KR101848106B1 - An anti-cancer supplement containing GKN2 - Google Patents

An anti-cancer supplement containing GKN2 Download PDF

Info

Publication number
KR101848106B1
KR101848106B1 KR1020130125819A KR20130125819A KR101848106B1 KR 101848106 B1 KR101848106 B1 KR 101848106B1 KR 1020130125819 A KR1020130125819 A KR 1020130125819A KR 20130125819 A KR20130125819 A KR 20130125819A KR 101848106 B1 KR101848106 B1 KR 101848106B1
Authority
KR
South Korea
Prior art keywords
gkn2
gkn1
protein
expression
gastric
Prior art date
Application number
KR1020130125819A
Other languages
Korean (ko)
Other versions
KR20150046507A (en
Inventor
박원상
윤정환
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Priority to KR1020130125819A priority Critical patent/KR101848106B1/en
Publication of KR20150046507A publication Critical patent/KR20150046507A/en
Application granted granted Critical
Publication of KR101848106B1 publication Critical patent/KR101848106B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 GKN2를 유효성분으로 포함하는 항암 보조제에 관한 것으로, 더 상세하게는 GKN1과의 상호 작용에 의해 위 점막의 항상성을 유지시킴으로써 GKN1의 항암제로서의 부작용을 감소 또는 완화시킬 수 있는 GKN2의 신규한 용도에 관한 것이다.
본 발명에 따른 GKN2는 GKN1의 과발현에 의해 유도될 수 있는 위 점막 정상 조직의 과도한 세포사멸을 억제하여 GKN1을 유효성분으로 함유하는 위암 치료용 조성물의 부작용을 효과적으로 억제할 수 있고, GKN1과의 음성 피드백에 의한 길항 작용으로 상호 적정 수준의 발현 내지 기능을 유지할 수 있으므로 위 점막 조직의 항상성 유지를 위한 약제학적 조성물로 유용하게 사용할 수 있을 것이다.
The present invention relates to an anti-cancer adjuvant comprising GKN2 as an active ingredient, and more particularly, to a novel anti-cancer agent of GKN2 capable of reducing or alleviating side effects of GKN1 as an anticancer drug by maintaining homeostasis of gastric mucosa by interaction with GKN1 Lt; / RTI >
GKN2 according to the present invention can inhibit excessive cell death of gastric mucosal normal tissue that can be induced by overexpression of GKN1, effectively inhibiting side effects of a composition for treating gastric cancer containing GKN1 as an active ingredient, Can be used as a pharmaceutical composition for maintaining homeostasis of gastric mucosal tissues because it can maintain an appropriate level of expression or function by antagonism by feedback.

Description

GKN2를 유효성분으로 포함하는 항암 보조제{An anti-cancer supplement containing GKN2}An anticancer agent containing GKN2, which contains GKN2 as an active ingredient,

본 발명은 GKN2를 유효성분으로 포함하는 항암 보조제에 관한 것으로, 더 상세하게는 GKN1과의 상호 작용에 의해 위 점막의 항상성을 유지시킴으로써 GKN1의 항암제로서의 부작용을 감소 또는 완화시킬 수 있는 GKN2의 신규한 용도에 관한 것이다.The present invention relates to an anti-cancer adjuvant comprising GKN2 as an active ingredient, and more particularly, to a novel anti-cancer agent of GKN2 capable of reducing or alleviating side effects of GKN1 as an anticancer drug by maintaining homeostasis of gastric mucosa by interaction with GKN1 Lt; / RTI >

위 상피 조직은 동적 평형을 통해 항상성을 유지한다. 즉, 정상적인 위 점막 세포는 지속적인 세포 증식, 분화, 자기 재생의 과정이 세포 사멸과 상호 균형을 이루어 항상성을 유지한다. 이와 같이 지속적인 세포 증식과 세포사멸 간의 적절한 균형의 유지는 신호 경로 복합체와 전사 조절인자에 의해 조절되는데, 이러한 조절이 적절히 일어나지 않아 항상성의 균형이 깨지면 위염과 위암과 같은 다양한 질병을 초래할 수 있다. 그러나, 이에 대한 정확한 분자 기전에 대해서는 거의 연구된 바가 없는 실정이다.Stomach epithelial tissue maintains homeostasis through dynamic equilibrium. In other words, normal gastric mucosal cells maintain a constant state of cell proliferation, differentiation, and self-renewal process by mutual balancing with cell death. Thus, proper balance between sustained cell proliferation and apoptosis is regulated by signaling pathway complexes and transcription factors. If the homeostatic balance is not properly controlled, various diseases such as gastritis and gastric cancer may result. However, there has been little research on the precise molecular mechanism for this.

