KR20150070990A - Pharmaceutical composition comprising Thioredoxin-binding protein as an active ingradient and using thereof - Google Patents

Abstract

The present invention relates to a composition, including thioredoxin-binding protein (TXNIP) as an active ingredient, for enhancing immunity, inhibiting cancer metastasis, and preventing and treating blood diseases. More specifically, in TXNIP-deficient mice, it is confirmed that the frequency of hematopoietic stem cells and myeloproliferative ability decrease, and that the myeloproliferative ability of marrow cells derived from the TXNIP-deficient mice decreases through bone-marrow transplantation. Moreover, in TXNIP knockout mice and TXNIP-deficient cell strains under oxidative stress conditions, it is confirmed that the level of reactive oxygen species increases and apoptosis is induced, and that the myeloproliferative ability of the cell strains derived from the TXNIP knockout mice decreases. In the TXNIP knockout mice under oxidative stress conditions, it is confirmed that cancer metastasis increases and p53 expression decreases. Moreover, direct binding sites between TXNIP and p53 are identified, and it is confirmed that the binding increases under oxidative stress conditions, thereby increasing p53-mediated transcriptional activities and p53-mediated antioxidant activities. Therefore, a gene carrier, a cell or a TXNIP protein, which includes the TXNIP gene of the present invention can be effectively used as a composition for enhancing immunity, inhibiting cancer metastasis, and preventing and treating blood diseases.

Description

Pharmaceutical composition comprising Thioredoxin-binding protein as an active ingradient and using thereof}

The present invention relates to a composition for enhancing immunity, inhibiting cancer metastasis, and preventing and treating blood diseases, including thioredoxin-binding protein (TXNIP) as an active ingredient.

Oxidative stress is caused by excessive accumulation of reactive oxygen species (ROS) in cells or lack of an antioxidant defense system. Oxidative stress induces various pathological diseases such as diabetes, degenerative brain disease and cancer (Hole et al., 2011; Sinha et al., 2013), and it is confirmed that the regulation of free radicals is an important factor in the hematopoietic action. Became. Hematopoietic cells are susceptible to oxidative stress, and malignancy of hematopoietic tissue was observed under chronic oxidative stress conditions (Ghaffari, 2008). In the hematopoietic tissue, the regulation of homeostasis of the redox state is important for the normal hematopoietic process.

Hematopoietic stem cells (HSCs) are the storage of hematopoietic cell lineages that the host produces throughout life. The hematopoietic stem cell pool maintains their quiescence regulation and self-renewal in bone marrow (BM) (Abbas et al., 2010; Rathinam et al., 2011l Scheller et al., 2011l Scheller et al. al., 2008). The hematopoietic stem cells maintain a low intracellular active oxygen level, and appropriate regulation of oxidative stress in hematopoietic stem cells is required to maintain the hematopoietic stem cell pool (Blank et al., 2008; Naka et al., 2008). Several recent studies have identified that hematopoietic stem cells are involved in functional deficiency through induction of free radicals (Ito et al., 2004; Ito et al., 2006; Miyamoto et al., 2007).

Thioredoxin-binding protein (TXNIP) is a 50 kDa protein composed of 397 amino acids and is included in the arrestin family. Txnip ^-/- mice show a high incidence of hepatocellular carcinoma (Jeong et al., 2009; Kwon et al., 2011; Lee et al., 2005; Song et al., 2003), and expression of TXNIP. Decreases various types of tumors, and overexpression of TXNIP inhibits tumor growth by inhibiting cell-cycle progression (Han et al., 2003). In ^{the bone marrow cells of Txnip -/-} mice, the number of natural killer cells (NK cells) decreases, and the hematopoietic stem cell population restored for a long time exhibits an exhausted phenotype, and the frequency also decreases. (Jeong et al., 2009; Lee et al., 2005).

The tumor suppressor protein p53 plays a role in limiting the expansion of abnormal cells through growth arrest or apoptosis in response to genotoxic stress (Olovnikov et al., 2009; Sablina et al., 2005). The p53 pathway is regulated by MDM2 (mouse double minute 2), which functions as a p53 target protein, E3 ubiquitin ligase, for proteosomal degradation (Sasaki et al., 2011). p53 acts on a strong pro-survival pathway by inducing the expression of anti-apoptotic or anti-oxidative genes (Bensaad and Vousden, 2007; Janicke et al., 2008). Previous studies have revealed anti-aging effects of TXNIP in maintaining the hematopoietic cell pool (Jeong et al., 2009; Kim et al., 2007).

Accordingly, the present inventors were studying a pharmaceutical composition that showed the effect of enhancing immunity in hematopoietic cells by inhibiting antioxidant stress, while in TXNIP-deficient mice, the frequency of hematopoietic stem cells decreased, myeloproliferative ability decreased, and TXNIP through bone marrow transplantation. It was confirmed that the proliferative capacity of the deficient mouse-derived bone marrow cells decreased. In addition, it was confirmed that the level of free radicals increased in TXNIP knockout mice and TXNIP deficient cell lines under oxidative stress conditions, induced apoptosis, and decreased myeloproliferative ability of the TXNIP knockout mouse-derived cell lines. In addition, it was confirmed that cancer metastasis was increased in TXNIP knockout mice under oxidative stress conditions, and the expression of p53 was decreased. In addition, by confirming the direct binding site between TXNIP and p53, the binding increases under oxidative stress conditions, thereby increasing p53-mediated transcriptional activity, and also increasing p53-mediated antioxidant activity. The present invention has been completed.

An object of the present invention is to provide a composition for enhancing immunity, inhibiting cancer metastasis, and preventing and treating blood diseases, including thioredoxin-binding protein (TXNIP) as an active ingredient.

In order to achieve the above object, the present invention provides a pharmaceutical composition for enhancing immunity containing a gene delivery system including a TXNIP (Thioredixin-interacting protein) gene, a cell, or a TXNIP protein as an active ingredient.

In addition, the present invention provides a health food for enhancing immunity containing a gene delivery system including the TXNIP gene, cells, or TXNIP protein as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for inhibiting cancer metastasis containing a gene delivery system including the TXNIP gene, cells or TXNIP protein as an active ingredient.

In addition, the present invention provides a health food for inhibiting cancer metastasis containing a gene delivery system including the XNIP gene, cells or TXNIP protein as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing and treating blood diseases containing a gene delivery system including the TXNIP gene, cells, or TXNIP protein as an active ingredient.

In addition, the present invention provides a health food for preventing and improving blood diseases containing a gene delivery system including the TXNIP gene, cells or TXNIP protein as an active ingredient.

TXNIP of the present invention regulates the myeloproliferative ability of hematopoietic stem cells (HSC) under oxidative stress conditions, exhibits antioxidant activity in vivo, and regulates free radicals by binding with p53 in hematopoietic cells. By doing so, it can be usefully used as a composition for enhancing immunity, inhibiting cancer metastasis, and preventing and treating blood diseases.

