past, little research has been reported to diagnose the risk of colorectal cancer using gene SNP polymorphism. The present inventors hypothesized that individual SNP mutations would affect the risk of developing colorectal cancer and analyzed the relationship between the SNPs in the clinical samples and the risk of colon cancer in patients with colorectal cancer and normal subjects, We have identified a single SNP biomarker that can predict risk. Furthermore, the present inventors completed the present invention by constructing a more robust colon cancer prediction model through analysis of gene-gene interactions using a single SNP.

One object of the present invention is to provide a method for predicting the risk of developing colon cancer by identifying a specific SNP base having a significant correlation with the risk of colon cancer in a gene sample obtained from a patient .

It is an object of the present invention to provide a method for providing information for predicting risk of developing colon cancer by identifying a specific SNP base having a significant correlation with the risk of colon cancer in a gene sample obtained from a patient.

Another object of the present invention is to provide a composition for predicting risk of developing colon cancer, which comprises a polynucleotide, a polypeptide or cDNA thereof capable of identifying a specific SNP marker.

Another object of the present invention is to provide a microarray for predicting the risk of developing a colorectal cancer, which comprises a polynucleotide, a polypeptide, an antibody thereto, or cDNA thereof capable of identifying a specific SNP marker.

Another object of the present invention is to provide a kit for predicting risk of developing colon cancer, which comprises a polynucleotide capable of identifying a specific SNP marker, a polypeptide, an antibody thereto, or cDNA thereof.

Colorectal cancer is caused by environmental factors and genetic factors. Pre-prediction and prevention of genetic factors can effectively prevent colon cancer. In the present invention, a powerful model for predicting colorectal cancer using gene-gene interactions has been proposed.

The present inventors confirmed the relationship between SNP (rs3865188) in the T-cadherin gene and the risk of colorectal cancer in 325 patients with colorectal cancer and 977 patients with normal group. Furthermore, SNPs in the adiponectin gene, which is a ligand of rs3865188 and t- (Rs2241767, rs3821799, rs3774261, rs6773957) and the risk of colon cancer were analyzed.

As a result, rs3865188 could be used as a single SNP in predicting the risk of colorectal cancer, and it was further confirmed that a combination of rs3865188 and adiponectin SNP could predict a risk group up to 4.257 times higher. It was also confirmed that these gene-gene combinations correlated with the actual amount of adiponectin in the blood.

Accordingly, in one embodiment, the present invention includes a step of confirming the polymorphism of the 27th nucleotide of the sequence represented by SEQ ID NO: 1 (NCBI refSNP ID: rs3865188) in the T-cadherin gene with respect to the gene sample obtained from the patient A method for providing information for predicting the risk of developing colon cancer.

In a preferred embodiment, the present invention relates to a method for screening a gene sample obtained from a patient for the polymorphism of the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, (NCBI refSNP ID: rs3774261) in the adiponectin gene, and the nucleotide sequence of SEQ ID NO: 5 (NCBI refSNP ID: rs3774261) in the adiponectin gene, the polymorphism of the 27th base of the sequence represented by SEQ ID NO: ID: rs6773957). ≪ / RTI > In another aspect, the present invention provides a method for providing information for predicting the risk of developing a colorectal cancer, which method comprises the step of identifying at least one polymorphism selected from the group consisting of the 27th base of the sequence represented by SEQ ID NO:

In the present invention, T-cadherin (H-cadherin or CDH13) is also known as a receptor for adiponectin and a receptor for LDL, and methylation studies of the T-cadherin promoter region in relation to colorectal cancer have been reported Br J Cancer, 2004, 90, 1030-3, Cancer Res, 2002, 62m 3383-6).

In addition, adiponectin (adiponectin, APN, adipoQ or apM1) has been reported to be associated with insulin resistance in the body, and as the adiponectin level in the body of the colon cancer is lower, it has been reported to be associated with colorectal cancer (J Natl Cancer Inst, 2005, 97, 1688-94, int J Colorectal Dis, 2009, 24, 275-81).

In Table 1 below, the refSNP ID of the NCBI for the SNP marker provided by the present invention indicates the sequence of the corresponding SNP and its position. Those skilled in the art can easily identify the position and sequence of the SNP using the above numbers. It will be apparent to those skilled in the art that the specific sequence corresponding to the refSNP ID of the SNPs registered in the NCBI may be varied slightly depending on the results of the study of the succeeding genes and such altered sequences are also included within the scope of the present invention.

