KR20160054872A - A composition for skin external application containing extracts of Bamboo Sheath for improving skin dryness - Google Patents

Abstract

The present invention relates to a Phyllostachyos Caulis in Taeniam extract which has efficacy on improving dry skin caused by skin aging, and to a skin-moisturizing composition for skin external application containing the same. More specifically, the present invention relates to a composition for skin external application, which exhibits excellent effects of improving dry skin and moisturizing skin, by means of the Phyllostachyos Caulis in Taeniam extract. According to the present invention, the Phyllostachyos Caulis in Taeniam extract promotes activity of hyaluronic acid synthase (HAS), and has capability of retaining moisture by hyaluronic acid and also promoting production of filaggrin which is a precursor of a natural moisturizing factor (NMF).

Description

[0001] The present invention relates to a composition for promoting the activity of hyaluronic acid synthase (HAS) and an external composition for skin moisturization containing the extract,

The present invention relates to a composition for external application for skin moisturizing which contains an extract. More specifically, the present invention relates to a method for producing a hyaluronic acid (HAS), which comprises a kale extract having hyaluronic acid and hyaluronic acid (HAS) activity and having a capability of promoting fila green formation, which is a precursor of NMF (Natural Moisturizing Factor) The present invention relates to a composition for external application for skin moisturizing which shows excellent skin moisturizing effect.

Skin aging is accelerated by weakening the function of protecting the skin from the outside due to changes in the environment or changes in living environment, excessive cooling / heating, various stresses, and skin stress due to environmental pollution. Especially, skin moisture reduction according to external environment and age is a decisive factor for skin aging. The epidermis, which plays an important role in controlling the skin moisture, is composed of the stratum corneum, the granular layer, the superficial layer, and the basal layer, and the outermost stratum corneum constitutes a skin barrier by interstitial lipids between keratinocytes and keratinocytes (J. Invest. Dermatol 80 (Suppl.), 44-49, 1983). The stratum corneum of the epidermis contains about 10 ~ 30% of water, and it inhibits the penetration of foreign substances from the outside as well as the substance which inhibits the in vitro evaporation of the water electrolytes. It is known that the keratinocyte layer has hydrophilic water retention ability, which is a water-soluble natural moisturizing factor (NMF), plays an important role in moisturizing the skin, Invest, Dermatol, 54, 24-31, 1970). Recently, researchers have reported that yaluronic acid synthase (HAS) is present in the basal layer and the superficial layer of the epidermis to maintain moisture retention in the skin by generating hyaluronic acid, which is essential for moisture retention.

Humectants, which have the property of absorbing water as a moisturizing agent, and occlusive moisturizers that prevent moisture evaporation have been widely used in the past to increase the moisture retention in the stratum corneum. Glycerin, propylene glycol, 1,3-butylene glycol, and polyethylene glycol, which are widely used as moisturizing agents for cosmetics, are excellent in moisturizing power but have disadvantages of stickiness or usability that is poor in use, , And essential fatty acid and lipid complexes (J. Invest. Dermatol. (5), 731-740, 1994) are poorly soluble or have limited formulations and therefore are difficult to use widely. Also, natural moisturizing agents such as sodium pyrrolidonate -Na), sodium lactate, etc. have a problem in that most of the natural extracts developed in addition to maintaining the formulation stability are insignificantly effective.

Therefore, there is a continuing need for a moisturizing agent that increases moisture absorption of the skin without a limitation of conventional moisturizing agents. It is well known that Natural Moisturizing Factor (NMF), which is generally a substance having hydrophilic water retention ability, plays an important role in skin moisturization. These natural moisturizing factors are produced from the pillared green through several stages. Therefore, promoting the formation of pilar green promotes the production of NMF, thereby increasing the water absorption capacity of the skin.

 It also increases the moisture content of the epidermis. Hyaluronic acid plays an important role in the hydration process of the skin, and the amount of hyaluronic acid is rapidly decreased with aging, resulting in wrinkles. In addition, hyaluronic acid not only plays an important role in hydration of the stratum corneum, but also influences water retention and water and ion exchange regulation. Recently, it has been reported that it is possible to promote the synthesis of hyaluronic acid by increasing the activity of hyaluronic acid synthetase, and it has become an important task to identify the ingredients that promote the activity of hyaluronic acid synthase.