1A is a diagram showing a decrease in frequency of hematopoietic stem cells (HSC) in old TXNIP knock-out mice.
Young: a young mouse, and
Old: Old mouse.
1B is a diagram showing an experimental method of a competitive repopulation assay and a serial bone marrow transplantation assay (serial BMT assay).
Figure 1C is a diagram showing a decrease in myeloproliferative ability in TXNIP knockout mice.
WT-Y: wild-type young mouse,
WT-O: wild type old mouse,
KO-Y: TXNIP knocked out young mice, and
KO-O: TXNIP knockout old mouse.
1D is a diagram showing the decrease in the regeneration capacity of all bone marrow cells received from TXNIP knockout mice.
WT: wild type,
KO: TXNIP knockout,
Young: a young mouse, and
Old: Old mouse.
1E is a diagram showing that the proliferative capacity of donor-derived bone marrow cells decreases in the recipients derived from TXNIP knockout mice.
WT: wild type,
KO: TXNIP knockout,
1st: after the first bone marrow transplant, and
2nd: After the second bone marrow transplant.
1F is a diagram showing that the population of hematopoietic stem cells and progenitor cells decreases in TXNIP knockout mice after bone marrow transplantation.
WT: wild type, and
KO: TXNIP knockout.
Figure 2A is a diagram showing a marked increase in the level of free radicals in bone marrow cells derived from TXNIP knockout mice.
WT-Y: wild-type young mouse,
WT-O: wild type old mouse,
KO-Y: TXNIP knocked out young mice, and
KO-O: TXNIP knockout old mouse.
2B is a diagram showing a high level of reactive oxygen species in mice transplanted with bone marrow cells derived from TXNIP knockout mice.
WT: wild type, and
KO: TXNIP knockout.
2C is a diagram showing a high level of reactive oxygen species in bone marrow cells derived from TXNIP knockout mice under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
2D is a diagram showing an increase in apoptosis of bone marrow cells derived from TXNIP knockout mice under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
3A is a diagram showing an experimental method of competitive myeloproliferation, colony forming unit-spleen (CFU-S) and radioprotection assay.
3B and 3C are diagrams showing that bone marrow proliferation and hematopoietic stem cell frequency of TXNIP knockout mouse-derived bone marrow cells are reduced under oxidative stress conditions.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
3D is a diagram showing that the number of colony-forming units-spleen of bone marrow cells derived from TXNIP knockout mice decreases under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: You treated paraquat.
3E is a diagram showing that the survival rate of bone marrow cells derived from TXNIP knockout mice is low under oxidative stress conditions.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
3F and 3G are diagrams showing that the TXNIP knockout mouse-derived LKS cell line decreases myeloproliferation and hematopoietic stem cell frequency in the recipient under oxidative stress conditions.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
Figure 4A is a diagram showing that the survival rate of TXNIP knockout mice decreases under oxidative stress conditions.
WT-PA: wild-type mice treated with paraquat,
KO-PA: TXNIP knockout mice treated with paraquat, and
KO-PA+NAC: TXNIP knockout mice treated with paraquat and antioxidants.
Figure 4B is a diagram showing that the survival rate of the bone marrow transplanted mice derived from TXNIP knockout mice decreased under oxidative stress conditions.
CD45.1 (WT): wild type CD45.1 mice that received wild type bone marrow, and
CD45.1 (KO): wild-type CD45.1 mice that received TXNIP knockout bone marrow.
Figure 4C is a diagram showing the decrease in spleen size and cytoplasm of TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: You treated paraquat.
4D is a diagram showing an increase in apoptosis in TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: You treated paraquat.
Figure 4E is a diagram showing the occurrence of damage to the thymus of TXNIP knockout mice under oxidative stress conditions.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
4F is a diagram showing an increase in cancer metastasis in TXNIP knockout mice under oxidative stress conditions.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
4G is a diagram showing an increase in lung metastasis in mice receiving total bone marrow cells derived from TXNIP knockout mice.
WT-PBS: wild type control mice,
WT-PA: wild-type mice treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: group treated with paraquat in TXNIP knockout mice.
5A and 5B are diagrams showing that the levels of free radicals and TXNIP are in inverse correlation in bone marrow cells.
5C is a diagram showing a decrease in the expression of p53 in TXNIP knockout bone marrow cells.
WT: wild type, and
KO: TXNIP knockout.
5D is a diagram showing an increase in the level of free radicals in TXNIP knockout bone marrow cells.
WT: wild type, and
KO: TXNIP knockout.
5E is a diagram showing that the level of reactive oxygen species is high in p53 ^{-/- hematopoietic stem cells and progenitor cells.}
WT: wild type,
Txnip ^-/- : TXNIP deficiency,
p53 ^-/- : p53 deficiency.
5F and 5G are diagrams showing an increase in the level of reactive oxygen ^{species in TXNIP -/- hematopoietic stem cells and progenitor cells when p53 is inhibited.}
Control: control,
Txnip shRNA: wild-type or TXNIP knockout LKS cells treated with shRNA for Txnip,
p53 shRNA: wild-type or TXNIP knockout LKS cells treated with shRNA against p53,
WT: wild type mouse,
WT/PFT-α: group treated with p53 inhibitor in wild type,
KO: TXNIP knockout mouse, and
KO/PFT-α: group treated with p53 inhibitor in TXNIP knockout mice.
5H is a diagram showing the increase in the level of reactive oxygen species in hematopoietic stem cells and immune cells of ^{p53 -/-} mice under oxidative stress conditions.
WT: wild type, and
p53 ^-/- : p53 deficiency.
5I is a diagram showing that the survival rate ^{of p53 -/-} mice decreases under oxidative stress conditions.
WT: wild type, and
p53 ^-/- : p53 deficiency.
5J is a diagram showing that the survival rate of the mouse is decreased when the TXNIP knockout mouse is treated with a p53 inhibitor under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse, and
KO/PFT-α: group treated with p53 inhibitor in TXNIP knockout mice.
6A is a diagram illustrating the location of TXNIP binding to p53.
6B is a diagram illustrating a domain of p53 that binds to TXNIP.
6C is a diagram showing an increase in the binding between TXNIP and p53 under oxidative stress conditions.
6D is a diagram showing that the C247S and C267S mutations of TXNIP do not exist at the same position because they cannot bind to p53.
6E is a diagram showing that the binding between p53 and MDM2 is decreased by TXNIP.
Vector: control,
TXNIP (WT): wild type TXNIP, and
TXNIP (DW): Double mutation of TXNIP.
6F is a diagram showing that p53-mediated transcriptional activity in cells is increased by binding between TXNIP and p53.
7A and 7B are diagrams confirming the expression of p53 and its target protein in hematopoietic cells.
7C is a diagram showing the decrease in the expression of the p53 target protein in the TXNIP-deficient cell line.
WT: wild type, and
KO: TXNIP knockout.
7D is a diagram showing an increase in the expression of an oxidation-promoting gene mRNA in a TXNIP-deficient cell line.
WT: wild type, and
KO: TXNIP knockout.
7E is a diagram showing changes in the activity of p53 in TXNIP-deficient cell lines under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
7F is a diagram showing the recovery of the frequency of hematopoietic stem cells in mice transplanted with bone marrow cells transfected with wild-type TXNIP or p53.
WT (Fresh): wild type bone marrow cells,
WT (Vector): a group in which only a vector was transfected into wild-type bone marrow cells,
KO(Fresh): TXNIP-deficient bone marrow cells,
KO(Vector): a group transfected with only a vector into TXNIP-deficient bone marrow cells,
KO(p53): group transfected with p53 into TXNIP-deficient bone marrow cells,
KO (TXNIP): group transfected with wild-type TXNIP into TXNIP-deficient bone marrow cells, and
KO(DM): group in which TXNIP-deficient bone marrow cells were transfected with double mutant TXNIP.
7G is a diagram showing an increase in the survival rate of mice transplanted with bone marrow cells transfected with wild-type TXNIP or p53.
WT/Vector: a group transfected with only a vector into wild-type bone marrow cells,
KO/Vector: group transfected with only the vector into TXNIP-deficient bone marrow cells,
KO/Txnip(WT): group transfected with wild-type TXNIP into TXNIP-deficient bone marrow cells,
KO/Txnip(DM): group transfected with double mutant TXNIP into TXNIP-deficient bone marrow cells, and
KO/p53: group transfected with p53 into TXNIP-deficient bone marrow cells.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for enhancing immunity containing a gene delivery system including a TXNIP (Thioredixin-interacting protein) gene, a cell, or a TXNIP protein as an active ingredient.

The TXNIP gene preferably has a nucleotide sequence consisting of SEQ ID NOs: 29 and 30, but is not limited thereto.

The gene delivery system is preferably a vector or a recombinant virus, but is not limited thereto, and the vector is preferably a linear DNA, plasmid DNA or a recombinant viral vector, and the recombinant virus is a retrovirus, adenovirus, adeno-associated virus, and herpes It is preferably any one selected from the group consisting of simplex viruses, but is not limited thereto.

The cell is most preferably a hematopoietic stem cell (HSC), but is not limited thereto.

The immunity enhancement is preferably by maintaining homeostasis of the immune system, but is not limited thereto, and it is preferably by maintaining homeostasis of hematopoietic stem cells, but is not limited thereto. In addition, the immunity enhancement is preferably due to antioxidant activity due to an interaction between TXNIP and p53, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors reduced the frequency of hematopoietic stem cells in TXNIP knockout mice (see Fig. 1A), and the myeloproliferative capacity of all myeloid cells decreased (see Fig. 1C), and TXNIP knockout mice It was confirmed that the frequency of total bone marrow cells and hematopoietic stem cells decreased even in mice that received bone marrow transplantation from (see Fig. 1D). In addition, the above results showed the same results even after repeating the bone marrow transplant twice (see Figs. 1E and 1F). In addition, it was confirmed that the level of free radicals increased in the bone marrow cells derived from TXNIP knockout mice (see Figs. 2A to 2C), which induces apoptosis (see Fig. 2D). In addition, the myeloproliferative ability of TXNIP knockout mice is reduced under oxidative stress conditions (see FIGS. 3B and 3C), and the number of colony forming unit-spleen (CFU-S) of the mouse-derived bone marrow cells decreases, and (See Fig. 3D), it was confirmed that these mice showed a low survival rate (see Fig. 3E). In addition, the myeloproliferative ability of the hematopoietic stem cells isolated from TXNIP knockout mice decreases (see FIGS. 3F and 3G), and the survival rate of the TXNIP knockout mice decreases under oxidative stress conditions (see FIG. 4A), and under oxidative stress conditions It was confirmed that the survival rate of recipients transplanted with TXNIP knockout mouse-derived bone marrow cells also decreased (see FIG. 4B). Under oxidative stress conditions, the spleen size and cytoplasm of TXNIP knockout mice decreased (see FIG. 4C), damage to the thymus occurred (see FIG. 4E), and apoptosis was increased in the mouse (FIG. 4D), and cancer metastasis was observed. It was confirmed that it increases (see Figs. 4F and 4G). In addition, it was confirmed that there was an inverse correlation between the level of ROS and TXNIP expression in bone marrow cells and the level of p53 expression and ROS in TXNIP knockout bone marrow cells (see FIGS. 5A to 5D). In addition, p53 ^-/- high levels of free radicals in hematopoietic stem cells (see Fig. 5E), and inhibition of p53 ^{increases the level of free radicals in TXNIP -/-} hematopoietic stem cells (see Figs. 5F and 5G), and oxidative It was confirmed that the level of reactive oxygen species increased in ^{p53 -/-} hematopoietic stem cells even under stress conditions (see FIG. 5H). ^{In addition, it was confirmed that the survival rate of p53 -/-} mice and mice treated with the p53 inhibitor decreased under oxidative stress conditions (see FIGS. 5I and 5J). In addition, the location where TXNIP and p53 interact is confirmed (see FIGS. 6A and 6B), and the interaction of TXNIP and p53 increases under oxidative stress conditions (see FIG. 6C), and the TXNIP site that interacts with p53 It was confirmed that the double mutant TXNIP that caused the mutation was not present at the same position as p53 in the cell (see FIG. 6D). In addition, it was confirmed that the interaction between p53 and MDM2 (mouse double minute 2) decreased by TXNIP (see FIG. 6E), and p53-mediated transcriptional activity increased by the interaction of TXNIP and p53 (see FIG. 5F). ). In addition, the expression of p53 and its target protein was confirmed in hematopoietic cells (see Figs. 7A and 7B), and when TXNIP is deficient, the expression of p53 target protein is reduced (see Fig. 7C), and oxidation is promoted in the TXNIP-deficient cell line. It was confirmed that the expression of the gene is increased (see Fig. 7D). In addition, there is a change in the activity of p53 according to the change in the expression of TXNIP (see Fig. 7E), and when the TXNIP-deficient bone marrow cells or mice are transfected with wild-type p53 or TXNIP, the frequency of hematopoietic stem cells is recovered, and the survival rate of the mouse. It was confirmed that this increase (see Figs. 7F and 7G).