NCBI refSNP ID order SEQ ID NO: rs3865188 AGCAAGTTTGTCCCTGGTCTTTGTGG [A / T] ATCTATGTACAACCTTCAGTAGCCT One rs2241767 TTTTATGTTAACCATAAGCAACCTGA [A / G] GTGATTTGGGGTTGGTCTTCCAAGG 2 rs3821799 ATGTGCAAGGCTCTGTTGGTGGTTAC [C / T] ACAAGAAAGTCTACTCTAAAAATGT 3 rs3774261 TTCAAAGTATGGAGCATAGAGAAAAT [A / G] TACTCACCGTGGACCTGATGAAGAA 4 rs6773957 TCATGAAGACCAATCTCTTGAATCCC [A / G] TATCTACCCAGAATTAACTCCATTC 5

For example, in the present invention, it can be predicted that the 27th base of the sequence represented by SEQ ID NO: 1 (rs3865188) in the T-cadherin gene has a TT genotype higher than that of AA or AT. In a specific example of the present invention, the rs3865188: TT genotype was found to be 1.577 times more risky than the rs3865188: AA or rs3865188: AT genotype group ( p = 0.0144).

In another embodiment, in the present invention, the genotype of the 27th base in the sequence represented by SEQ ID NO: 1 (rs3865188) in the T-cadherin gene is TT and the genotype of the 27th base in SEQ ID NO: 2 (rs2241767) in the adiponectin gene is AA , Or when the genotype of the 27th base of SEQ ID NO: 1 is TT and the genotype of the 27th base of SEQ ID NO: 2 is GA or AA, it can be predicted that the risk of colon cancer is high.

In a specific embodiment of the present invention, a person with the rs3865188: TT and rs2241767: AA genotypes compared to rs3865188: AA and rs2241767: GG genotypes was found to be 2.485 times more susceptible to the risk for colorectal cancer. We also found that individuals with rs3865188: TT and rs2241767: GA, AA genotypes were 2.301 times more susceptible to the risk for colorectal cancer than rs3865188: AA and rs2241767: GG genotypes.

As another example, in the present invention, the 27th nucleotide of SEQ ID NO: 1 (rs3865188) in the T-cadherin gene is TT and the 27th nucleotide of SEQ ID NO: 3 (rs2241767) in the adiponectin gene is CC The risk of developing colon cancer can be expected to be high.

In a specific embodiment of the present invention, a person with rs3865188: TT and rs3821799: CC genotypes compared to rs3865188: AA and rs3821799: TT genotypes was found to be 3.573 times more susceptible to the risk for colorectal cancer.

As another example, in the present invention, the 27 th base of the sequence represented by SEQ ID NO: 1 (rs3865188) in the T-cadherin gene is TT and the 27th base of SEQ ID NO: 4 (rs3774261) in the adiponectin gene has the genotype GG The risk of developing colon cancer can be expected to be high.

In a specific embodiment of the present invention, a person with the rs3865188: TT and rs3774261 GG genotypes compared to rs3865188: AA and rs3774261: AA genotypes was found to be 4.257 times more susceptible to the risk for colorectal cancer.

In another embodiment, the genotype of the 27 th base in the sequence represented by SEQ ID NO: 1 (rs3865188) in the T-cadherin gene is TT and the genotype of the 27th nucleotide in SEQ ID NO: 5 (rs6773957) in the adiponectin gene is GG The risk of developing colon cancer can be expected to be high.

In a specific embodiment of the present invention, a person with the rs3865188: TT and rs6773957: GG genotypes compared to the rs3865188: AA and rs6773957: AA genotypes was found to be 3.992 times more susceptible to the risk for colorectal cancer.

In the present invention, the patient may be a general patient before the onset of colorectal cancer, and a patient who intends to predict and manage the risk of developing colon cancer. Alternatively, it may be a patient already having colon cancer.

In the present invention, a sample obtained from a patient includes a tissue, a cell, a whole blood, a serum, a plasma, a saliva, a sputum, a cerebrospinal fluid or urine and obtains a gene sample from these samples. And includes cDNA to be synthesized.

In the present invention, the term "prediction " refers to determining whether a patient has a high incidence of colorectal cancer, whether the likelihood of developing colon cancer is relatively high, or whether a colorectal cancer has already developed. The method of the present invention can be used to slow the onset or prevent the onset of disease through special and appropriate management as a patient with a high risk of developing colorectal cancer for any particular patient. In addition, the methods of the present invention can be used clinically to make treatment decisions by early diagnosis of colon cancer and by selecting the most appropriate treatment regimen.