Meanwhile, the killer extract of the present invention is known to be effective as an antioxidant activity and an acne inhibiting ingredient (Korean Patent Laid-Open Publication No. 2004-39663). However, the effect of promoting the production of pilar green and the activity of promoting activity of hyaluronic acid synthase is not known.

Bamboo grows well in the southern part of Korea, China, Japan, etc. It is a plant belonging to the rice plant. It grows bamboo shoots every year. It grows in height and thickness in 15 ~ 20 days and grows up to more than 100cm per day. Is known as one of the most vigorous growing plants on the planet. It is also called bamboo leopard, bamboo leopard, and bamboo leopard (bamboo leopard). It cuts the stem of bamboo (Phyllostachys bambusoides) belonging to Bambusoideae, The outer layer is peeled off and a slightly flimsy interlayer is scratched and dried like a line. The line is not long in length and is made of spiral, curled, twisted, and spiraled.

It is known that the taste is sweet (药性 論), and the quality is a little cold (醫 医 別 錄). It works by acting on the stomach (胃经), menopause (肺 经) and liver (肝 经) to lower the fever, eliminate the heat from the blood, and stop the vomiting. It is effective. In addition, if the child suffers from coughing due to chest pains and hiccups or fever (fever fever) due to fever (stomach fever), seizures due to hemorrhagic fever such as seborrhea, nosebleeds, (Fetal anxiety) is used. According to the new edition of the Jikgwan new edition, if you can not sleep because of the heat due to the upper limit, kill the bamboo, bamboo, bamboo, Baekbokryeong (竹 茯 茯 笭) According to Dongbokbo (), it is said that it kills the morning sickness, and it is said that it takes the 茹 茹 湯 to put keummun-dong etc. In addition, I kill in the Huangpo hot stone in my living room, and put in the ointment, 清水 香, and 仁, . According to Yon Kwon, it is said that the cold is dry, the skin is rough, coughing (seawater), symptoms of blood in the acupuncture point, stopping the nose, and treating hemorrhoids (hemorrhoids) In addition, the extract contains a large amount of various nutrients such as inorganic water, amino acid, saccharide, etc. necessary for the growth of bamboo, thereby helping to protect aged skin and maintaining clean skin. Also, it can prevent skin stains, pruritus, Liver group) and helps to maintain a clean skin. (Ingredients of Herbal Medicines and Herbs, January, 1991, p774 / Illustrated Guide to Korea, Theology, 1998, p94).

Recently it has been reported that killing kills the free radicals that cause antimicrobial activity and cell senescence, and studies on killing the killing have been made actively. Korean Patent Publication No. 10-0610951 discloses that killing inhibits the growth of acne (P. acnes), which is known to be the cause of acne, and is useful for treating acne.

The present inventors searched for a substance that retains and retains moisture in the keratin layer, and found that the extract is a hyaluronic acid synthase gene responsible for the synthesis of hyaluronic acid, which is a substrate component of a cell that performs a skin moisture- Lt; RTI ID = 0.0 > expression. ≪ / RTI > Furthermore, it has been confirmed that the expression of Fillagrin gene, which is a precursor protein of natural moisturizing factor (NMF) responsible for skin moisturization, is increased, thus completing the present invention

Accordingly, it is an object of the present invention to provide a composition for external application for skin containing as active ingredient (Phyllostachys bambusoides). In another aspect, the present invention provides a method for preventing and treating various symptoms of skin caused by moisture deficiency by containing a large amount of water in the horny layer of the skin and reducing the evaporation of water through promoting the expression of hyaluronic acid synthetase activity and promoting the formation of pill green And to provide a skin external composition for moisturizing.

In order to achieve the above object, the present invention relates to a composition for enhancing the expression of a hyaluronic acid synthase gene, which is responsible for the synthesis of hyaluronic acid to perform a skin moisture-retaining function, and a natural moisturizing factor Natural Moisturizing Factor (NMF), which is a precursor protein of the Fillagrin gene, is contained in the extract to maximize skin moisture retention and maintenance. Hereinafter, the present invention will be described in more detail.