Therefore, the present inventors confirmed that TXNIP exhibits antioxidant activity through interaction with p53 in vivo.

The gene delivery system containing the TXNIP gene of the present invention, a cell, or a composition containing the TXNIP protein may contain one or more active ingredients exhibiting the same or similar functions in addition to the above components.

The composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose , Mannitol, syrup, arabic rubber, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate , Sucrose, dextrose, sorbitol and talc, and the like may be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

That is, the composition of the present invention can be administered in various oral and parenteral dosage forms at the time of actual clinical administration.When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. It can be prepared using. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient, such as starch, calcium in the gene delivery system containing the TXNIP gene, cells or TXNIP protein. It can be prepared by mixing carbonate (Calcium carbonate), sucrose (Sucrose), lactose (Lactose) or gelatin. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, and syrups. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. . Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The composition of the present invention may be administered orally or parenterally according to a desired method, and when administered parenterally, external skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection injection method It is preferable to choose. The dosage range varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and disease severity.

Dosage units may contain, for example, 1, 2, 3 or 4 times or 1/2, 1/3 or 1/4 times the individual dosage. Individual dosages specifically contain the amount of the effective drug administered at one time, which is usually all, 1/2, 1/3 or 1/4 times the daily dosage. The effective dose of the composition of the present invention may be 0.0001 to 10 g/kg, specifically 0.001 to 1 g/kg, and may be administered 1 to 6 times a day. However, since it may increase or decrease according to the route of administration, the severity of the disease, sex, weight, age, etc., the dosage amount does not limit the scope of the present invention in any way.

The composition of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.

The present invention provides a health food for enhancing immunity containing a gene delivery system including the TXNIP gene, cells, or TXNIP protein as an active ingredient.

The health food of the present invention may be used with a gene delivery system including the TXNIP gene, cells, or TXNIP protein as it is or with other foods or food ingredients, and may be appropriately used according to a conventional method.

There is no particular limitation on the kind of the health food. Examples of foods to which the gene delivery system containing the TXNIP gene, cells, or TXNIP protein can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and dairy including ice cream. There are products, various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, and all health foods in the usual sense are included.

The health beverage composition of the present invention may contain various flavoring agents or natural carbohydrates as an additional component, like a conventional beverage. The natural carbohydrates described above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 of the composition of the present invention.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols. , Carbonating agents used in carbonated beverages, and the like may be contained. In addition, it may contain flesh for the manufacture of natural fruit juice, fruit juice beverage and vegetable beverage. These ingredients may be used independently or in combination. Although the ratio of these additives is not very important, it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The present invention provides a pharmaceutical composition for inhibiting cancer metastasis containing a gene delivery system including the TXNIP gene, cells or TXNIP protein as an active ingredient.

The present invention provides a health food for inhibiting cancer metastasis containing a gene delivery system including XNIP gene, cells or TXNIP protein as an active ingredient.

The cancers are breast cancer, liver cancer, gastric cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, esophageal cancer, small intestine cancer, anal muscle cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal It is preferable to be selected from the group consisting of carcinoma, vulvar carcinoma, Hodgkin's disease, prostate cancer, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, and central nervous system tumor, and according to a preferred embodiment of the present invention, lung cancer It is more preferable to be, but is not limited thereto.

The present invention provides a pharmaceutical composition for preventing and treating blood diseases containing a gene delivery system including the TXNIP gene, cells, or TXNIP protein as an active ingredient.

The present invention provides a health food for preventing and improving blood diseases containing a gene delivery system including the TXNIP gene, cells or TXNIP protein as an active ingredient.

The blood disease is preferably any one selected from the group consisting of anemia, polyemia, leukemia, myelodysplasia, myelofibrosis, and thrombocytopenia, but is not limited thereto.

In addition, the expression level of the TXNIP mRNA or protein of the present invention can be used to enhance immunity, inhibit cancer metastasis, and diagnose blood diseases, as well as enhance immunity and cancer metastasis to select candidate drugs that control these expression levels. It can be used for inhibition and screening of candidate drugs for blood diseases.

In addition, the present invention provides an active oxygen inhibitor for hematopoietic stem cells in vitro containing a gene delivery system including a TXNIP (Thioredixin-interacting protein) gene, cells or TXNIP protein as an active ingredient.

In addition, the present invention provides an agent for protecting hematopoietic stem cell damage caused by oxidative stress in vitro containing a gene delivery system including the TXNIP gene, cells, or TXNIP protein as an active ingredient.

In addition, the present invention provides a method for inhibiting reactive oxygen species against hematopoietic stem cells in vitro, comprising the step of processing a gene delivery system including a TXNIP gene, a cell, or a TXNIP protein.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are only illustrative of the present invention, and the present invention is not limited by the following examples and preparation examples.

< Example 1> TXNIP deficiency is hematopoietic stem cells ( hematopoietic stem cell ; HSC )

<1-1> Preparation of experimental animals

TXNIP knockout (KO) mice were prepared according to a known method (Lee et al., 2005), congenic CD45.1 ⁺ C57BL/6 mice and p53 ^-/- mice (B6.129S2-Trp53). ^tm1Tyj /J) was purchased from Jackson Laboratory (USA). All mice were bred in a sterile animal facility where light-darkness was repeated at 12 hour intervals, and young mice from 8 to 12 weeks and mice from 22 to 23 months old were used for the experiment. p53 ^-/- , Txnip ^-/- (KO) and wild type (WT) mice in paraquat 40, 50 or 80 mg/kg, and N-acetyl-cysteine; NAC, Sigma-Aldrich, USA) 100 mg/kg or PFT-α (Sigma, USA) 5 mg/kg was injected intraperitoneally. All experiments were conducted in accordance with the guidelines for the care and use of laboratory animals of the institute for laboratory animal research.

<1-2> TXNIP Frequency of hematopoietic stem cells due to deficiency ( frequency ) Check the reduction effect

To confirm the effect of TXNIP deficiency on hematopoietic activity, hematopoietic stem cells from young (12 weeks) old (22 to 23 months) Txnip ^+/+ (WT) and Txnip ^-/- (KO) mice. The frequency was analyzed.

Specifically, in order to analyze hematopoietic stem cells, the rat femur, tibia, and sciatic bone were separated, and then bone marrow cells were separated from the bone using a mortar, suspended in RPMI1640 medium, and then centrifuged to remove the medium. The cells were suspended in a PBS buffer solution containing FBS, and the supernatant was removed after centrifugation. Then, after resuspending in a PBS buffer solution containing 2% FBS once again, the number of cells was determined and 10 ⁷ cells were dispensed. Lineage ⁺ (Lineage ⁺⁾ with biotin (biotin) attached to stain the cells Mac-1, Gr-1, Ter119, NK1.1, into the CD2 and B220, c-Kit (PE- Cy7), Sca-1 (PE), CD150 (PE-Cy5), CD48 (APC-Cy7), CD34 (FITC), and CD135 (APC) were added together and reacted at 4° C. for 25 minutes, and a PBS buffer solution containing 2% FBS was used. The cells were washed and reacted with BD Horizon V450 to which streptavidin is attached at 4° C. for 25 minutes to stain ^{Lineage + cells.} The stained cells were analyzed using FACSanto II (BD Biosciences).