In the present invention, the term "polymorphism" refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base differs from a polymorphism region to a single base polymorphism (single nucleotide polymorphism, SNP). Preferred polymorphic markers have two or more alleles exhibiting an incidence of 1% or more, more preferably 10% or 20% or more, in the selected population.

The term "allele " in the present invention refers to various types of genes that exist on the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two kinds of bialles.

In another aspect, the present invention provides a composition for predicting the risk of developing colon cancer in a patient.

The composition is characterized in that it contains a reagent for identifying the 27th base of the sequence represented by SEQ ID NO: 1 (NCBI refSNP ID: rs3865188) in the T-cadherin gene, with respect to the isolated gene sample from the patient.

For example, the reagent contained in the composition of the present invention is preferably composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 1 (NCBI refSNP ID: rs3865188) in the T-cadherin gene RTI ID = 0.0 > polynucleotide < / RTI > or a complementary polynucleotide thereof

Further, the above composition is characterized in that, for the gene sample isolated from the patient, the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, the SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) in the adiponectin gene The 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) in the displayed sequence, the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs6773427) in the adiponectin gene, And a reagent for identifying one or more bases selected from the group consisting of the first base and the second base.

For example, the reagent contained in the composition may be the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) (NCBI refSNP ID: rs3774261) in the adiponectin gene, and the 27th base of the sequence represented by SEQ ID NO: 5 (NCBI refSNP ID: rs6773957) in the adiponectin gene of the 27th base of the adiponectin gene of SEQ ID NO: A polynucleotide consisting of 10 or more consecutive bases comprising one or more bases selected from the group consisting of SEQ ID NOs.

Accordingly, the present invention provides the above polynucleotide as an embodiment.

The polynucleotide or its complementary polynucleotide according to the present invention may comprise more than 10, preferably 10 to 100, more preferably 20 to 60, even more preferably 40 to 60 contiguous bases have.

The polynucleotide or its complementary polynucleotide according to the present invention is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a single base polymorphism in the nucleotide sequence. A polymorphic site is a site in a polymorphic sequence where a single base polymorphism occurs. In the present invention, the polynucleotide may be DNA or RNA.

In another example, the reagent contained in the composition of the present invention may preferably include a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof.

Accordingly, the present invention provides, as an aspect, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof.

In the present invention, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof is an allele-specific polynucleotide.

Allele-specific polynucleotides are meant to specifically hybridize to each allele. That is, hybridization refers to hybridization so that the base of the polymorphic site present in the polymorphic sequence can be specifically discriminated. Here, hybridization is usually carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

In the present invention, the allele-specific polynucleotide may be an allele-specific probe. That is, in the present invention, a probe means a hybridization probe, and means an oligonucleotide capable of binding sequence-specifically to a complementary strand of a nucleic acid. The allele-specific probe of the present invention has a polymorphic site among nucleic acid fragments derived from two individuals of the same species, and hybridizes to a DNA fragment derived from one individual, but not to a fragment derived from another individual. In this case, the hybridization conditions show a significant difference in the hybridization intensity between the alleles, and should be sufficiently strict so that only one of the alleles hybridizes. Preferably, the probe of the present invention aligns with the polymorphic site of the polymorphic sequence. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used in a diagnostic kit such as a microarray for predicting the risk of colon cancer by detecting alleles, a prediction method, and the like.

In the present invention, the allele-specific polynucleotide may be an allele-specific primer. The appropriate length of the primer may vary depending on the purpose of use, but is generally comprised of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primer hybridizes to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing the polymorphic site. The primer of the present invention can be used for a diagnostic kit such as a microarray for predicting the risk of colon cancer by detecting alleles, a prediction method and the like.

As another example, the reagent contained in the composition of the present invention may comprise a polypeptide encoded by the polynucleotide or a complementary polynucleotide thereof.

Accordingly, the present invention provides, as an embodiment, a polypeptide encoding the polynucleotide.

Such polypeptides may be used in compositions, microarrays or kits for predicting the risk of colorectal cancer. Alternatively, an antibody to the polypeptide may be used in place of the polypeptide.