As described above, the composition for external application for skin, which contains a large amount of water in the horny layer of the present invention and has an effect of reducing water evaporation, is excellent in skin safety by containing an extract and exhibiting excellent skin moisturizing effect. Can be used.

Using the previously prepared Comparative Example 1 and Formulation Example 1-4, the skin moisturizing power when applied to a human body was measured. Twenty healthy 30- to 40-year-old women should be washed thoroughly and allowed to stand at constant temperature and humidity (24 ± 1 ℃, 40 ~ 50%) for a certain period of time. Comparative Example 1 and Formulation Example 1-4 were randomly applied to the whole area, and the skin moisture content was measured at 0, 2, 4, 6, 8, and 24 hours. Skin moisture is measured by AramHuvis. Aramo TS < (R) > As a result, as shown in FIG. 2, it was confirmed that Example 4 maximally increased human skin moisture.

The present invention will be described in more detail as follows. (Phyllostachys bambusoides) is finely pulverized under the sun and pulverized with a predetermined amount of the above-mentioned killing solution as purified water or an extract made of anhydrous or hydrolyzed ethanol having a carbon number of 1 to 4, methanol, glycerin, butylene glycol and propylene glycol (1) heating for 4 to 20 hours at a temperature of 10 to 70 캜 in a state where a cooling condenser is installed, and (2) the active ingredient is extracted by immersion for 1 to 15 days at a temperature of 5 to 10 to 30 ° C. After filtration with a filter cloth, the residue is extracted one more time by the same method. This primary extract is dispersed in water and then immersed for 3 days. After filtration with filter paper, the extract layer is combined with activated carbon, concentrated under reduced pressure, and freeze-dried or spray-dried to obtain a dried extract.

The obtained Phyllostachys bambusoides extract is prepared with an external preparation such as an external preparation for skin or lotion, and has excellent skin moisturizing effect when applied to human skin. It also shows that Bambusa arundinacea extract is safe and effective, improves skin dryness and is a skin moisturizer without any side effects.

The content of the extract of Phyllostachys bambusoides contained in the external ointment for skin or the preparation of external preparation is preferably 0.01-20.0 weight by dry weight, preferably 0.0005-10.0 weight. No significant effect could be expected at concentrations below 0.01 wt. And at concentrations above 10 wt.

The composition according to the invention contains cosmetics and dermatologically acceptable mediums and / or bases. It may be in any form suitable for topical application, for example as a solution, a gel or a solid or paste anhydrous product, an emulsion obtained by dispersing an oil phase in water, a suspension, a microemulsion, a microcapsule, a microgranule or an ionic form (liposome) Or in the form of a non-ionic follicular dispersion, or in the form of creams, skins, lotions, powders, ointments, sprays or conical sticks. These compositions may be prepared according to conventional methods in the art. The composition according to the invention may also be used in the form of a foam or in the form of an aerosol composition further containing a compressed propellant.

The composition of the present invention is not particularly limited in its formulation and may be, for example, an external preparation composition having a formulation of a softening agent, a nutritional lotion, a massage cream, a nutritional cream, a pack, a gel or a skin adhesive type external preparation, Make-up bases, and the like. These adjuvants are introduced in amounts commonly used in the cosmetic or dermatological fields.

The external preparation for skin according to the present invention may contain various components generally used in addition to the extract such as a solubilizing agent, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, Water, ionic or non-ionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics Such as, for example, cosmetic or dermatological ingredients, such as, for example, cosmetics, cosmetics or any other ingredient to be used.

Hereinafter, the present invention will be described in more detail with reference to test examples, but the present invention is not limited to these examples.

[Example 1] Preparation of killed extract

250 g of the selected kills were individually weighed and placed in an extractor. 3 L of distilled water was added, and the mixture was immersed for 5 days at room temperature. The mixture was filtered through a 400 mesh filter cloth, filtered through a 0.45 μm filter, concentrated under reduced pressure, 1.3 g.