As a result, as shown in Fig. 1A, it was confirmed that the HSC frequency was remarkably high in the old wild-type mouse, whereas the HSC frequency was relatively decreased in the young knockout mouse (Fig. 1A).

< Example 2> Competitive myeloproliferation ability by TXNIP deficiency (competitive repopulation capacity) reduction effect

<2-1> bone marrow ( bone marrow ; BM ) Preparation of cells

Total bone marrow cells were separated by grinding tissues of mouse femurs, tibias, hipbones and shoulder bones cultured in RPMI-1640 medium (WelGENE, Korea) containing 2% FBS. , Red blood cells (RBC) were _{lysed or not lysed using ACK buffer [0.15 M NH 4} Cl, 1.0 mM KHCO ₃ , 0.1 mM EDTA (pH 7.0)]. In addition, the cells were filtered using a filter. Bone marrow cells were stained by a method well known to those skilled in the art (Jeong et al., 2009) and analyzed using FACSCanto II, and Lineage ^- c-Kit ⁺ Sca ⁺ (LKS) cells were FACSAria cell sorter. Separated into each. The MACS purification method was used to prepare ^Lineage- c-kit ^{+ (LK) cells.}

<2-2> TXNIP Confirmation of the effect of reducing competitive myeloproliferative capacity due to deficiency

Bone marrow transplantation (BMT) was performed to confirm the bone marrow proliferation ability using the cell line prepared by the method of Example <2-1>.

Specifically, young or old wild type or TXNIP knockout mice (CD45.2 ^+), or a whole bone marrow cells obtained from mice (CD45.1 ⁺⁾ thereof similar genotype (whole bone marrow; WBM) 2.0 x 10 6 cells or LSK 5.0 ^{A mixture was prepared by mixing 3} ×10 wells, and the mixture was injected intravenously into a radioactively irradiated (9 Gy) wild-type pseudogenotype (CD45.1 ⁺ ) recipient (recipient). Myeloproliferation of donor-derived cells was observed through PB staining on tail vein and bone marrow cells using antibodies against surface markers. ^{For non-competitive transplantation, 2.5 x 10 6} total bone marrow cells of wild-type or TXNIP knockout mice were irradiated (9 Gy) and injected intravenously into wild-type pseudogenetic (CD45.1 ⁺ ) recipient mice, and 8 Analysis was performed after a week. In addition, for PB staining, blood was collected from the tail vein and treated with ACK solution (0.15 M NH ₄ Cl, 1.0 mM KHCO ₃ , 0.1 mM MEDTA, pH 7.4) to remove red blood cells and CD45.1 (FITC) and CD45.2 (APC) The cells were suspended in a PBS buffer solution containing 2% FBS as an antibody and stained at 4° C. for 20 minutes, and then the cells were washed with a PBS buffer solution containing 2% FBS, and then suspended again and analyzed by flow cytometry. I did.

As a result, as shown in FIG. 1C, the myeloproliferative ability of LKS and all bone marrow cells of the old wild-type mouse showed a slight change, whereas the myeloproliferative ability of LKS and all bone marrow cells of the old TXNIP knockout mouse was significantly reduced. It was confirmed (Fig. 1C). In addition, as shown in Fig. 1D, it was confirmed that the total bone marrow cells of the recipients received from the young or old TXNIP knockout mice significantly decreased compared to the frequency of hematopoietic stem cells and the progenitors awarded from wild-type mice (Fig. 1D ).

<2-3> TXNIP Confirmation of the reduction effect of donor-derived bone marrow cells due to deficiency

In order to confirm the proliferation ability of donor-derived bone marrow cells by repeating the bone marrow transplantation performed in Example <2-2> twice, a serial BMT assay was performed.

Specifically, the bone marrow cells (2.0 x 10 ⁶ ) isolated from the donor (CD45.2) and the bone marrow cells (1.0 x 10 ⁶ ) isolated from the recipient (CD45.1) were well mixed and irradiated with radiation (9 Gy). After administration to the tail vein of the recipient (CD45.1), after 16 weeks, the recipient's bone marrow cells (2.0 x 10 ⁶ ) mixed with the donor and recipient's cells were separated and irradiated again (9 Gy). After administration to the tail vein of a female body (CD45.1), PB and bone marrow cells were analyzed in the recipient after 16 weeks.

As a result, as shown in Figs. 1E and 1F, the proliferation capacity of donor-derived bone marrow cells is significantly reduced in the recipient derived from TXNIP knockout mice (Fig. 1E), and the results of confirming the hematopoietic stem cells or progenitor cells present in the bone marrow. , It was confirmed that the TXNIP knockout mouse-derived recipient significantly decreased (Fig. 1F).

< Example 3> Confirmation of the effect of regulating free radicals in hematopoietic cells of TXNIP under oxidative stress conditions

<3-1> TXNIP Confirmation of increase in the level of free radicals in bone marrow cells derived from knockout mice

After bone marrow transplantation, the level of active oxygen in the cells was measured to determine whether the initial depletion of hematopoietic stem cells was due to the accumulation of active oxygen.

Specifically, flow cytometry was used to measure the amount of active oxygen in cells in cells derived from young or old wild-type or TXNIP mice, and at this time, a ROS-specific fluorescent probe ), DCF (C6827) and DHE (D11347) (Invitrogen, USA) were used. As soon as the cells to be used in the experiment were isolated, a solution prepared so that the final concentration was 5 μM DFC or 2.5 μM DHE, respectively, was added to PBS containing 2% FBS, and reacted in an incubator at 37° C. for 15 minutes. In order to analyze the hematopoietic stem cells before performing the reactive oxygen-specific fluorescence probe reaction, the rat femur, tibia, and ischial were separated, and the bone marrow cells were separated from the bone using a mortar, suspended in RPMI1640 medium, and then centrifuged. Then, the medium was removed, and the cells were suspended in a PBS buffer solution containing 2% FBS, and the supernatant was removed after centrifugation. Once again suspended in a PBS buffer solution containing 2% FBS, the number of cells was determined, and 10 ⁷ cells were dispensed. After staining the hematopoietic stem cells by the above method and adding a solution prepared so that the final concentration is 5 μM DFC or 2.5 μM DHE, respectively, to PBS containing 2% FBS, reacted in an incubator at 37° C. for 15 minutes, and then 2% FBS The cells were washed with PBS containing and cell analysis was performed using a flow cytometer.

As a result, as shown in FIG. 2A, it was confirmed that the bone marrow cells derived from old TXNIP knockout mice significantly increased the level of reactive oxygen species compared to the wild-type control group (FIG. 2A ).

<3-2> Confirmation of increase in reactive oxygen levels in bone marrow cell transplantation mice derived from TXNIP knockout mice

9 months after transplantation of ^{whole bone marrow cells (CD45.2 +} ) into a wild pseudogenotype (CD45.1 ⁺ ) recipient irradiated with radiation to confirm the effect of increased free radicals in maintaining bone marrow cells derived from TXNIP knockout mice. , The level of active oxygen in the cells was measured using the method of Example <2-1>.

As a result, it was confirmed that the level of free radicals was remarkably high in the bone marrow cells derived from TXNIP knockout as shown in FIG. 2B (FIG. 2B ). It is known that TXNIP of the present invention functions as a pro-oxidant that inhibits thioredoxin (Lee et al., 2005; Patwari et al., 2006; Schulze et al., 2002). In addition, it shows that hematopoietic cells are protected from free radicals by other mechanisms.

< Example 4> In hematopoietic cells TXNIP Antioxidant activity by

<4-1> Confirmation of the effect of inducing active oxygen increase by TXNIP deficiency under oxidative stress conditions

In order to confirm the antioxidant function of TXNIP in hematopoietic cells under oxidative stress, the level of free radicals in young mice was measured.

Specifically, after injection of paraquat, a strong oxidative stress inducer, into the abdominal cavity of a young mouse, the level of intracellular free radicals was measured by the method of Example <2-1>.

As a result, it was confirmed that the level of active oxygen was significantly high in the bone marrow cells derived from TXNIP knockout mice as shown in FIG. 2C (FIG. 2C ).

<4-2> Confirmation of the effect of inducing apoptosis by TXNIP deficiency under oxidative stress conditions

It was confirmed that TXNIP deficiency increases free radicals due to oxidative stress and also induces apoptosis accordingly.

Specifically, after injection of paraquat (40 mg/kg), a strong oxidative stress inducer, into the peritoneal cavity of a young mouse, bone marrow cells were isolated from the mouse, and the hematopoietic stem cells were stained and then bound. 5 µl of Annexin V (BD Bioscience) was added to the cells suspended in the solution and reacted for 15 minutes at room temperature (25° C.) blocked from light, and then the binding solution was appropriately added to analyze the cells using a flow cytometer.

As a result, as shown in FIG. 2D, apoptosis was significantly increased in bone marrow cells derived from TXNIP knockout mice (FIG. 2D ), indicating that TXNIP knockout hematopoietic stem cells are more sensitive to reactive oxygen species.