In the present invention, an antibody refers to a specific protein molecule, which is known in the art and directed to an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a polypeptide comprising a SNP marker of the present invention. Such an antibody can be prepared by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene, and obtaining the protein from the obtained protein by a conventional method. Also included are partial peptides that can be made from the protein, and the partial peptides of the invention include at least 7 amino acids, preferably 9 amino acids, more preferably 12 or more amino acids. The form of the antibody of the present invention is not particularly limited, and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention and include all immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies. Antibodies used in the detection of markers for predicting risk of developing colon cancer of the present invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

The polynucleotide, the polynucleotide that specifically hybridizes with the polynucleotide, the polypeptide specifically encoded by the polynucleotide, or the cDNA thereof contained in the composition of the present invention is also useful for the production of a microarray or kit for predicting the risk of colon cancer Lt; / RTI > The microarray or kit may be prepared by conventional methods known to those skilled in the art.

In the present invention, the microarray may be a conventional microarray, except for including polynucleotides, polypeptides, cDNA, etc. of the present invention. The hybridization of nucleic acids on a microarray and the detection of hybridization results are well known in the art. The detection may be performed, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray, The hybridization result can be detected.

In the present invention, the kit may include one or more other component compositions, solutions or devices suitable for the analysis method as well as polynucleotides, polypeptides, cDNAs, etc. of the present invention. In one embodiment, the kit of the present invention may be a kit containing the necessary elements necessary to perform PCR and may be a test tube or other suitable container, reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs) Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water and sterile water. In another embodiment, the kit of the present invention may be a kit for predicting the risk of colorectal cancer including essential elements necessary for carrying out a DNA chip, and the DNA chip kit may include a polynucleotide, a primer or a probe specific for the SNP And the substrate may comprise a nucleic acid corresponding to a quantitation control gene or a fragment thereof.

The genotyping of the SNP of the present invention can be confirmed by sequencing analysis, sequencing analysis using an automatic sequencer, pyrosequencing, hybridization with a microarray, PCR-RELP (restriction fragment length polymorphism), PCR-SSCP single strand conformation polymorphism (PCR), SSO (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method using PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF / MS method, RCA method rolling circle amplification, HRM (high resolution melting), primer extension, Southern blot hybridization, dot hybridization, and the like.

Further, the results of the SNP polymorphism can be statistically processed using statistical analysis methods commonly used in the art, such as Student's t-test, Chi- continuous variables, categorical variables, odds ratios, and 95% confidence intervals, obtained through linear regression analysis, linear regression line analysis, and multiple logistic regression analysis, % Confidence interval, and so on.

The present invention can provide information that can diagnose, predict and prevent colon cancer risk group by providing a genotype susceptible to colon cancer. In addition, the present invention can provide a method for providing information for developing and predicting a diagnostic kit for early diagnosis of a composition capable of preventing colon cancer.

Figure 1 shows the association disequilibrium (LD) between the 6 adiponectin gene SNPs.
Figure 2 shows the correlation between the interaction between rs3865188 and rs3774261 and the level of adiponectin in human blood. The rs3865188: TT and rs3774261: GG genotype combination group (median value of adiponectin: 4.800 ug / ml), which showed the highest risk for colorectal cancer compared with rs3865188: AA and rs3774261: AA genotype combination group ) Was significantly lower in the blood ( P = 0.0017).

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Overview of Statistical Analysis

In the present invention, the risk of colorectal cancer due to the interaction between rs3865188 of t-cadherin and rs2241767, rs3821799, rs3774261 and rs6773957 of adiponectin was shown through statistical analysis. We also found a link between the combined genotype of these interacting SNP-SNPs and the amount of adiponectin in the blood.

In the present invention, samples were collected from a colorectal cancer sample in a cohort of Metabolic Syndrome of the research team of the Yonsei Univ. School of Medicine, and the adiponectin blood level was measured using a Mesdia adiponectin ELISA kit. The following statistical analysis tools were utilized for the present invention. T-test and ANOVA were used according to the normality test, and statistical analysis was performed by other nonparametric tests. Genetic - gene interactions were basically analyzed by logistic regression and corrected for age and BMI.

Example  2. SNP - SNP  Group composition for analyzing interactions

For the present invention, a group of 325 colorectal cancer patients and 977 normal cancer patients were selected from the group of patients with the metabolic syndrome cohort study at the Yonsei University Graduate School of Public Health. Differences between the two groups are clearly distinguished in clinical characteristics (Table 2).

