KR20230075172A - Composition for preventing or treating cancer with emodin as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing, improving, or treating cancer containing emodin as an active ingredient, which can prevent, improve, or treat the evolution of malignant cancer by promoting EMT, and suppress the function of an EMT-promoting transcription factor to Cancer can be prevented, ameliorated or treated.

Description

Composition for preventing or treating cancer containing emodin as an active ingredient {Composition for preventing or treating cancer with emodin as an active ingredient}

The present invention relates to a composition for preventing or treating cancer comprising emodin as an active ingredient. TCF4-TWIST1 binding increases the expression of PTHrP, and it is known that the expression of PTHrP greatly increases in cancer cells. Therefore, the emodin of the present invention can be used as a composition for preventing or treating cancer by suppressing the expression of PTHrP.

Cancer cells formed from epithelial cells can be converted into mesenchymal cells through the increase and activation of EMT-promoting transcription factors through TGFβ1 (transforming growth factor beta-1) signals, and these cell morphological changes is called the epithelial-mesenchymal transition (EMT). Cancer cells transformed into mesenchymal cells have a strong metastatic effect, immune cell evasion effect, anticancer drug resistance, and the ability as cancer stem cells to evolve into malignant cancer.

On the other hand, PTHrP (parathyroid hormone-related protein) is a normal gene product that is expressed in various neuroendocrine tissues and the placenta, and is known to regulate intrachondral bone growth and blood calcium concentration in the growth plate. It is known that PTHrP mRNA expression is greatly increased in cancer cells, and that in breast cancer, as PTHrP increases, cancer cachexia and bone metastasis are promoted. In addition, it has been reported that lung cancer tumor-derived PTHrP induces cachexia, and neutralization of PTHrP can block browning of adipose tissue and loss of muscle mass and strength (Serkan Kir et al., Tumour-derived PTH -related protein triggers adipose tissue browning and cancer cachexia, Nature, 2014 Sep 4;513(7516): 100-104).

Lung cancer is classified as the most dangerous cancer with high mortality worldwide because primary lung cancer cells metastasize to various distant organs including bone, liver, and brain. In the bone metastasis process of lung cancer and breast cancer, tumor-driven osteoclastogenic factors such as TGFβ1 and PTHrP are known to promote osteolysis and bone metastasis of cancer cells.

TGFβ1 is known to regulate cellular behavior including cell cycle progression, motility, proliferation, and differentiation, and to play a key role in cancer development. It has been reported that cancer cells exposed to TGFβ1 signals regulate epithelial-mesenchymal transition (EMT)-related gene expression, such as CDH1, CDH2, VIM, SNAI1, and SNAI2.

In addition, it is known that cancer cells exposed to the TGFβ1 signal increase the PTHrP gene, and the PTHrP protein synthesized from the PTHrP gene acts as a hormone to have cancer cell metastasis, proliferation, immune cell evasion, and the like. It has also been reported that SMAD3 transcription factor and TWIST1 transcription factor activated by TGb1 signal increase PTHrP gene expression, thereby inducing cancer malignancy.

On the other hand, TCF4 (transcription factor 4) has a bHLH (basic helix-loop-helix) region with a DNA binding function. The bHLH region promotes gene expression by specifically binding to the E-box region among DNA sequences. acts as a deterrent. The function of TCF4 in cancer growth and metastasis has been partially reported, and it has recently been reported that TCF4 is increased by TGFβ1 signaling to promote epithelial-mesenchymal transition (EMT). In addition, TWIST1 (Twist-related protein 1) is an epithelial-mesenchymal transition (EMT) promoting factor, and is known to induce metastasis in epithelial type cancer.

No. 10-1895418

An object of the present invention is to provide a composition capable of preventing, improving, or treating the evolution of malignant cancer by EMT promotion.

The present invention provides a pharmaceutical composition for preventing or treating cancer caused by increased binding of TCF4-TWIST1, including emodin as an active ingredient.

In the present invention, the cancer caused by increased TCF4-TWIST1 binding may preferably be lung cancer.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer caused by increased expression of an EMT-promoting transcription factor or PTHrP containing emodin as an active ingredient.