[Example 2] Preparation of killed extract

250 g of the selected kills were individually weighed and placed in an extractor. 3 L of 95% ethanol was added, and the mixture was extracted by dipping at room temperature for 5 days. The mixture was filtered through a 400 mesh filter cloth, filtered through a 0.45 μm filter, and concentrated under reduced pressure. .

[Example 3] Preparation of killed extract

250 g of the selected kills were individually weighed and placed in an extractor. 3 L of distilled water was added thereto, and the mixture was extracted at 60 ° C. for 7 hours. The mixture was filtered through 400 mesh filter paper, filtered through a 0.45 μm filter, and then concentrated under reduced pressure to obtain 1.8 g of an extract.

[Example 4] Preparation of killing extract

250 g of the selected kills were individually weighed and placed in an extractor. 3 L of 95% ethanol was added thereto, and the mixture was extracted at 60 ° C. for 7 hours. The mixture was filtered through 400 mesh filter paper, filtered through a 0.45 μm filter and concentrated under reduced pressure to obtain 2.3 g of an extract .

[Composition preparation example]

[Production Examples 1 to 4]

An emulsifier type was usually prepared as shown in Table 1 below.

Component content (%) Comparative Example Production Example 1 Production Example 2 Production Example 3 Production Example 4 Purified water 79.97 76.97 76.97 76.97 76.97 glycerin 3.00 3.00 3.00 3.00 3.00 Methylparaben 0.15 0.15 0.15 0.15 0.15 EDTA 2Na 0.20 0.20 0.20 0.20 0.20 Octyldodecanol 2.00 2.00 2.00 2.00 2.00 Beads wax 7.00 7.00 7.00 7.00 7.00 Glyceryl stearate 2.30 2.30 2.30 2.30 2.30 FAGE 40 Stearate 1.60 1.60 1.60 1.60 1.60 Cetyl alcohol 2.50 2.50 2.50 2.50 2.50 antiseptic 0.70 0.70 0.70 0.70 0.70 BH 0.05 0.05 0.05 0.05 0.05 Tocopheryl acetate 0.50 0.50 0.50 0.50 0.50 Spices 0.03 0.03 0.03 0.03 0.03 Example 1 3.00 - - - Example 2 - 3.00 - - Example 3 - - 3.00 - Example 4 - - - 3.00 sum 100.00 100.00 100.00 100.00 100.00

[Manufacturing Examples 5 to 8]

Solubilized formulations were routinely prepared as described in Table 2 below.

[Table 2] Composition of the solubilized formulation Raw material name Comparative Example 2 Production Example 5 Production Example 6 Production Example 7 Production Example 8 Purified water 85.62  83.62  83.62  83.62  83.62 Methylglucose 20 7.00 7.00 7.00 7.00 7.00 glycerin 3.00 3.00 3.00 3.00 3.00 Bufilene Glycoll 3.00 3.00 3.00 3.00 3.00 Diel panthenol 0.50 0.50 0.50 0.50 0.50 Methylparaben 0.15 0.15 0.15 0.15 0.15 EDTA 2Na 0.20 0.20 0.20 0.20 0.20 Piggy 60 Hydrogenated castor oil 0.50 0.50 0.50 0.50 0.50 Spices 0.03 0.03 0.03 0.03 0.03 Example 1 - 3.00 - - - Example 2 - - 3.00 - - Example 3 - - - 3.00 - Example 4 - - - - 3.00 sum 100.00 100.00 100.00 100.00 100.00

  [Effects of the Invention]

The present inventors conducted experiments on the skin moisturizing effect on the killing extract. It was shown by the following experiment that killer extract has hyaluronic acid synthesizing enzyme and promoting pilase green synthesis. In addition, the cosmetic product containing the killed extract of the present invention can be provided as a water-soluble cosmetic product or an oil-based cosmetic product, and has excellent storage stability when formulated.