위 특이적으로 발현되는 단백질인 Gastrokin 1(이하 'GKN1'이라 한다)은 18 kDa 크기의 단백질로, 위 전정부(gastric antrum)에서 주로 발현하고 있으며, 위 점막의 분화 및 세포사 조절에 중요한 역할을 한다. 또한, GKN1은 위 표면 세포의 점액 분비 과립에서 발견되고 상피 세포 분열에 관여하는 것으로 알려져 있다. 위 점막 이 외에도 GKN1은 장 점막에서 점막층을 보호하고 상해에 대한 회복과 증식을 촉진하며, 연접 주변부를 안정화시키고 특정 밀착 연접(tight junction) 단백질에 작용하여 장 점막 장벽을 보호하는 역할을 한다. Gastrokin 1 (GKN1) is a 18 kDa protein that is mainly expressed in the gastric antrum and plays an important role in gastric mucosal differentiation and cell death control. do. In addition, GKN1 is found in the mucus secretory granules of gastric surface cells and is known to be involved in epithelial cell division. In addition to the gastric mucosa, GKN1 protects the mucosal layer in the intestinal mucosa, promotes recovery and proliferation of injuries, stabilizes the periphery of the junction, and acts on specific tight junction proteins to protect the intestinal barrier.

일부 연구에서는 헬리코박터 파이로리균에 감염된 위 점막 상피 세포와 그 밖의 대부분의 위암에서 GKN1이 하향 조절되고 있다고 보고하고 있다. 또한, 본 발명자들은 이전 연구를 통하여 GKN1이 위암 발생에 있어 종양 억제 활성이 있음을 확인한 바 있다(대한민국등록특허 제10-1215069호). 이와 더불어 최근에는 GKN1이 위암 세포에서 p16/Rb 경로의 활성화를 통하여 노화를 유도하고, GKN1의 과발현이 Fas가 매개하는 세포사멸을 유도하며, GKN1의 부재는 세포사멸 없이 위 상피 세포를 계속적으로 증식시키는 것으로 알려졌다. 따라서, 정상 위 점막 조직에서 GKN1의 과발현은 정상 위 점막세포에서 세포사를 유도하여 위축성 위염과 같은 질병을 야기할 수 있다. 이러한 점에서 볼 때 위 점막의 항상성 유지를 위한 분자적 기전에 대한 연구가 필요하며, 특히 GKN1의 저해제에 대한 동정이 요청되고 있다. Some studies report that GKN1 is downregulated in gastric epithelial cells infected with Helicobacter pylori and most other gastric cancers. Further, the present inventors have confirmed through previous studies that GKN1 has a tumor suppressive activity in the development of gastric cancer (Korean Patent No. 10-1215069). In addition, recently, GKN1 induces senescence through activation of p16 / Rb pathway in gastric cancer cells, overexpression of GKN1 induces Fas-mediated apoptosis, and absence of GKN1 causes proliferation of gastric epithelial cells . Thus, overexpression of GKN1 in normal gastric mucosal tissues may lead to diseases such as atrophic gastritis by inducing apoptosis in normal gastric mucosal cells. In this regard, studies on the molecular mechanisms for maintaining homeostasis of the gastric mucosa are required, and identification of GKN1 inhibitors is required.

한편, GKN2는 TFIZ1, GDDR, blottin으로도 알려져 있는데, 위장관의 항상성 유지에 참여하는 점액 연관 단백질인 위 Trefoil factor family (TFF1)단백질과 결합하는 파트너로 알려져 있다. 또한, GKN2는 위 표면의 분비세포(foveolar cell)에서 발현되나 헬리코박터 파이로리균에 감염시 또는 위암 조직에서는 그 발현이 감소되는 것으로 보고되고 있다. 그러나, GKN2가 위 항상성 유지에 미치는 영향은 아직 보고된 바 없다.GKN2, also known as TFIZ1, GDDR, or blottin, is known to bind to the gastric trefoil factor family (TFF1) protein, a mucin-binding protein that participates in the maintenance of gastrointestinal homeostasis. In addition, GKN2 is expressed in the foveolar cell of the stomach but it is reported that the expression of GKN2 is reduced when infected with Helicobacter pylori or in gastric cancer tissue. However, the effect of GKN2 on gastric homeostasis has not been reported.