In the present invention, the EMT promoting transcription factor may be preferably SNAI2 or CDH2.

In addition, the present invention provides a health functional food composition for preventing or improving cancer caused by increased binding of TCF4-TWIST1 containing emodin as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving cancer caused by increased expression of an EMT-promoting transcription factor or PTHrP containing emodin as an active ingredient.

The present invention provides a composition excellent in preventing, improving or treating the evolution of malignant cancer by EMT promotion. The present invention inhibits the binding of TCF4-TWIST1 to inhibit the function of an EMT-promoting transcription factor, or inhibits the expression of PTHrP, thereby exhibiting effects of preventing, ameliorating, or treating cancer.

1 is a diagram confirming the binding of TCF4-TWIST1 through immunoprecipitation.
Figure 2 is a diagram confirming the binding region of TCF4-TWIST1 through immunoprecipitation.
Figure 3 is a diagram showing the increase in the expression of PTHrP and SNAI2 by TCF4 overexpression.
4 is a diagram showing TCF4 expression according to Ad-GFP and Ad-TCF4 in A549, Calu-1, and NCI-H358 lung cancer cells.
5 is a diagram showing the increase in the expression of PTHrP and SNAI2 according to the increase in TCF4 expression in A549, Calu-1, and NCI-H358 lung cancer cells.
6 and 7 are diagrams showing the mRNA expression levels of PTHrP, TCF4, and SNAI2 according to TCF4 expression inhibition in A549 lung cancer cells and Calu-1 lung cancer cells, respectively.
8 and 9 are diagrams showing the mRNA expression levels of PTHrP, TCF4, and SNAI2 according to the double overexpression of TCF4 and TWIST1 in A549 lung cancer cells and NCI-H358 lung cancer cells, respectively.
10 is a diagram showing the principle of a two-type mammalian hybrid system. Luciferase activity was significantly increased in the full length (FL) of cells expressing GAL4-TWIST1 and VP16-TCF4, and the C-terminal domain of VP16-TCF4 increased luciferase activity together with GAL4-TWIST1 (FL: Full length). , N:N-terminal domain, M:Middle domain, C:C-terminal domain).
11 is a diagram showing the luciferase activity of a library containing 501 kinds of natural product-derived single substances.
12 is a diagram showing the results of cytotoxicity tests of 12 natural product-derived single substances having low luciferase activity.
13 is a diagram showing luciferase activity according to the treatment concentration of emodin.
14 is a diagram showing the results of immunoprecipitation experiments for Myc-tagged TCF4 and Flag-tagged TWIST1.
15 is a diagram showing the results of immunoprecipitation experiments for the Flag-HA tagged TWIST1-NT2 vector and Myc-tagged TCF4.
16 and 17 are diagrams showing the expression levels of CDH2 and PTHrP according to emodin treatment in A549 lung cancer cells and NCI-H358 lung cancer cells, respectively.
18 is a diagram showing the cell viability of lung cancer cells against emodin.
19 is a diagram showing the cell viability of breast cancer cells against emodin.

An object of the present invention is to provide a composition for preventing, improving, or treating cancer caused by increased TCF4-TWIST1 binding, including emodin as an active ingredient. In addition, an object of the present invention is to provide a composition for preventing, improving or treating cancer caused by increased expression of PTHrP containing emodin as an active ingredient.

Emodin is an orange needle-shaped crystal or powder, and refers to a substance having a structure represented by the following [Formula 1].

[Formula 1]

The present invention confirmed that the expression of TCF4 (transcription factor 4) affects the expression level of PTHrP (parathyroid hormone-related protein), and the gene promoting EMT (epithelial-mesenchymal transition) is similarly expressed. It was confirmed that the pattern was visible.

In addition, the present invention confirmed that TCF4 and TWIST1 (Twist-related protein 1) bind in a specific region. In addition, it was confirmed that the expression of PTHrP is further promoted by TCF4-TWIST1 binding, that is, dual overexpression of TCF4 and TWIST1.