<Example 5> TXNIP regulates the proliferative capacity of bone marrow stem cells under oxidative stress conditions,

<5-1> Confirmation of reduction in myeloproliferative ability of TXNIP knockout mice under oxidative stress conditions

In order to confirm the effect of oxidative stress on the myeloproliferative ability of hematopoietic stem cells, a competitive repopulation assay was performed by the method of Example <2-2>.

As a result, as shown in Figs. 3B and 3C, it was confirmed that the bone marrow cells derived from TXNIP knockout mice under oxidative stress conditions decreased the myeloproliferative capacity and the hematopoietic stem cell frequency (Figs.

<5-2> Confirmation of reduction of colony-type sex units in the spleen of TXNIP knockout mice under oxidative stress conditions

Colony forming unit-spleen (CFU-S) was performed to confirm colony formation in the spleen by TXNIP knockout mouse-derived bone marrow cells under oxidative stress conditions.

^{Specifically, 1 x 10 5} bone marrow cells treated with paraquat to induce oxidative stress in wild-type or TXNIP knockout mice to the wild-type ^{pseudogenotype (CD45.1 +} ) recipient subjected to irradiation (9 Gy) were injected into a vein. Injected. At this time, the control mice were treated with PBS. The spleen was separated from the mouse, fixed in Carnoy's solution [60% ethanol, 30% chloroform, 10% acetic acid (V/V)], and the number of microscopic colonies was counted after 7 days.

As a result, as shown in FIG. 3D, it was confirmed that the number of colony forming units-spleen of bone marrow cells derived from TXNIP knockout mice was significantly reduced under oxidative stress conditions (FIG. 3D ).

<5-3> Oxidative Under stress conditions TXNIP Confirmation of reduction in survival rate of knockout mice

To confirm the survival rate of TXNIP knockout mice under oxidative stress conditions, a radioprotection assay was performed.

Specifically, after bone marrow transplantation was performed by the method of Example <2-2>, the number was adjusted so that the survival rate of wild-type bone marrow cells was 60% or more. Red blood cells (RBC) were isolated from the whole bone marrow cells of the donor, and mice treated with PBS for wild type, mice treated with paraquat for wild type, mice treated with PBS for TXNIP knockout, and paraquat for TXNIP knockout. ^{Each of 1.5 x 10 5} bone marrow cells isolated from mice was injected into the irradiated (9 Gy) pseudogenotype (CD45.1 ^{+) recipient.} The results of the above experiment show the reason why mice that have received a sufficient amount of hematopoietic stem cells from donor bone marrow cells due to the normal blood production process can survive after bone marrow transplantation. In addition, recipient survival was recorded daily and expressed as a Kaplan-Meier survival curve.

As a result, as shown in Fig. 3E, compared with the wild type, the bone marrow cells derived from TXNIP knockout mice under oxidative stress conditions showed a low survival rate (Fig. 3E).

<5-4> Confirmation of reduction in myeloproliferative ability of hematopoietic stem cells isolated from TXNIP knockout mice

In order to directly confirm the myeloproliferative ability of hematopoietic stem cells, LKS cells (CD45.2+) were isolated from mice, and competitive myeloproliferation analysis was performed by the method of Example <2-2>.

As a result, as shown in FIGS. 3F and 3G, it was confirmed that the LKS cell line derived from TXNIP knockout mice under oxidative stress conditions significantly decreased in myeloproliferative capacity and hematopoietic stem cell frequency in the recipient (FIGS. 3F and 3G ).

Therefore, the above results indicate that TXNIP maintains the myeloproliferative ability of hematopoietic stem cells by regulating the level of free radicals under oxidative stress conditions.

< Example 6> in vivo TXNIP The antioxidant effect of

<6-1> Oxidative Under stress conditions TXNIP Confirmation of reduction in survival rate of knockout mice

Based on the role of TXNIP in the maintenance of hematopoietic stem cells, the present inventors confirmed the effect of TXNIP deficiency on the hematopoietic system in terms of protection against oxidative stress in vivo.

Specifically, in order to induce an oxidative stress environment, 40 mg/kg of paraquat was injected into the mouse, and the experiment was performed by the method of Example <5-3>.

As a result, as shown in Fig. 4A, all TXNIP knockout mice died within 160 hours, but wild-type mice did not die within this time, and survived for more than 2 months. In addition, the group treated with the antioxidant N-acetylcysteine (NAC) showed a recovery rate of about 70% despite the TXNIP knockout mouse (Fig. 4A).

<6-2> Confirmation of reduction in survival rate of recipients transplanted with bone marrow derived from TXNIP knockout mice under oxidative stress conditions

In order to exclude the possibility of toxic effects in other tissues and determine the intrinsic response of hematopoietic cells to oxidative stress, bone marrow transplantation was performed by the method of Example <2-2>, and after 8 weeks. , In order to induce an oxidative stress environment, 40 mg/kg of paraquat was injected into the mouse.

As a result, as shown in FIG. 4B, mice that received total bone marrow cells derived from TXNIP knockout mice died within 150 hours, but 70% of the mice that received total bone marrow cells derived from wild-type mice survived (FIG. 4B ).

<6-3> Effect of oxidative stress conditions on the spleen and thymus (thymus) knockout mice confirmed the TXNIP

The spleen was isolated from the mice used in the experiment of Example <6-3>, and the spleens of TXNIP knockout mice and wild-type mice were observed under oxidative stress conditions.

Specifically, paraquat was administered intraperitoneally at 40 mg/kg to 8-week-old wild-type mice and TXNIP knockout mice, and after 96 hours, the spleen and thymus were taken out from the mice and photographed immediately.

As a result, it was confirmed that the spleen size and cytoplasm of TXNIP knockout mice exposed to oxidative stress were significantly reduced as shown in FIG. 4C (FIG. 4C ). In addition, as a result of observing the thymus of the mouse, it was confirmed that significant damage to the thymus occurred in TXNIP knockout mice exposed to oxidative stress as shown in FIG. 4E (FIG. 4E ).

<6-4> Confirmation of increased apoptosis in TXNIP knockout mice under oxidative stress conditions

TUNEL analysis and annexin V staining were performed to confirm the occurrence of apoptosis in the spleen of TXNIP knockout mice under oxidative stress.

Specifically, to 8-week-old wild-type mice and TXNIP knockout mice, paraquat was administered intraperitoneally at 40 mg/kg, and after 96 hours, the spleen and thymus were taken out from the mouse to measure the number of cells in the spleen, and to measure apoptosis. Annexin V was stained and confirmed by flow cytometry, and some were fixed in 10% formalin solution, and TUNEL staining was performed by a method well known to those skilled in the art to confirm H&E staining and apoptosis of the spleen.

As a result, it was confirmed that apoptosis was significantly increased in TXNIP knockout mice exposed to oxidative stress as shown in FIG. 4D (FIG. 4D ).

< Example 7> Oxidative Confirmation of increased lung cancer metastasis under stress conditions

In the host's immune system, metastasis of lung cancer was measured to confirm the effect of oxidative stress.

B16-F10 melanoma cells were suspended in PBS solution in 8-12 week old wild-type mice and TXNIP knockout mice, and 5 x 10 ⁵ cells per mouse were injected into the tail vein, and two days later, two days apart. Paraquat was injected intraperitoneally at 20 mg/kg. After 8 days, the lungs of the mice were isolated and metastasized melanoma was photographed.

As a result, it was confirmed that cancer metastasis was significantly increased in TXNIP mice exposed to oxidative stress as shown in FIG. 4F (FIG. 4F ).

< Example 8> TXNIP Confirmation of increased cancer metastasis due to deficiency of

Lung cancer cells were used to confirm the anti-metastasis response of immune cells through bone marrow cell transplantation.

^{Specifically, 2.5 x 10 6} bone marrow cells (CD45.2) were isolated from wild-type and TXNIP knockout donor mice, and the cells were injected into the tail vein of the recipient mice (CD45.1) irradiated with 9 Gy of radiation, and 8 weeks later, After performing the experiment by the method of <Example 7>, after 13 days, the lungs were separated and photographed.

As a result, as shown in FIG. 4G, it was confirmed that lung metastasis was significantly increased in the mice receiving total bone marrow cells derived from TXNIP knockout mice (FIG. 4G ).

Therefore, it was confirmed that the toxic effect of paraquat in TXNIP knockout mice was confirmed, and that TXNIP knockout mice were unable to maintain a functional immune system under oxidative stress conditions. In addition, the above results indicate that in all hematopoietic cells including immune cells and hematopoietic stem cells, TXNIP acts as an antioxidant protein regulating free radicals.

< Example 9> Confirmation of correlation between TXNIP protein, free radicals and p53 levels in bone marrow cells

<9-1> active oxygen and TXNIP Confirmation of relevance of expression levels

In order to confirm the relationship between the expression levels of ROS and TXNIP in bone marrow cells, the levels of ROS and TXNIP in the cells were confirmed using the method of Example <3-1>.

As a result, as shown in Figs. 5A and 5B, in bone marrow cells, it was confirmed that there is an inverse correlation between free radicals and TXNIP levels (Figs. 5A and 5B).