[Test Example 1] Expression of hyaluronic acid synthase (HAS 1, HAS2 and HAS3) genes

Human fibroblasts Under 37 ℃, 5% CO ₂ purchased from (KCLB, Korea), 10% fetal bovine serum (FBS, Invitrogen) 50 μg / mL straptomycin (Sigma, USA) the Roswell Park Memorial Institute medium (RPMI, Invitrogen added ). The cells were cultured for 24 hours at a concentration of 1 × 10 ⁶ in a 75 ml flask, and the cells under culturing were treated with Examples 1 to 4 for a certain period of time and extracted with total RNA using Trizol reagent (Invitrogen, USA). CDNA was synthesized by a known method, and HAS 1, 2, and 3 genes were amplified and the amount of gene expression was confirmed by electrophoresis. The primer sequences of HAS 1, 2, and 3 for PCR execution are shown in Table 2 below.

Insert the total RNA with 1 μ g in reverse transcription buffer 25 μ L Oligo dT 15 (500 ng / μ L) primer, dNTP (10 mM), RTase inhibitor (40 units / μ L) and the Powerscript Ⅱ RTase reverse transcriptase polymerase , And primers were annealed at 25 ° C for 10 minutes, cDNA was synthesized at 42 ° C for 60 minutes, and RTase was denatured at 95 ° C for 5 minutes. to amplify GAPDH, HAS-2 from cDNA cDNA 2 μ L, 2.5 mM dNTP 2 μ L, 10 pmol primer , respectively 2 μ L, 10X buffer [10 mM Tris - HCl (pH 8.8), (NH 4) 2 SO _4, 20 mM MgCl _2], plus the 5 μ L, 2.5 unit taq polymerase 0.5 μ L of distilled water and the mixture was adjusted to 50 μ L. The PCR products were analyzed by electrophoresis using 1 ~ 1.5% agarose gel. GAPDH (glyceraldehyde 3-phosphate dehydrogenase) was used as an internal standard to correct the quantitative level of gene expression

The killing extract according to the present invention increases the expression of the fillagrin gene, which is a precursor protein of the natural moisturizing factor (NMF) responsible for moisturizing the surface of the skin, It was confirmed that the hyaluronic acid synthase gene responsible for the synthesis of hyaluronic acid is increased.

Primer pair Gene Gene ID Primer sequence β-Actin Forward 5 '- CTG GGA CGA CAT GGA GAA AA - 3' Reverse 5 '- AAG GAA GGC TGG AAG AGT GC-3' HAS-1 Forward 5 'GACTCCTGGGTCAGCTTCCTAAG 3' Reverse 5 'GTAGAACAGACGCAGCACAG 3' HAS-2 Forward 5 'GCTACCAGTTTATCCAAACG 3' Reverse 5 'GTGACTCATCTGTCTCACCG 3' HAS-3 Forward 5 'GAGGACTGGTACCATCAGAA 3' Reverse 5 'GCCAGATTTGTTGATGGTAGC 3'

[Table 4] Hyaluronic acid synthase 1 (HAS-1) expression sample density GAPDH HAS-1 HAS-1 / GAPDH % Control 236469 212372 0.90 100.0 Vitamin C 250 Um 240109 261598 1.09 121.3 Example 1 One% 243844 215261 0.88 98.3 5% 246962 222355 0.90 100.3 10% 236000 208602 0.88 98.4 Example 2 One% 256987 227160 0.88 113.7 5% 258329 259178 1.00 129.1 10% 258891 275524 1.14 138.8 Example 3 One% 243844 229261 0.94 104.7 5% 246962 222355 0.90 100.3 10% 236000 218602 0.93 103.1 Example 4 One% 244384 236361 0.97 107.7 5% 246783 265218 1.07 119.7 10% 247584 287218 1.16 129.2

[Table 5] Expression of hyaluronic acid synthase 2 (HAS-2) sample density GAPDH HAS-2 HAS-2 / GAPDH % Control 236469 156712 0.66 100.0 Vitamin C 250 uM 240109 233961 0.97 147.0 Example 1 One% 266844 270320 1.01 99.4 5% 266962 305850 1.15 112.4 10% 256000 354410 1.38 135.8 Example 2 One% 256987 270000 1.05 103.1 5% 258329 319054 1.24 121.2 10% 258891 370412 1.43 140.4 Example 3 One% 243844 215320 0.88 133.2 5% 246962 305850 1.24 186.9 10% 236000 334410 1.42 213.8 Example 4 One% 233844 251329 1.07 162.2 5% 241826 325587 1.35 203.2 10% 237063 364410 1.54 232.0