Meanwhile, the inventors of the present application have confirmed the possibility of bone metastasis of lung cancer by increasing the expression of EMT-promoting genes according to the binding of TCF4-TWIST1 (PGC1α Loss Promotes Lung Cancer Metastasis through Epithelial-Mesenchymal Transition. Cancers (Basel). 2021 Apr 8;13(8):1772). As EMT is promoted, the ability of cancer cells to metastasize is strengthened, and the ability to evade immune cells and resist anticancer drugs is strengthened. Accordingly, an object of the present invention is to provide a composition having excellent effects in improving, treating, and preventing cancer by inhibiting the binding of TCF4-TWIST1. It is known that when the expression of PTHrP is further promoted by TCF4-TWIST1 binding, the growth of breast cancer, lung cancer, and colorectal cancer is promoted, and the possibility of bone metastasis increases.

In the present invention, emodin has low luciferase activity and low cytotoxicity, so it is selected as a candidate substance that inhibits TCF4-TWIST1 binding, and emodin inhibits luciferase activity by GAL16-TWIST1 and VP16-TCF4 binding. As a result of confirming the effect, it was confirmed that the luciferase activity was suppressed as the treatment concentration of emodin increased. In addition, as a result of confirming by performing immunoprecipitation, it was confirmed that emodin inhibits TCF4-TWIST1 binding. In addition, the present invention confirmed that the expression of EMT promoting genes and PTHrP decreased according to emodin treatment.

In addition, the present invention confirmed that lung cancer cells and breast cancer cells were significantly killed by emodin treatment.

On the other hand, the present invention relates to a health functional food composition for improving or preventing cancer containing emodine as an active ingredient, in addition to containing emodine as an active ingredient, various flavoring agents or natural carbohydrates, etc. may be included as an additional component.

Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. The food composition of the present invention is formulated in the same way as the following pharmaceutical composition and can be used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is

In addition, the food composition includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, in addition to extracts that are active ingredients. , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain natural fruit juice and fruit flesh for preparing fruit juice beverages and vegetable beverages.

The health functional food composition of the present invention may be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills, and the like. In the present invention, 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionalities for the human body according to the Health Functional Food Act No. 6727, and the structure and function of the human body It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions. The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and general test methods approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the relevant standards and standards. Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations. For example, a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent or the like, if necessary. Among capsule-type health functional foods, hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling a mixture mixed with gelatin in a capsule base. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, binder, disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc. Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing the excipients, binders, disintegrants, etc. of the active ingredients of the present invention, and if necessary, flavoring agents, flavoring agents, etc. can

In addition, the present invention relates to a pharmaceutical composition for preventing or treating cancer comprising emodin as an active ingredient, and the pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. Any of the adjuvants known in the art may be used without limitation.

The pharmaceutical composition according to the present invention may be prepared in the form of incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers usable in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods, respectively. .

When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations contain at least one or more excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin in addition to active ingredients. It can be prepared by mixing etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. can Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. Witepsol, TweenW 61, cacao paper, laurin paper, glycerogelatin, etc. may be used as a base for suppositories.

The pharmaceutical composition according to the present invention can be administered to a subject by various routes. All modes of administration are contemplated, eg oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The pharmaceutical composition may be formulated into various oral or parenteral dosage forms.

Formulations for oral administration include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, granules, etc. chlorose, mannitol, sorbitol, cellulose and/or glycine), lubricants such as silica, talc, stearic acid and magnesium or calcium salts thereof and/or polyethylene glycol. In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases starch, agar, alginic acid or a disintegrant or effervescent mixture, such as its sodium salt, and/or absorbents, colorants, flavors, and sweeteners. The formulation may be prepared by conventional mixing, granulating or coating methods.

In addition, a typical formulation for parenteral administration is an injection formulation, and water, Ringer's solution, isotonic physiological saline or suspension may be used as a solvent for the injection formulation. Sterile fixed oils of the above injectable preparations may be used as a solvent or suspension medium, and any bland fixed oil may be used for this purpose, including mono- and di-glycerides.

In addition, the formulation for injection may use a fatty acid such as oleic acid.

Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, the following examples and experimental examples are presented as examples of the present invention, and if it is determined that detailed descriptions of well-known techniques or configurations may unnecessarily obscure the gist of the present invention, detailed descriptions thereof will be omitted. It can be done, and the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of the claims described below and equivalents interpreted therefrom.