이에, 본 발명자들은 GKN2가 위염과 위암의 발생 및 진행에 밀접한 연관성을 가지고 있고, GKN2가 GKN1의 세포사멸능을 조절하는 조절 인자로써 위 점막 조직의 상피 세포에서 항상성을 유지하는데 중요한 역할을 할 수 있다는 가정 하에 위 점막 및 위암 조직에서 GKN2의 발현을 조사하였고, 세포 생존과 증식, 세포 사멸과 관련된 GKN1의 기능에 미치는 GKN2의 역할을 규명하였으며, GKN2가 GKN1의 과도한 활성을 저해하여 위 상피 세포의 항상성 유지에 중요한 역할을 한다는 것을 확인함으로써 본 발명을 완성하였다.The present inventors have found that GKN2 is closely related to the development and progression of gastritis and gastric cancer, and GKN2 plays an important role in maintaining homeostasis in gastric epithelial cells as a regulator of GKN1 cell apoptosis , GKN2 expression in gastric mucosa and stomach cancer tissues was investigated. GKN2 function was investigated in relation to GKN1 function related to cell survival, proliferation and apoptosis. GKN2 inhibited excessive activity of GKN1, And that it plays an important role in maintaining homeostasis.

대한민국등록특허 제10-1215069호Korean Patent No. 10-1215069

따라서, 본 발명의 목적은 GKN2 단백질 또는 상기 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 항암보조제, 위암 예방 또는 치료용 약제학적 조성물 및 위 점막 항상성 유지를 위한 약제학적 조성물을 제공하는 것이다.Accordingly, it is an object of the present invention to provide an anti-cancer adjuvant comprising a GKN2 protein or a polynucleotide encoding the protein, a pharmaceutical composition for preventing or treating stomach cancer, and a pharmaceutical composition for gastric mucosa homeostasis.

본 발명의 또 다른 목적은 GKN1 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드와 GKN2 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 처리하는 위암 치료방법을 제공하는 것이다.It is another object of the present invention to provide a method for treating gastric cancer, which polynucleotide encoding GKN1 protein or GKN1 protein and polynucleotide encoding GKN2 protein or GKN2 protein.

상기 목적을 달성하기 위하여, 본 발명은 항암제와 병용되는 GKN2 (Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 항암 보조제를 제공한다.In order to achieve the above object, the present invention provides an anti-cancer adjuvant comprising, as an active ingredient, a GKN2 (Gastrokine 2) protein or a polynucleotide encoding a GKN2 protein used in combination with an anticancer agent.

본 발명의 일실시예에 있어서, 상기 GKN2 단백질은 서열번호 1의 아미노산 서열로 이루어진 것일 수 있다.In one embodiment of the present invention, the GKN2 protein may comprise the amino acid sequence of SEQ ID NO: 1.

본 발명의 일실시예에 있어서, 상기 GKN2 단백질을 암호화하는 폴리뉴클레오티드는 서열번호 2의 염기서열로 이루어진 것일 수 있다.In one embodiment of the present invention, the polynucleotide encoding the GKN2 protein may comprise the nucleotide sequence of SEQ ID NO: 2.

본 발명의 일실시예에 있어서, 상기 항암 보조제는 GKN1(Gastrokine 1) 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 항암제에 대한 특이적인 보조제일 수 있다.In one embodiment of the present invention, the anticancer adjuvant may be a specific adjuvant for an anticancer agent comprising, as an active ingredient, a GKN1 (Gastrokine 1) protein or a polynucleotide encoding a GKN1 protein.

본 발명의 일실시예에 있어서, 상기 항암 보조제는 GKN1으로 인한 부작용을 감소 또는 완화시키는 것일 수 있다.In one embodiment of the present invention, the anti-cancer adjuvant may be to reduce or alleviate side effects due to GKN1.

본 발명의 일실시예에 있어서, 상기 부작용은 위축성 위염; 또는 위암이 전이된 조직이나 장기의 주변 정상세포의 세포사멸일 수 있다.In one embodiment of the present invention, the adverse effects include atrophic gastritis; Or cell death of peripheral normal cells of a tissue or organ in which the stomach cancer has metastasized.

또한, 본 발명은 GKN1(Gastrokine 1) 단백질 또는 GKN 1 단백질을 암호화하는 폴리뉴클레오티드와 GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 위암 예방 또는 치료용 약제학적 조성물을 제공한다.The present invention also provides a pharmaceutical composition for preventing or treating gastric cancer, comprising a polynucleotide encoding a GKN1 (Gastrokine 1) protein or a GKN 1 protein, and a polynucleotide encoding a GKN2 (Gastrokine 2) protein or a GKN2 protein.

본 발명의 일실시예에 있어서, 상기 GKN2는 상기 GKN1에 의해 유도되는 정상 위 점막조직 또는 위암이 전이된 조직이나 장기의 주변 정상세포의 과도한 세포사멸을 억제하여, GKN1으로 인한 부작용을 감소 또는 완화시키는 것일 수 있다.In one embodiment of the present invention, the GKN2 is a GKN1-inducible normal gastric mucosal tissue or gastric cancer-transferred tissue or a peripheral normal normal cell May be to inhibit excessive cell death, thereby reducing or alleviating side effects due to GKNl.