<9-2> Free radicals in bone marrow cells and TXNIP The relevance of the expression level of

Recently, it has been confirmed that p53, a tumor suppressor protein, has an antioxidant function and is overexpressed in hematopoietic stem cells. Therefore, in order to confirm the relationship between TXNIP and p53 in bone marrow cells, p53 was stained to check its level, and the level of free radicals was measured using the method of Example <3-1>.

Bone marrow cells were isolated from 8-12 weeks old wild-type and TXNIP knockout mice by the method of Example <2-1>, and a hematopoietic stem cell marker (Lin-c-KitSca-1) was attached, and BD Cytofix/Cytoperm The solution was fixed on ice for 30 minutes. Then, the cells were washed with the BD Perm/Wash solution, suspended with the Cytoperm Plus solution, and left for 10 minutes on ice.The cells were once again washed with the BD Perm/Wash solution, and 5 on ice with the BD Cytofix/Cytoperm solution. After fixing for a minute, the cells were washed with a BD Perm/Wash solution. The cells were suspended in a PBS solution containing 2% FBS and reacted at room temperature for 30 minutes by adding the p53 antibody to which FITC was attached, then washed the cells with a PBS solution containing 2% FBS, and resuspended to flow cytometry. Cell analysis was performed with.

As a result, it was confirmed that the expression of p53 was significantly reduced in TXNIP knockout bone marrow cells as shown in FIGS. 5C and 5D (FIG. 5C ), and the level of active oxygen was significantly increased (FIG. 5D ).

Therefore, the above results indicate that the expression of TXNIP, p53, and regulation of free radicals are related.In addition, the difference in the level of p53 in TXNIP knockout bone marrow cells is small, but the level of active oxygen is high when compared to wild-type bone marrow cells. It was confirmed that the difference was indicated. This indicates that active oxygen is not regulated only by p53 in TNXIP knockout bone marrow cells, and it was confirmed that the change in the level of p53 was more sensitive in the absence of TXNIP.

< Example 10> Hematopoietic In regulating active oxygen p53 The function of

<10-1> p53 ^-/- Increased levels of reactive oxygen species in hematopoietic stem cells and progenitors

In order to confirm the function of p53 in regulating free radicals in hematopoietic cells, p53 ^-/- reactive oxygen levels in hematopoietic stem cells and progenitor cells were measured using the method of Example <3-1>.

As a result, as shown in FIG. 5E, it was confirmed that p53 ^-/- hematopoietic stem cells and progenitor cells had a higher level of reactive oxygen species compared to wild-type hematopoietic stem cells and progenitor cells (FIG. 5E ).

<10-2> TXNIP and double knockdown (double of p53 Confirmation of the effect of increasing active oxygen by knock - down)

The level of free radicals was measured by double-knock-down by inhibiting the expression of p53 in the cells in which the expression of TXNIP was suppressed.

Specifically, a Platinum-E retroviral packaging cell line (CellBiolabs, USA) was used to produce a retrovirus capable of expressing shRNA, and a HuSH-29 shRNA (OriGene, USA) was used as shRNA. The virus obtained from the cell line was infected with LKS cells isolated from 8 to 12 week old wild type and TXNIP knockout mice 3 times for 3 days to confirm the expression of the gene by real-time PCR, and the level of free radicals. Confirmed. The sequence of the shRNA used in the experiment is as shown below:

mTXNIP (SEQ ID NO: 1): 5'-GATTCTAAGGTGATGTTCTTAGCACTTTA-3', and

mp53 (SEQ ID NO: 2): 5'-TGGCCATCTACAAGAAGTCACAGCACATG-3'.

In addition, PFT-α (Sigma, USA), a p53 inhibitor, was intraperitoneally injected into mice at 5 mg/kg, and 48 hours later, the level of reactive oxygen species was measured using the method of Example <3-1>.

As a result, it was confirmed that, as shown in FIGS. 5F and 5G, when p53 shRNA was treated or p53-specific inhibitor PFT-α was treated, ^{the level of free radicals in TXNIP -/-} hematopoietic stem cells and progenitor cells was further increased ( 5F and 5G).

<10-3> Oxidative Under stress conditions p53 The antioxidant effect of

In order to confirm the antioxidant effect of p53 under oxidative stress conditions, p53 ^-/- mice were treated with paraquat, and then the level of active oxygen was measured using the method of Example <3-1>.

As a result, it was confirmed that the level of reactive oxygen species in ^{p53 -/-} hematopoietic stem cells and immune cells increased under oxidative stress conditions as shown in FIG. 5H (FIG. 5H ).

<10-4> Oxidative Under stress conditions p53 ^-/- Confirmation of reduction in survival rate of mice

P53 ^-/- mice were injected with 50 mg/kg of paraquat to create an oxidative stress environment, and the survival rate of the mice was confirmed using the method of Example <5-3>.

^{As a result, it was confirmed that the survival rate of p53 -/-} mice significantly decreased in an oxidative stress environment as compared with the wild-type mice as shown in FIG. 5I (FIG. 5I ).

<10-5> Confirmation of reduction in survival rate of mice by p53 inhibitor treatment in TXNIP knockout mice under oxidative stress conditions

The paraquat 40 ㎎ / ㎏ to induce oxidative stress environment wild type mice, Txnip ^{- / -} mice and treated with Txnip PFT-α ^{- / -} was injected into the mice, the survival rate of mice Example <5-3 It was confirmed using the method of >.

As a result, as shown in Fig. 5J, it was confirmed ^{that Txnip -/-} mice treated with PFT-α were most sensitive to oxidative stress (FIG. 5J).

Thus, the above results indicate that TXNIP binds to p53 in order to regulate the level of free radicals in both hematopoietic stem cells and immune cells.

< Example 11> TXNIP And p53 Direct interaction of ( interaction ) Confirm

<11-1> TXNIP Of sequential mutants

In order to confirm the binding site of the TXNIP protein that binds to p53, sequential mutations of TXNIP were constructed.

Specifically, human GST-TXNIP and FLAG-TXNIP constructs were used as templates for site-directed mutagenesis of TXNIP mutants, and for the production of the mutants A QuickChange II site-directed mutagenesis kit (Stratagene, USA) was used according to the manufacturer's instructions. In addition, the primers used for the production of the mutant construct are shown in Table 1 below.

Primer name Sequence (5'→3') Sequence number human TXNIP(C247S)_F CTCAGGGACATCCGCATCATGGCGTGGC 3 human TXNIP(C247S)_R GCCACGCCATGATGCGGATGTCCCTGAG 4 human TXNIP(C267S)_F CTTCTATCCTGGGCTCCAACATCCTTCGAG 5 human TXNIP(C267S)_R CTCGAAGGATGTTGGAGCCCAGGATAGAAG 6 human TXNIP(C333S)_F GAAGCTCCTCCCTCCTATATGGATGTC 7 human TXNIP(C333S)_R GACATCCATATAGGAGGGAGGAGCTTC 8 human TXNIP(C384S)_F GAGGTGGATCCCTCCATCCTCAACAAC 9 human TXNIP(C384S)_R GTTGTTGAGGATGGAGGGATCCACCTC 10

<11-2> p53 Combined with TXNIP Check the bonding site of

GST pull-down was performed to check the bonding site with p53 using the construct prepared by the method of Example <11-1>.

Specifically, after injecting the construct into the cells, 48 hours later, a lysate of the cells was obtained. Dispense the lysate corresponding to 500 μg, each GST-4B bead was added, reacted at 4° C. for 4 hours to precipitate the beads, washed three times with a lysis solution, and then loaded with SDS loading) solution was treated and SDS-PAGE was performed. Thereafter, it was transferred to a PVDF membrane and Western blot was performed by a method well known to those skilled in the art.

As a result, as shown in Fig. 6A, it was confirmed that cysteine residues at positions 247 and 267 of TXNIP play an important role in binding to p53 (Fig. 6A).

<11-3> p53 deletion mutant ( deletion mutant ) production and confirmation of the connection part with TXNIP

This time, two deletion mutants were constructed to identify the site of p53 that binds to TXNIP.

Specifically, in order to produce a deletion mutation of the C-terminal or N-terminal p53 DNA-binding domain (DNA binding-domain; DBD), the p53 fragment was amplified using pfu polymerase mix (Bionia, Korea), and the pCMV-Flag vector Cloning was performed at the site of the corresponding restriction enzyme. At this time, the primers used are shown below. In order to check the binding site with TXNIP, GST pulldown was performed by the method of Example <11-2>.

DBD ( EcoRI / XhoI ) forward (SEQ ID NO: 11): 5'-GCGAATTCTTCTTGCATTCTGGGACA-3',

DBD ( EcoRI / XhoI ) reverse (SEQ ID NO: 12): 5'-GCCTCGAGGCGGAGATTCTCTTCCTC-3',

DBD-N ( EcoRI / XhoI ) forward (SEQ ID NO: 13): 5'-GCGAATTCTTCTTGCATTCTGGGACA-3',

DBD-N ( EcoRI / XhoI ) reverse (SEQ ID NO: 14): 5'-GCCTCGAGCAAATTTCCTTCCACTCG-3',

DBD-C ( EcoRI / XhoI ) forward (SEQ ID NO: 15): 5'-GCGAATTCCGTGTGGAGTATTTGGAT-3',

DBD-C ( EcoRI / XhoI ) reverse (SEQ ID NO: 16): 5'-GCCTCGAGGCGGAGATTCTCTTCCTC-3'.