<Experimental Example 1> Confirmation of TCF4 and TWIST1 binding

In this experiment, the binding of TCF4-TWIST1 and their binding regions were confirmed using immunoprecipitation. Cells were transiently transfected with Myc-TCF4 and Flag-HA-TWIST1 and incubated for 48 hours. Total cell lysates were obtained using a lysis buffer containing 1% CHAPS, 150 mM NaCl, 50 mM Tris-HCl (pH 7.9) and 0.1 mM EDTA. 1 mg of the cell lysate was incubated for 16 hours at 4° C. in a 15 μl Flag-M2-affinity agarose gel (Sigma-Aldrich, St. Louis, MO, USA). For Western blotting, SDS-PAGE was performed on the eluted protein and total protein after immunoprecipitation, and then the electrophoresed protein was transferred to a PVDF membrane (Millipore, Burlington, MA, USA). The proteins transferred to the PVDF membrane were reacted with primary antibodies (anti-Flag and anti-Myc) for 16 hours at 4°C, respectively, and reacted with secondary antibodies for 1 hour at room temperature. Protein expression was visualized using the ECL Prime kit (GE Healthcare, Milwaukee, USA). Antibody information is listed in Table 1.

Antibodies Source Cat. No anti-TCF4 mouse monoclonal Abnova H00006925-M04 anti-Myc-Tag rabbit monoclonal Cell Signaling Technology 2278 anti-Flag-M2 mouse monoclonal Sigma-Aldrich F3165 anti-β-actin mouse monoclonal Santa Cruz Biotechnology sc-47778

The experimental results are shown in Figures 1 and 2. As shown in FIG. 1, the binding between TWIST1 and TCF4 was confirmed, and as shown in FIG. 2, it was confirmed that the TCF4 protein binds to the bHLH (basic helix-loop-helix) region of the TWIST1 protein.

<Experimental Example 2> Confirmation of an increase in PTHrP expression according to an increase in TCF4 expression

Adenoviral particles expressing TCF4 (Gene Accession Number: BC031056) or GFP (green fluorescent protein) were purchased from Applied Biological Materials (abm). Each lung cancer cell (A549(10185), Calu-1(30054), NCI-H358(25807), NCI-H460(30177), Korean Cell Line Bank (Seoul, South Korea)) was treated with DMEM containing 10% FBS. and Roswell Park Memorial Institute (RPMI) 1640.

2-1. transduction

Lung cancer cells were incubated for 72 hours with GFP expressing TCF4 or adenoviral particles at a concentration of 1×10 ⁴ pfu/ml. TCF4 expression was confirmed using qRT-PCR. To measure the mRNA expression of cultured lung cancer cells, total RNA was isolated using TRIZOL (Invitrogen, Carlsbad, CA, USA) and isopropanol (Sigma-Aldrich, St. Louis, MO, USA). cDNA was synthesized from total RNA using reverse transcriptase and a cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). SYBR Green qPCR mixture (Applied Biosystems, Foster City, CA, USA) was used for qRT-PCR and experimental Ct values were normalized and calculated with the 36B4 gene.

Gene Forward Sequences (5’-3’) Reverse Sequences (5’-3’) CDH2 CCACCTTAAAATCTGCAGGC GTGCATGAAGGACAGCCTCT SNAI1 CCTTTCTAGGCCCTGGCT AGGTTGGAGCGGTCAGC SNAI2 TGACCTGTCTGCAAATGCTC CAGACCCTGGTTGCTTCAA TCF4 CATAGGGAGTCCCATCTCCA GGACCAACTTCTTTGGCAAG PTHrP TTGTCATGGAGGAGCTGATG CGGTGTTCCTGCTGAGCTAC H36B4 TGGTGATACCTAAAGCCTGGAA CATGTTGCTGGCCAATAAGG

As shown in Figure 3, TCF4 overexpression by adenovirus transduction increased the expression of PTHrP in all lung cancer cells (A549, Calu-1, NCI-H358, NCI-H460), and EMT promoting gene SNAI2, known as , also showed a tendency to increase. In addition, TCF4 expression in Ad-GFP or Ad-TCF4 expressed in each lung cancer cell (A549, Calu-1, NCI-H358) is shown in FIG. 4 .