Total P- value Normal group (n = 977) Colorectal cancer patients (n = 325) male(%) 56.5% 72.9% age 41.26 8.44 52.82 + - 10.33 <.0001 FBS 93.78 ± 16.32 97.62 ± 19.58 0.0005 BMI 23.66 ± 3.12 24.17 ± 2.91 0.0095 TC 185.5 ± 32.48 191.7 ± 36.48 0.0038 TG 117.6 ± 89.66 145.8 ± 92.30 <.0001 HDL 54.21 + - 12.83 51.48 ± 12.80 0.0011 LDL 110.1 ± 29.38 113.4 ± 32.62 0.0833 FBS: fasting blood sugar
BMI: body mass index (BMI)
TC: Total cholesterol (total cholesterol)
TG: triglyceride
HDL: high density lipoprotein (HDL)
LDL: Low density lipoprotein (LDL)

Example  3. Six Adiponectin Association imbalance ( LD ) analysis

Adiponectin gene SNPs were analyzed by using Haploview v4. Based on the genotyping data of Korean cohorts reported by the professor of Yonsei University under the rs182052, rs17366568, rs2241767, rs3821799, rs3774261, rs6773957. Of the six SNPs, rs2241767, rs3821799, rs3774261, and rs6773957 were found to form a linkage diseuilibrium block (LD block) with strong association imbalance. (Fig. 1, r ² = 98 and r ² = 99)

Example  4. Colorectal cancer and T- Kedherin SNP  ( rs3865188 ) And Adiponectin  gene SNP Analysis of association with

The significance of rs3865188, rs182052, rs17366568, rs2241767, rs3821799, rs3774261, and rs6773957 on the genotype of colon cancer patients was examined. As a result, only rs3865188 of T-cadherin showed the difference between genotype-based colorectal cancer patients and normal group (p = 0.0474), and adiponectin SNP did not show any correlation with colorectal cancer (Table 3).

gene SNP No . Group (n) genotype P- value frequency( frequency ) CDH13 rs3865188 AA AT TT Patients with colorectal cancer (315) 0.4646 0.3815 0.1538 0.0474 Normal group (977) 0.4862 0.4104 0.1034 APN rs182052 AA AG GG Patients with colorectal cancer (325) 0.2646 0.5077 0.2277 0.4161 Normal group (974) 0.2402 0.4979 0.2618 rs17366568 AA AG GG Patients with colorectal cancer (325) 0.0000 0.5540 0.9446 0.4235 Normal group (977) 0.0100 0.3990 0.9591 rs2241767 AA AG GG Patients with colorectal cancer (325) 0.4954 0.4246 0.0800 0.7045 Normal group (977) 0.5067 0.4023 0.0811 rs3821799 CC CT TT Patients with colorectal cancer (325) 0.1692 0.4677 0.3631 0.3357 The normal group (968) 0.1395 0.4638 0.3967 rs3774261 AA AG GG Patients with colorectal cancer (324) 0.3179 0.5062 0.1759 0.1516 The normal group (972) 0.3755 0.4743 0.1502 rs6773957 AA AG GG Patients with colorectal cancer (325) 0.3169 0.5046 0.1785 0.1417 Normal group (977) 0.3756 0.4719 0.1525

Example  5. T- Kedherin of rs3865188  Colon cancer risk analysis

The odds ratios for t-cadherin rs3865188 were determined using logistic regression analysis. The risk was divided into T-dominance mode and T-recessive mode. In the T-dominance mode, the TT genotype and the TA genotype were considered as one group, and the risk was analyzed for the AA genotype. The T-recessive mode was a risk factor for the TT genotype in the TA genotype and the AA genotype. The TT genotype was 1.577 times higher than the TA genotype and AA genotype ( p = 0.0144) (Table 4). Therefore, it was confirmed that the risk of colorectal cancer can be predicted by the genotype of rs3865188 of T - cadherin in Koreans.

Effects Point
estimate 95% wald
Confidence limits P- value T-dominance 1.090 0.848 1.402 0.5003 T-recessive 1.577 1.095 2.272 0.0144 T-Dominance; TT + TA vs. AA
T-recessive; TT vs. TA + AA,
Adjusted for age and BMI.

Example  6. rs3865188 and rs2241767  Predicting Risk of Colorectal Cancer by Interaction

Unlike the rs3865188 SNP of ticadherin in the present invention, the adiponectin SNP was not found to be associated with colon cancer. Thus, in the present invention, analysis was performed using gene-gene interactions between rs3865188 SNP of ticadherin and adiponectin SNP.