[Table 6] Hyaluronic acid synthase 3 (HAS-3) expression sample density GAPDH HAS-3 HAS-3 / GAPDH % Control 236469 119367 0.50 100.0 Vitamin C 250 uM 240109 151830 0.63 125.3 Example 1 One% 266844 233427 0.87 102.3 5% 266962 288965 1.08 126.5 10% 256000 295786 1.16 135.1 Example 2 One% 256987 220271 0.86 100.2 5% 258329 220271 0.85 99.7 10% 258891 220271 0.85 99.5 Example 3 One% 243844 178427 0.73 145.0 5% 246962 215965 0.87 173.2 10% 236000 225786 0.96 189.5 Example 4 One% 241484 191475 0.79 157.1 5% 243692 229164 0.94 186.3 10% 239783 241752 1.01 199.7

The killing extract according to the present invention has an effect of increasing the hyaluronic acid synthase gene expression responsible for the synthesis of hyaluronic acid, which is a substrate component of a cell that performs a skin moisture retaining function, as shown in Tables 4 to 6 . Especially, hyaluronic acid synthase 3 was superior to vitamin C, a positive control.

[Test Example 2] Expression of Fillagrin-producing gene

Human fibroblasts Under 37 ℃, 5% CO ₂ purchased from (KCLB, Korea), 10% fetal bovine serum (FBS, Invitrogen) 50 μg / mL straptomycin (Sigma, USA) the Roswell Park Memorial Institute medium (RPMI, Invitrogen added ). The cells were mixed at a concentration of 1 * ¹⁰ < ⁶ > per well and adapted for 3 hours in a medium not containing FBS. Then, the killed extracts prepared in Examples 1 to 4 were each treated at a concentration of 10 ppm for 2 hours, added with 1 μg / ml of LPS, and further cultured for 8 hours. Total RNA was extracted using Trizol TM (GIBCO BRL, MD, USA).

1 μg of the total RNA was added to 25 μl of the reverse transcription reaction buffer, followed by reaction with a primer of 0.5 μg / μl oligo (dT) 16 and 200 units SuperScript II (SuperScript II reverse transcription polymer) at 42 ° C. for 1 hour, 2.5 μl was added to 50 μl of a PCR reaction buffer containing 1 / 50,000 dilution of AmpliTaq DNA polymerase, 50 mM Tris (pH 8.3), 0.25 mg / ml bovine serum albumin, 3 mM MgCl 2, 0.25 mM dNTPs and SYBR Green I And 10 μM of primer was added thereto, followed by 30 cycles of denaturation at 94 ° C. for 30 seconds, annealing at 53 ° C. for 30 seconds, and extension at 72 ° C. for 1 minute. The primers were prepared by known methods and the respective base sequences are shown in Table 7 below. Quantitative expression levels of genes were corrected using GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as an internal standard.

As shown in Table 7, the killing extract according to the present invention has an excellent effect of increasing the expression of the filagrin-producing gene, a precursor protein of the natural moisturizing factor (NMF) responsible for moisturizing the skin surface

Gene Gene ID Primer sequence β-Actin Forward 5 '- GGA AAG CGA CAT GGA GAA AA - 3' Reverse 5 '- GAA GTG GGC TTG AGG AGT GC-3' Fillagrin Forward 5 'GGG AAG TAG GTC ACT GCA AAG 3' Reverse 5 'GTA GTG CTA CGC TGA ACT TTG 3'

Claims (3)

A skin moisturizing external application composition characterized by containing an extract as an active ingredient The skin moisturizing external application composition according to claim 1, wherein the composition is killed as an active ingredient, and the extract enhances gene expression of hyaluronic acid synthase and expression of filagreen-producing gene The skin moisturizer composition according to claim 1, wherein the skin moisturizer composition is a formulation of a softening agent, a nutritional lotion, a massage cream, a nutritional cream, a pack, a gel, an essence, a lipstick, a makeup base, a foundation, a lotion, an ointment, a gel, A composition for external application for skin moisturizing

Images