As a result, as shown in Fig. 6B, it was confirmed that TXNIP interacts with the C-terminal DNA-binding domain site of p53 containing five cysteine residues (Fig. 6B).

<11-4> Oxidative Under stress conditions TXNIP And p53 Increase the binding of

Immunoprecipitation was performed to confirm how the binding of TXNIP and p53 changes under oxidative stress conditions.

Specifically, _{after the cells were treated with H 2} O ₂ , a lysate of cells was obtained. After quantifying the protein of the lysate and dispensing each to be 500 μg, rabbit-TXNIP (rabbit-TXNIP) antibody was added and reacted at 4° C. for 1 hour, and protein G- capable of binding to the primary antibody Agarose beads (protein G-agarose bead, Roche, USA) were added and reacted for an additional 4 hours. After all reactions were completed, the beads were washed three times with a dissolution solution, and SDS-PAGE and Western blot were performed by a method well known in the art.

As a result, as shown in Fig. 6C, when H ₂ O ₂ is treated to create an oxidative stress environment, the binding between TXNIP and thioredoxin (TRX) is dissociated, and the binding between TXNIP and p53 It was confirmed that this significantly increased (Fig. 6C).

<11-5> TXNIP Double mutation and p53 The intracellular location of

Immunostaining was performed to confirm the binding between the C247S and C267S mutations and p53 of TXNIP under oxidative stress conditions.

Specifically, in the Baf3 cell line, which is a murine bone marrow-derived pro-B cell, cultured in RPMI-1640 medium containing 10% FBS and mouse IL-3 ng/ml, wild-type TXNIP or Double mutation (DM) TXNIP was overexpressed and used for immunostaining. The cell line was fixed and permeabilized using Cytofix/Perm solution (BD Biosciences, USA), and then p53 primary antibody (Santa Cruz, USA) was added in PBS containing 2% FBS. After reacting for 1 hour, it was washed 3 times with PBS and reacted with a secondary antibody of Alexa Fluor 488 or 546 (Invitrogen, USA), and the staining result was observed with an LSM510 confocal microscope (Carl Zeiss, Germany). .

As a result, as shown in FIG. 6D, it was confirmed that the C247S and C267S mutations of TXNIP did not bind to p53, and thus did not increase the expression of p53 in cells (FIG. 6D ).

<11-6> TXNIP On by p53 And MDM2 Check the effect of reducing the bond between

It is known that the stability of p53 is regulated by MDM2 through ubiquitination-dependent proteosomal degradation (Sasaki et al., 2011). Thus, to determine how TXNIP affects the binding of p53 and MDM2, immunoprecipitation was performed by the method of Example <11-4>, at this time, anti-MDM2 (Santa Cruz, USA), anti-p53 ( Santa Cruz, USA) and anti-TXNIP (Invitrogen, USA) primary antibodies were used.

As a result, it was confirmed that the binding of p53 and MDM2 was significantly reduced by TXNIP as shown in FIG. 6E (FIG. 6E ).

<11-7> TXNIP And p53 Confirmation of increase in binding-mediated transcriptional activity

A reporter assay was performed to determine how the p53 and TXNIP binding affects the function of p53.

Specifically, the murine bone marrow-derived Pro-B cell line Baf3 cell line cultured in RPMI-1640 medium containing 10% FBS and mouse IL-3 ng/ml was added TXNIP or TXNIP (double mutant) to the p53-Luc reporter and Using pRL-CMV plasmid vector and lipofectamine-plus, transfection was performed according to the manufacturer's instructions. Luciferase activity was observed using the p53-Luc reporter, and the efficiency of transfection by transfection with Renilla luciferase-expression vector (Promega, USA). Was confirmed. Firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, USA).

As a result, as shown in FIG. 6F, p53-mediated transcriptional activity was significantly increased in cells by the binding between TXNIP and p53 (FIG. 6F ).

Therefore, the above results indicate that TXNIP increases p53 stability by interfering with the binding between p53 and MDM2, and induces transcriptional activity of p53.

< Example 12> in vivo TXNIP end p53 The antioxidant effect of the medium

<12-1> In hematopoietic cells p53 And confirmation of the expression of its target protein

In order to confirm the possibility that TXNIP can regulate the antioxidant activity of p53 through the expression of p53-dependent antioxidant genes, expression of p53 and its target genes SESN1, SESN2, GPX-1, p21, etc. in wild-type LKS and LK cell lines. To confirm, immunostaining and Western blot were performed.

Specifically, immunostaining was performed according to the method of Example <11-5>. In addition, in order to perform Western blot, the cell line was washed with PBS, 0.1% Nonidet P-40, 10 mg/ml aprotinin, 10 mg/ml leupeptin, 10 mM sodium fluoride , 2 mg/ml a-1-antitrypsin, 2 mM sodium pyrophosphate, 25 mM β-glycerophosphate, 1 mM sodium orthovanadate (sodium orthovanadate) and 1 mM phenylmethylsulfonyl fluoride (PMSF) added lysis solution [20 mM Hepes (pH 7.9), 10 mM EDTA, 0.1 M KCl, 0.3 M NaCl] 1 x RIPA buffer was added to lyse the cells. The protein extracted from the lysed cells was centrifuged to obtain a supernatant, and the protein concentration of the supernatant was quantified using the BCA method. Then, the same amount of protein was separated using SDS running buffer by PAGE electrophoresis, transferred to a PVDF membrane, and 0.1% tween 20 and 5% skim milk were added. Pre-treatment was performed with the prepared PBS. Then, the primary antibodies against p53, GPX-1, p21 and β-actin were treated and reacted overnight at 4° C., washed with PBS, and then treated with the secondary antibody and reacted at room temperature for 1 hour. The membrane was developed using ECL (Pierce, USA) solution.

As a result, as shown in Figs. 7A and 7B, the expression of p53 and its target genes SESN1, SESN2, GPX-1 and p21 proteins was confirmed (Figs. 7A and 7B).

<12-2> TXNIP In deficient cell lines p53 Confirmation of decreased expression of target gene

Quantitative real-time PCR and RT-PCR were performed to confirm the mRNA expression level of the p53 target gene in wild-type and TXNIP-deficient LKS cell lines.

Specifically, total RNA was isolated from LKS cells using TRIzol and RNeasy Micro kit (Qiagen, USA), and quantitative PCR was performed using SYBR Premix ExTaq (Takara Bio, Japan) and Thermal Cycler Dice Real-Time System TP800 (Takara Bio, USA). Japan). RT-PCR was performed according to the manufacturer's instructions using a Maxime PCR premix kit (Intron biotechnology, Korea), and the primers used at this time are as shown in Table 2 below.

Primer name Sequence (5'→3') Sequence number BAX_F ATGCGTCCACCAAGAAGCTG 17 BAX_R CCCCAGTTGAAGTTGCCATC 18 PUMA_F CTGTATCCTGCAGCCTTTGC 19 PUMA_R ACGGGCGACTCTAAGTGCT 20 CDKN1A_F GGAACATCTCAGGGCCGAA 21 CDKN1A_R TGGGCACTTCAGGGTTTTCT 22 GPX-1_F CCAAGTACATCATTTGGTCT 23 GPX-1_R CATTAGGTGGAAAGGCATCG 24 SESN1_F CCAGGACGAGGAACTTGG 25 SESN1_R CCAGGTAGGAACACTGATGC 26 SESN2_F CTCACAGCTGGTCTGTGTG 27 SESN2_R CCTCCGTGTGGCAATACC 28

As a result, as shown in FIG. 7C, it was confirmed that the expression of the p53 target protein exhibiting an antioxidant effect was decreased in the TXNIP-deficient cell line compared to the wild-type LKS cell line (FIG. 7C).

<12-3> In TXNIP- deficient cell lines, the pro - oxidant gene (pro-oxidant gene ) increase in expression

In the TXNIP-deficient cell line, the expression level of mRNA was confirmed by the method of Example <12-3> in order to confirm the change in the expression of the oxidation-promoting gene that induces apoptosis, and the primers used at this time are shown in Table 2 above. Indicated.

As a result, it was confirmed that the mRNA expression levels of the oxidation promoting genes CDKN1A, BAX, and PUMA were significantly increased in the TXNIP-deficient cell line as shown in FIG. 7D (FIG. 7D ). Therefore, the above results indicate that a marked increase in the level of active oxygen in TXNIP knockout mice may be associated with p53 activity.

<12-4> Confirmation of changes in p53 activity according to changes in TXNIP expression under oxidative stress conditions

Western blot was performed by the method of Example <12-1> to change the expression of TXNIP and the corresponding change in the activity of p53 according to the exposure time to the oxidative stress environment, and at this time, phospho-p53 (S15) (Cell signaling, US ), p53 (Santa Cruz, USA), TXNIP (Invitrogen, USA) and GAPDH (Santa Cruz, USA).