The risk of colorectal cancer due to gene-gene interactions for the four SNPs of rs3865188 and adiponectin was measured by logistic regression analysis. Among them, the combination of rs2241767 and rs3865188 of adiponectin was found to be much higher than that of rs3865188 single SNP. Those with rs3865188: TT and rs2241767: AA genotype compared to rs3865188: AA and rs2241767: GG genotypes were 2.485 times more susceptible to the risk for colorectal cancer. We also found that individuals with rs3865188: TT and rs2241767: GA, AA genotypes were 2.301 times more susceptible to the risk of colorectal cancer than rs3865188: AA and rs2241767: GG genotypes (Table 5).

rs3865188 AA AT TT AA , AT AT , TT rs2241767 GG One 1.460
(0.516-4.128)
0.4756 2.775
(0.598-12.872)
0.1923 1.179
(0.491-2.834)
0.7128 1.729
(0.649-4.610)
0.2736 GA 2.135
(0.939-4.854)
0.0703 1.664
(0.729-3.795)
0.2262 2.053
(0.749-5.626)
0.1619 1.927
(0.873-4.256)
0.1045 1.780
(0.787-4.025)
0.1662 AA 1.381
(0.609-3.131)
0.4392 1.651
(0.739-3.702)
0.2239 2.485
(1.042-5.923)
0.0400 1.506
(0.688-3.295)
0.3058 1.824
(0.839-3.963)
0.1292 GG , GA 1.833
(0.825-4.072)
0.1365 1.367
(0.730-3.672)
0.2320 2.222
(0.839-5.882)
0.1081 1.755
(0.808-3.814)
0.1555 1.785
(0.799-3.991)
0.1579 GA , AA 1.692
(0.768-3.726)
0.1919 1.647
(0.755-3.594)
0.2099 2.301
(1.005 to 5.268)
0.0485 1.676
(0.766-3.618)
0.1883 1.790
(0.832-3.849)
0.1362

Example  7. rs3865188 and rs3821799  Interaction between

The second SNP of the LD block of adiponectin, rs3821799, was also found to be associated with rs3865188. Compared to rs3865188: AA and rs3821799: TT genotypes, individuals with rs3865188: TT and rs3821799: CC genotypes were found to be 3.573 times more susceptible to the risk for colorectal cancer (Table 6).

　
　 rs3865188 AA AT TT AA , AT AT , TT rs3821799
TT One 0.956
(0.575-1.589)
0.8609 1.515
(0.701-3.275)
0.2910 0.978
(0.638-1.500)
0.9203 1.056
(0.655-1.702)
0.8225 TC 1.038
(0.650-1.657)
0.8764 1.145
(0.713-1.841)
0.5751 1.360
(0.700-2.641)
0.3640 1.091
(0.722-1.647)
0.6796 1.199
(0.770-1.865)
0.4223 CC 1.317
(0.688-2.520)
0.4056 0.956
(0.575-1.589)
0.8609 3.573
(1.292-9.887)
0.0142 1.332
(0.771-2.304)
0.3044 1.755
(0.936-3.289)
0.0796 TT , TC 1.019
(0673-1.544)
0.9280 1.047
(0.687-1.597)
0.8298 1.408
(0.808-2.455)
0.2274 1.033
(0.705-1.515)
0.8664 1.122
(0.750-1.695)
0.5754 TC , CC 1.095
(0.701-1.708)
0.6907 1.186
(0.756-1.860)
0.4585 1.716
(0.949-3.100)
0.0738 1.135
(0.760-1.696)
0.5350 1.298
(0.851-1.980)
0.2252

Example  8. rs3865188 and rs3774261  Interaction between

The third SNP of the LD block of adiponectin, rs3774261, showed the strongest risk among the 6 SNPs in combination with rs3865188. Individuals with rs3865188: TT and rs3774261 GG genotypes are 4.257 times more likely to be at risk for colorectal cancer than rs3865188: AA and rs3774261: AA genotypes (Table 7).

　
　 rs3865188 AA AT TT AA , AT AT , TT rs3774261 AA One 0.803
(0.467-1.382)
0.4289 1.551
(0.711-3.381)
0.2698 0.907
(0.582-1.415)
0.6676 0.943
(0.572-1.555)
0.8180 AG 1,000
(0.623-1.604)
0.9989 1.221
(0.762-1.956)
0.4075 1.206
(0.615-2.366)
0.5859 1.103
(0.726-1.675)
0.6469 1.222
(0.782-1.908)
0.3794 GG 1.216
(0.637-2.320)
0.5536 1.280
(0.636-2.575)
0.4890 4.257
(1.557-11.638)
0.0048 1.251
(0.725-2.160)
0.4216 1.784
(0.965-3.299)
0.0651 AA , AG 1,000
(0.654-1.530)
0.9988 1.026
(0.66-1.581)
0.9065 1.319
(0.749-2.323)
0.3369 1.013
(0.683-1.501)
0.9502 1.089
(0.719-1.648)
0.6875 AG , GG 1.037
(0.660-1.629)
0.8739 1.235
(0.787-1.938)
0.3581 1.653
(0.912-2.993)
0.0974 1.125
(0.747-1.693)
0.5736 1.322
(0.862-2.025)
0.2004