2-2. Transfection

On the other hand, non-specific gene expression may occur in the case of the adenovirus system. To overcome this technical error, a mammalian expression vector such as Myc-tagged TCF4 expression vector is temporarily transfected into cultured lung cancer cells and PTHrP The expression of was confirmed. Myc-tagged TCF4 and partial domain mutants (TCF4-ND, -MD, -CD) were provided from Seoul National University. Flag-HA-TWIST1 and domain mutants (TWIST1-NT1, -NT2) were generated using PCR with a V5 tagged TWIST1 plasmid containing primers with EcoR I and Xhol restriction sites, and then the amplified PCR fragments were pc- It was inserted into DNA Flag-HA vector (Addgene).

Constructs Sequences (5’-3’) Flag-HA-TWIST1-FL [F] CCGCTCGAGATGATGCAGGACGTG [R] CCGGAATTCTTAGTGGGACGCGGACAT Flag-HA-TWIST1-NT1 [F] CCGCTCGAGATGATGCAGGACGTG [R] CCGGAATTCTTACTCCTCGTAAGACTG Flag-HA-TWIST1-NT2 [F] CCGCTCGAGATGATGCAGGACGTG [R] CCGGAATTCTTAGCTCTGGAGGACCTG

0.5 μg/ml of Myc-tagged TCF4 expression vector was transfected into lung cancer cells using Polyfect (Qiagen, Hilden, Germany) at 1 μl/ml. 20 nM SiRNA control and TCF4 (Integrated DNA Technologies, Inc. USA) were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), followed by further incubation for 48 hours for stabilization and protein expression.

5 shows the results of ectopic expression of TCF4. In each lung cancer cell (A549, Calu-1, NCI-H358), it was confirmed that PTHrP increased according to the increase in TCF4 protein expression, and SNAI2 was also increased.

On the other hand, the effect of TCF4 expression knockdown on PTHrP and SNAI2 expression was confirmed. After transiently transfecting lung cancer cells with siRNA for control or TCF4, the transfected cells were treated with 20 ng/ml of TGFβ1 and further cultured for 48 hours. The mRNA levels of PTHrP, TCF4, and SNAI2 were measured by qRT-PCR.

6 and 7 show the mRNA expression levels of PTHrP, TCF4, and SNAI2 in A549 lung cancer cells and Calu-1 lung cancer cells, respectively. The expression of PTHrP and SNAI2, whose expression was increased by TGFβ1 treatment, decreased as TCF4 expression was suppressed.

<Experimental Example 3> Confirmation of PTHrP expression promoting effect by dual overexpression of TCF4 and TWIST1

In this experiment, based on the fact that TCF4 and TWIST1 bind according to Experimental Example 1, the TCF4-TWIST1 binding, that is, the effect of promoting PTHrP expression by double overexpression of TCF4 and TWIST1 was confirmed. Adenovirus-expressing negative controls, GFP or TCF4, were transduced into Flag-tagged empty or TWIST1 ectopic lung cancer cells. The mRNA levels of PTHrP, TCF4, and SNAI2 were measured by qRT-PCR.

8 and 9 show the mRNA expression levels of PTHrP, TCF4, and SNAI2 in A549 lung cancer cells and NCI-H358 lung cancer cells, respectively. Double overexpression of TCF4 and TWIST1 greatly increased the expression of PTHrP. That is, TCF4 maximizes PTHrP expression by promoting the transcriptional activity of TWIST1, and double overexpression of TCF4 and TWIST1 increases the expression of PTHrP up to 8-fold compared to overexpression of TCF4 or TWIST1 alone. In addition, SNAI2, known as an EMT promoting gene, also showed a 6-fold increase in expression.

<Experimental Example 4> Screening of substances inhibiting binding of TCF4 and TWIST1

In this experiment, in order to inhibit TCF4-TWIST1 binding, that is, the effect of promoting PTHrP expression by double overexpression of TCF4 and TWIST1, substances that inhibit TCF4-TWIST1 binding were searched for.