As a result, as shown in FIG. Lineage 7E ^- (lineage ^-) in cell lines, increased expression of TXNIP in oxidative stress environment, view represents a different kinetics (kinetics) of active p53 (Fig. 7E).

<12-5> in vivo TXNIP And p53 Antioxidant activity by the interaction of

In order to directly confirm the antioxidant activity due to the interaction of TXNIP and p53, wild-type TXNIP, double mutant TXNIP, or p53 gene was transfected into bone marrow cells derived from TXNIP knockout mice, and these cells were used in Example <2-2>. Bone marrow transplantation was performed on a pseudogenotype (CD45.1 ^{+) recipient by the method of.} Eight weeks after bone marrow transplantation, 40 mg/kg of paraquat was administered to the recipient, and the frequency of hematopoietic stem cells and the frequency of the hematopoietic stem cells in Example <5-3> were administered to the recipient. The survival rate was measured by the method.

As a result, as shown in Fig. 7F, in the case of a mouse transplanted with wild-type TXNIP or p53-transfected cells, the frequency of hematopoietic stem cells was recovered (Fig. 7F), and, as shown in Fig. 7G, the survival rate of the mouse It was confirmed that this increase (Fig. 7G).

Therefore, the above results indicate that TXNIP has an antioxidant effect through the interaction with p53 in vivo (Fig. 7H).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Pharmaceutical composition comprising Thioredoxin-binding protein as an active ingradient and using thereof <130> 13P-04-47 <160> 30 <170> KopatentIn 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mTXNIP <400> 1 gattctaagg tgatgttctt agcacttta 29 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mp53 <400> 2 tggccatcta caagaagtca cagcacatg 29 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C247S)_F <400> 3 ctcagggaca tccgcatcat ggcgtggc 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C247S)_R <400> 4 gccacgccat gatgcggatg tccctgag 28 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C267S)_F <400> 5 cttctatcct gggctccaac atccttcgag 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C267S)_R <400> 6 ctcgaaggat gttggagccc aggatagaag 30 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C333S)_F <400> 7 gaagctcctc cctcctatat ggatgtc 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C333S)_R <400> 8 gacatccata taggagggag gagcttc 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C384S)_F <400> 9 gaggtggatc cctccatcct caacaac 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> human TXNIP(C384S)_R <400> 10 gttgttgagg atggagggat ccacctc 27 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD(EcoRI/XhoI)forward <400> 11 gcgaattctt cttgcattct gggaca 26 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD(EcoRI/XhoI)reverse <400> 12 gcctcgaggc ggagattctc ttcctc 26 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-N(EcoRI/XhoI)forward <400> 13 gcgaattctt cttgcattct gggaca 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-N(EcoRI/XhoI)reverse <400> 14 gcctcgagca aatttccttc cactcg 26 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-C(EcoRI/XhoI)forward <400> 15 gcgaattccg tgtggagtat ttggat 26 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-C(EcoRI/XhoI)reverse <400> 16 gcctcgaggc ggagattctc ttcctc 26 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BAX_F <400> 17 atgcgtccac caagaagctg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BAX_R <400> 18 ccccagttga agttgccatc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PUMA_F <400> 19 ctgtatcctg cagcctttgc 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PUMA_R <400> 20 acgggcgact ctaagtgct 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CDKN1A_F <400> 21 ggaacatctc agggccgaa 19 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDKN1A_R <400> 22 tgggcacttc agggttttct 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPX-1_F <400> 23 ccaagtacat catttggtct 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPX-1_R <400> 24 cattaggtgg aaaggcatcg 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SESN1_F <400> 25 ccaggacgag gaacttgg 18 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SESN1_R <400> 26 ccaggtagga acactgatgc 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SESN2_F <400> 27 ctcacagctg gtctgtgtg 19 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SESN2_R <400> 28 cctccgtgtg gcaatacc 18 <210> 29 <211> 1176 <212> DNA <213> Homo sapiens <400> 29 atggtgatgt tcaagaagat caagtctttt gaggtggtct ttaacgaccc tgaaaaggtg 60 tacggcagtg gcgagagggt ggctggccgg gtgatagtgg aggtgtgtga agttactcgt 120 gtcaaagccg ttaggatcct ggcttgcgga gtggctaaag tgctttggat gcagggatcc 180 cagcagtgca aacagacttc ggagtacctg cgctatgaag acacgcttct tctggaagac 240 cagccaacag gtgagaatga gatggtgatc atgagacctg gaaacaaata tgagtacaag 300 ttcggctttg agcttcctca ggggcctctg ggaacatcct tcaaaggaaa atatgggtgt 360 gtagactact gggtgaaggc ttttcttgac cgcccgagcc agccaactca agagacaaag 420 aaaaactttg aagtagtgga tctggtggat gtcaataccc ctgatttaat ggcacctgtg 480 tctgctaaaa aagaaaagaa agtttcctgc atgttcattc ctgatgggcg ggtgtctgtc 540 tctgctcgaa ttgacagaaa aggattctgt gaaggtgatg agatttccat ccatgctgac 600 tttgagaata catgttcccg aattgtggtc cccaaagctg ccattgtggc ccgccacact 660 taccttgcca atggccagac caaggtgctg actcagaagt tgtcatcagt cagaggcaat 720 catattatct cagggacatg cgcatcatgg cgtggcaaga gccttcgggt tcagaagatc 780 aggccttcta tcctgggctg caacatcctt cgagttgaat attccttact gatctatgtt 840 agcgttcctg gatccaagaa ggtcatcctt gacctgcccc tggtaattgg cagcagatca 900 ggtctaagca gcagaacatc cagcatggcc agccgaacca gctctgagat gagttgggta 960 gatctgaaca tccctgatac cccagaagct cctccctgct atatggatgt cattcctgaa 1020 gatcaccgat tggagagccc aacaactcct ctgctagatg acatggatgg ctctcaagac 1080 agccctatct ttatgtatgc ccctgagttc aagttcatgc caccaccgac ttatactgag 1140 gtggatccct gcatcctcaa caacaatgtg cagtga 1176 <210> 30 <211> 1194 <212> DNA <213> Mus musculus <400> 30 atggtgatgt tcaagaagat caagtctttt gaggtggtct tcaacgaccc cgagaaggtg 60 tacggcagcg gggagaaggt ggccggacgg gtaatagtgg aagtgtgtga agttacccga 120 gtcaaagccg tcaggatcct ggcttgcggc gtggccaagg tcctgtggat gcaagggtct 180 cagcagtgca aacagacttt ggactacttg cgctatgaag acacacttct cctagaagag 240 cagcctacag caggtgagaa cgagatggtg atcatgaggc ctggaaacaa atatgagtac 300 aagttcggct tcgagcttcc tcaagggccc ctgggaacat cctttaaagg aaaatatggt 360 tgcgtagact actgggtgaa ggcttttctc gatcgcccca gccagccaac tcaagaggca 420 aagaaaaact tcgaagtgat ggatctagtg gatgtcaata cccctgacct aatggcacca 480 gtgtctgcca aaaaggagaa gaaagtttcc tgcatgttca ttcctgatgg acgtgtgtca 540 gtctctgctc gaattgacag aaaaggattc tgtgaaggtg atgacatctc catccatgct 600 gactttgaga acacgtgttc ccgaatcgtg gtccccaaag cggctattgt ggcccgacac 660 acttaccttg ccaatggcca gaccaaagtg ttcactcaga agctgtcctc agtcagaggc 720 aatcacatta tctcagggac ttgcgcatcg tggcgtggca agagcctcag agtgcagaag 780 atcagaccat ccatcctggg ctgcaacatc ctcaaagtcg aatactcctt gctgatctac 840 gtcagtgtcc ctggctccaa gaaagtcatc cttgatctgc ccctagtgat tggcagcagg 900 tctggtctga gcagccggac atccagcatg gccagccgga cgagctctga gatgagctgg 960 atagacctaa acatcccaga taccccagaa gctcctcctt gctatatgga catcattcct 1020 gaagatcaca gactagagag ccccaccacc cctctgctgg acgatgtgga cgactctcaa 1080 gacagcccta tctttatgta cgcccctgag ttccagttca tgcccccacc cacttacact 1140 gaggtggatc cgtgcgtcct taacaacaac aacaacaaca acaacgtgca gtga 1194

Claims (4)

An active oxygen inhibitor for hematopoietic stem cells in vitro containing a gene carrier, cell or TXNIP protein containing the TXNIP (Thioredixin-interacting protein) gene as an active ingredient.
The method of claim 1, wherein the TXNIP Wherein the gene is a nucleotide sequence consisting of SEQ ID NOS: 29 and 30.
A protective agent for damage of hematopoietic stem cell by oxidative stress in vitro containing gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.
A method for inhibiting reactive oxygen species in a test tube for hematopoietic stem cells comprising the step of treating a gene carrier, cell or TXNIP protein comprising the TXNIP gene.

Images