Example  9. rs3865188 and rs6773957  Interaction between

The last SNP of the LD block of adiponectin, rs6773957, was able to confirm the risk in combination with rs3865288. Individuals with rs3865188: TT and rs6773957: GG genotypes are 3.992 times more susceptible to the risk for colorectal cancer than rs3865188: AA and rs6773957: AA genotypes (Table 8).

　
　 rs3865188 AA AT TT AA , AT AT , TT rs6773957 AA One 0.803
(0.467-1.382)
0.4281 1.556
(0.713-3.393)
0.2666 0.907
(0.582-1.415)
0.6672 0.907
(0.582-1.415)
0.6672 AG 1.003
(0.625-1.608)
0.9917 1.224
(0.764-1.962)
0.4009 1.210
(0.610-2.373)
0.5799 1.106
(0.728-1.680)
0.6368 1.106
(0.728-1.680)
0.6368 GG 1.249
(0.657-2.375)
0.4951 1.270
(0.632-2.552)
0.5019 3.992
(1.487-10.716)
0.0060 1.266
(0.734-2.183)
0.3966 1.266
(0.734-2.183)
0.3966 AA , AG 1.002
(0.655-1.532)
0.9931 1.028
(0.667-1.583)
0.9013 1.324
(0.752-2.331)
0.3315 1.014
(0.684-1.503)
0.9439 1.014
(0.684-1.503)
0.9439 AG , GG 1.047
(0.666-1.644)
0.8427 1.236
(0.788-1.939)
0.3568 1.645
(0.908-2.977)
0.1004 1.130
(0.751-1.702)
0.5568 1.130
(0.751-1.702)
0.5568

Example  10. rs3865188 and rs3774261  Interactions between the blood and the human body Adiponectin amount

In the present invention, the risk of colorectal cancer was predicted using gene-gene interactions. In particular, although rs3865188 discovered by the present inventors can predict the risk alone, the combination of rs3865188 and the four SNPs forming the LD block of adiponectin has been further subdivided and predicted at high risk.

Using the correlation between the previously reported intracerebral and adiponectin levels in the blood, we found that the combination of rs3865188 and rs3774261, which were the most risky, The blood levels of adiponectin of rs3865188: TT and rs3774261: GG were significantly lower than those of rs3865188: AA and rs3774261: AA genotypes, which were the highest risk combinations (Fig. 2: rs3865188: AA and rs3774261: AA adiponectin Median value 7.835 ug / ml, rs3865188: TT and rs3774261: median value of adiponectin of GG 4.800 ug / ml, P = 0.0017). In the present invention, the relationship between disease-related gene-gene interactions and actual clinical parameters was confirmed.

<110> CATHOLIC UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION          Yonsei University, University - Industry Foundation (UIF) <120> Genetic marker for predicting a risk of developing colorectal          cancer and use thereof <130> DPP20136315KR <160> 5 <170> Kopatentin 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or t <400> 1 agcaagtttg tccctggtct ttgtggyatc tatgtacaac cttcagtagc ct 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or g <400> 2 ttttatgtta accataagca acctgaygtg atttggggtt ggtcttccaa gg 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or t <400> 3 atgtgcaagg ctctgttggt ggttacyaca agaaagtcta ctctaaaaat gt 52 <210> 4 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or g <400> 4 ttcaaagtat ggagcataga gaaaatytac tcaccgtgga cctgatgaag aa 52 <210> 5 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or g <400> 5 tcatgaagac caatctcttg aatcccytat ctacccagaa ttaactccat tc 52

Claims (14)

For gene samples from patients,
Confirming the polymorphism of the 27th base of the sequence represented by SEQ ID NO: 1 (NCBI refSNP ID: rs3865188) in the T-cadherin gene; And
The 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, the 27th base of the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) in the adiponectin gene, , The polymorphism of the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) in the adiponectin gene and the 27th base of the sequence represented by SEQ ID NO: 5 (NCBI refSNP ID: rs6773957) in the adiponectin gene Identifying at least one polymorphism selected from the group consisting of: &lt; RTI ID = 0.0 &gt;
A method of providing information for predicting the risk of developing colon cancer.
2. The method according to claim 1, wherein the risk of colon cancer is higher than that of AA or AT when the 27th base of SEQ ID NO: 1 is TT.