PTHrP is particularly expressed in cancer cells and is known to induce cancer cachexia. PTHrP induces browning of adipose tissue and promotes the expression of thermogenic genes, which is known to cause rapid weight loss and decreased muscle function (Serkan Kir et al., Tumour-derived PTH-related protein triggers adipose tissue browning and cancer cachexia, Nature, 2014 Sep 4;513(7516): 100-104). In addition, PTHrP is known to promote cancer cell growth and bone metastasis in breast, lung and colorectal cancers. Accordingly, the present invention was intended to suppress the expression of PTHrP for suppressing the induction of cancer cachexia, inhibiting the growth of cancer cells, and inhibiting bone metastasis of cancer, and based on Experimental Example 3, a substance inhibiting the binding of TCF4-TWIST1 explored.

To screen substances that inhibit the binding of TCF4 and TWIST1, a Mammalian Two hybrid system based on GAL4-VP16 was constructed (CheckMateTM/Flexi® Vector Mammalian Two-Hybrid System Kit (Promega)) .

The full length (1-671 a.a), N-terminal domain (1-250 a.a), intermediate domain (251-500 a.a) and C-terminal domain (501-671 a.a) of TCF4 were synthesized with Sgf I and Pme I restriction enzymes. It was inserted into the pFN10A vector expressing VP16-tagged TCF4. The full length of TWIST1 was inserted into the pFN11A vector expressing GAL4-tagged TWIST1 with Sgf I and Pme I restriction enzymes, and the pGL4.31 (luc2P/GAL4UAS/Hygro) vector was used to mediate VP16-TCF4 and GAL4-TWIST1 interaction with luciferase. Raise expression was measured (see Figure 10).

Constructs Sequences (5’-3’) pFN10A-TCF4-FL [F] ATAGGCGATCGCCATGCATCACCAACAGCGA [R]AGCTTTGTTTAAACCATCTGTCCCATGTGATTCGATGC pFN10A-TCF4-ND [F] ATAGGCGATCGCCATGCATCACCAACAGCGA [R] AGCTTTGTTTAAACCTGTGGAATATGAGAAGAGTTGCCC pFN10A-TCF4-MD [F] ATAGGCGATCGCCATGTCCAGCAGCTACTGTAGCC [R] AGCTTTGTTTAAACTCCTGGTGGCATGCCTCT pFN10A-TCF4-CD [F] ATAGGCGATCGCCATGCTACAGGGGCAGAGTGT [R] AGCTTTGTTTAAACCATCTGTCCCATGTGATTCGATGC

As shown in FIG. 10, the luciferase activity was significantly increased in the full length (FL) of the cells expressing GAL4-TWIST1 and VP16-TCF4, and the C-terminal domain of VP16-TCF4 had luciferase activity together with GAL4-TWIST1. was confirmed to increase.

Accordingly, in order to perform HTS (High Throughput Screening) using 501 natural product-derived single substances, HEK239T cells were transiently transfected with pGL4.31-Luc, pFN10A-TCF4, and pFN11A-TWIST1, and the cells were incubated for 24 days. It was stabilized by additional incubation time. Then, the cells were divided into 96 well cell culture plates and incubated for 24 hours. Cells expressing pGL4.31-Luc, pFN10A-TCF4, and pFN11A-TWIST1 were treated with 10 μM of the library containing single substances derived from natural products, and incubated for 24 hours. To measure the luciferase activity, the cell lysate was reacted with a luciferase assay buffer and a luciferin substrate, and then the luciferase activity was measured using a Luminometer (BioTek, Winooski, VT, USA).

As shown in FIG. 11, it was confirmed that the luciferase activity was decreased in about 12 natural product-derived single substances.

On the other hand, natural product-derived substances generally exhibit cytotoxicity, and in order to overcome technical errors in which luciferase activity is reduced due to cytotoxicity, cytotoxicity was analyzed for each of 12 types of natural product-derived single substances. HEK239T cells were treated with 10 μM of 12 kinds of natural product-derived single substances and cultured for 48 hours. The cultured cells were washed with PBS, fixed in a 4% paraformaldehyde solution for 10 minutes, and then stained with a 0.5% crystal violet (Sigma aldrich) solution for 10 minutes. After drying the stained cells at room temperature for 24 hours, they were lysed using a solution containing 1% SDS and then analyzed by absorbance.

As shown in FIG. 12, most of the 11 types of natural product-derived single substances except emodin exhibit strong cytotoxicity, whereas emodin has relatively low cytotoxicity.

In addition, as a result of treatment with various concentrations of emodin to confirm the effect of emodin on luciferase activity by GAL16-TWIST1 and VP16-TCF4 binding, as shown in FIG. 13, as the treatment concentration of emodin increases, luciferase It was confirmed that the activity was inhibited.

<Experimental Example 5> Confirmation of TCF4-TWIST1 binding inhibitory effect by emodin

In this experiment, the effect of inhibiting TCF4-TWIST1 binding by emodin was confirmed using immunoprecipitation (see Experimental Example 1). The transiently transfected Myc-tagged TCF4 and Flag-tagged TWIST1 were treated with 20 μM of emodin and further cultured for 24 hours to perform immunoprecipitation.

14 shows the experimental results for Myc-tagged TCF4 and Flag-tagged TWIST1, and FIG. 15 shows the experimental results for the Flag-HA tagged TWIST1-NT2 vector and Myc-tagged TCF4. It was confirmed that TCF4-TWIST1 binding was inhibited when emodin was treated.

<Experimental Example 6> Confirmation of PTHrP expression inhibitory effect of emodin

In this experiment, based on the fact that the binding of TCF4-TWIST1 increases the expression of PTHrP and EMT-promoting genes, the effect of emodin on CDH2 and PTHrP expression was confirmed. CDH2 (Cadherin-2) is known as an EMT promoting gene. Each of A549 and NCI-H356 lung cancer cells were incubated with TGFβ1 (20 ng/ml) for 1 hour, followed by incubation with Emodin (20 μM) for 24 hours, and the mRNA expression levels of CDH2 and PTHrP were measured by qRT-PCR. .

16 and 17 show the expression levels of CDH2 and PTHrP according to emodin treatment in A549 lung cancer cells and NCI-H358 lung cancer cells, respectively. It was confirmed that CDH2 and PTHrP, which were increased by TGFβ1, decreased with emodin treatment.

<Experimental Example 7> Cell viability test of cancer cells for emodin

A549, Calu-1, and NCI-H460 lung cancer cells were treated with DMSO as a negative control (emodin 0 uM) and emodin at different concentrations (2.5-40 uM) and cultured for 48 hours. The cultured cells were washed with PBS, fixed in a 4% paraformaldehyde solution for 10 minutes, and then stained with a 0.5% crystal violet (Sigma aldrich) solution for 10 minutes. The stained cells were dried at room temperature for 24 hours, lysed using a solution containing 1% SDS, and then analyzed by absorbance.

As shown in FIG. 18, three types of lung cancer cells showed low cell viability when treated with emodin.

In addition, as a result of treating MDA-MB231 (estrogen receptor-) and MCF-7 (estrogen receptor+) breast cancer cells with emodin and confirming cell viability according to the above experimental method, as shown in FIG. 19, when emodin is treated, breast cancer Cell viability was found to be low.

Claims (6)

A pharmaceutical composition for preventing or treating cancer caused by increased binding of TCF4-TWIST1, comprising emodine as an active ingredient.
According to claim 1,
A pharmaceutical composition for preventing or treating cancer, characterized in that the cancer caused by increased binding of TCF4-TWIST1 is lung cancer.
A pharmaceutical composition for preventing or treating cancer caused by increased expression of an EMT-promoting transcription factor or PTHrP, comprising emodin as an active ingredient.
According to claim 3,
The EMT-promoting transcription factor is a pharmaceutical composition for preventing or treating cancer, characterized in that SNAI2 or CDH2.
A health functional food composition for preventing or improving cancer caused by increased binding of TCF4-TWIST1 containing emodine as an active ingredient.
A health functional food composition for preventing or improving cancer caused by increased expression of an EMT-promoting transcription factor or PTHrP containing emodin as an active ingredient.

Images