delete 2. The method according to claim 1, wherein the 27th base of SEQ ID NO: 1 is TT, the 27th base of SEQ ID NO: 2 is AA, or the 27th base of SEQ ID NO: 1 is TT and SEQ ID NO: Of the 27 bases of the genotype is GA or AA, the risk of colon cancer is high.
The method according to claim 1, wherein the 27th base of SEQ ID NO: 1 is TT and the 27th nucleotide of SEQ ID NO: 3 is CC, thereby predicting the risk of developing colon cancer.
The method according to claim 1, wherein the 27th base of SEQ ID NO: 1 is TT and the 27th base of SEQ ID NO: 4 is GG, the risk of colon cancer is high.
The method according to claim 1, wherein the 27th base of SEQ ID NO: 1 is TT and the 27th nucleotide of SEQ ID NO: 5 is GG, the risk of colon cancer is high.
A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 (NCBI refSNP ID: rs3865188) in the T-cadherin gene, or a complementary polynucleotide thereof; And
A polynucleotide consisting of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, a polynucleotide consisting of 10 or more contiguous bases represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) (NCBI refSNP ID: rs3774261) in the adiponectin gene, a polynucleotide consisting of 10 or more consecutive bases comprising the 27th nucleotide of the nucleotide sequence of SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 5 (NCBI refSNP ID: rs6773957) in the adiponectin gene, and a complementary polynucleotide thereof Comprising one or more polynucleotides selected from the group consisting &lt; RTI ID = 0.0 &gt; of:
Compositions for predicting the risk of developing colon cancer.


delete (NCBI refSNP ID: rs3865188) in the T-cadherin gene, or a polynucleotide that specifically hybridizes with a polynucleotide consisting of at least 10 consecutive bases or a complementary polynucleotide thereof, including the 27th base of the sequence represented by SEQ ID NO: 1 Nucleotides; And
A polynucleotide that specifically hybridizes with a polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof consisting of the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, a polynucleotide that specifically binds adiponectin A polynucleotide that specifically hybridizes with a polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof comprising the 27th base of the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) in the gene, an adiponectin gene A polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) or a complementary polynucleotide thereof, and an adiponectin gene SEQ ID NO: 5 (NCBI r and a polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27 &lt; th &gt; base of the sequence represented by SEQ ID NO: rs6773957) or a complementary polynucleotide thereof, / RTI &gt;
Compositions for predicting the risk of developing colon cancer.
11. The composition of claim 10, wherein the specifically hybridizing polynucleotide is a probe or a primer.


delete (NCBI refSNP ID: rs3865188) in the T-cadherin gene, or a polynucleotide that specifically hybridizes with a polynucleotide consisting of at least 10 consecutive bases or a complementary polynucleotide thereof, including the 27th base of the sequence represented by SEQ ID NO: 1 Nucleotides; And
A polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases or a complementary polynucleotide thereof consisting of the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, a polynucleotide that specifically binds adiponectin A polynucleotide that specifically hybridizes with a polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof comprising the 27th base of the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) in the gene, an adiponectin gene A polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) or a complementary polynucleotide thereof, and an adiponectin gene SEQ ID NO: 5 (NCBI r and a polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27 &lt; th &gt; base of the sequence represented by SEQ ID NO: rs6773957) or a complementary polynucleotide thereof, / RTI &gt;
Microarray for risk prediction of colorectal cancer.
(NCBI refSNP ID: rs3865188) in the T-cadherin gene, or a polynucleotide that specifically hybridizes with a polynucleotide consisting of at least 10 consecutive bases or a complementary polynucleotide thereof, including the 27th base of the sequence represented by SEQ ID NO: 1 Nucleotides; And
A polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases or a complementary polynucleotide thereof consisting of the 27th base of the sequence represented by SEQ ID NO: 2 (NCBI refSNP ID: rs2241767) in the adiponectin gene, a polynucleotide that specifically binds adiponectin A polynucleotide that specifically hybridizes with a polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof comprising the 27th base of the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs3821799) in the gene, an adiponectin gene A polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs3774261) or a complementary polynucleotide thereof, and an adiponectin gene SEQ ID NO: 5 (NCBI r and a polynucleotide that specifically hybridizes with a polynucleotide consisting of 10 or more consecutive bases comprising the 27 &lt; th &gt; base of the sequence represented by SEQ ID NO: rs6773957) or a complementary polynucleotide thereof, / RTI &gt;
A kit for predicting risk of developing colon cancer.

Images