또한, 본 발명은 GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 위 점막 항상성 유지를 위한 약제학적 조성물을 제공한다.The present invention also provides a pharmaceutical composition for gastric mucosal homeostasis comprising as an active ingredient a polynucleotide encoding GKN2 (Gastrokine 2) protein or GKN2 protein.

본 발명의 일실시예에 있어서, 상기 조성물은 GKN1(Gastrokine 1) 단백질 또는 GKN 1 단백질을 암호화하는 폴리뉴클레오티드를 더 포함하는 것일 수 있다.In one embodiment of the present invention, the composition may further comprise a GKN1 (Gastrokine 1) protein or a polynucleotide encoding a GKN1 protein.

또한, 본 발명은 인간을 제외한 포유동물에 있어서, 위암 세포에는 GKN1 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 처리하고, 위암 세포 주변의 정상 위 점막 또는 위암이 전이된 조직이나 장기의 주변 정상세포에는 GKN2 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 처리하는 위암 치료방법을 제공한다.The present invention also provides a method for treating gastric cancer cells in a mammal other than a human, comprising administering to the gastric cancer cells a polynucleotide encoding a GKN1 protein or a GKN1 protein and treating the gastric cancer cell with a normal gastric mucosa or gastric cancer, A GKN2 protein or a polynucleotide encoding a GKN2 protein.

본 발명에 따른 GKN2는 GKN1의 과발현에 의해 유도될 수 있는 위 점막 및 암 전위 부위에 있는 정상 세포들의 과도한 세포사멸을 억제하여 GKN1을 유효성분으로 함유하는 위암 치료용 조성물의 부작용을 효과적으로 억제할 수 있고, GKN1과의 음성 피드백에 의한 길항 작용으로 상호 적정 수준의 발현 내지 기능을 유지할 수 있으므로 위 점막 조직의 항상성 유지를 위한 약제학적 조성물로 유용하게 사용할 수 있을 것이다.The GKN2 according to the present invention suppresses excessive cell apoptosis of normal cells in the gastric mucosal membrane and cancer potential site that can be induced by overexpression of GKN1 and effectively inhibits side effects of a composition for treating gastric cancer containing GKN1 as an active ingredient And can maintain an appropriate level of expression or function by antagonistic action by the negative feedback with GKN1, so that it can be usefully used as a pharmaceutical composition for maintaining homeostasis of gastric mucosal tissues.

도 1은 GKN2에 의한 GKN1의 항증식 저해효과를 (A) MTT assay (B) BrdU incorporation assay (C) colony formation assay로 확인한 결과이다.
도 2는 GKN2에 의한 GKN1의 세포사멸 저해효과를 (A) Annexin V-binding assay (B) caspase-3, -7 activity 분석을 통해 확인한 결과이다.
도 3은 GKN1에 의해 유도되는 G2/M arrest에 대한 GKN2의 억제 효과를 (A) 유세포분석기 (B) 웨스턴 블라팅을 통해 확인한 결과이다.
도 4는 GKN1에 의해 유도되는 (A) miR-185 발현 (B) 후생적 조절자(DNMT1, EZH2)의 발현 억제에 대한 GKN2의 저해 효과를 나타내는 결과이다.
도 5는 비종양 위 점막에서 (A) GKN1와 GKN2 (B) GKN1, GKN2와 CagA의 발현간의 상관관계를 분석한 결과이다.
도 6은 GKN1이 NF-B 불활성 및 IB 활성을 통해 GKN2 발현을 조절하는 것을 나타낸 것이다.
도 7은 위암 조직에서 GKN2 발현을 면역염색한 것으로 (A) 위 점막 상피세포에서 GKN2 발현 (B) 장형 위암 조직에서 GKN2 발현 (C) 장형 위암 조직에서 GKN2 음성 염색을 나타낸 것이다.
FIG. 1 shows the results of (A) MTT assay (B) BrdU incorporation assay (C) colony formation assay for the inhibitory effect of GKN1 on GKN1.
FIG. 2 shows the results of GKN2-induced inhibition of GKN1 apoptosis by (A) Annexin V-binding assay (B) caspase-3, -7 activity assay.
FIG. 3 shows the results of (A) inhibitory effect of GKN2 on G2 / M arrest induced by GKN1 through Western blotting of flow cytometry analyzer (B).
Fig. 4 shows the inhibitory effect of GKN2 on the inhibition of GKN1-induced (A) miR-185 expression (B) welfare regulators (DNMT1, EZH2).
FIG. 5 shows the results of analysis of the correlation between (A) GKN1 and GKN2 (B) GKN1, GKN2 and CagA expression in the non-tumor gastric mucosa.
Figure 6 shows that GKN1 regulates GKN2 expression through NF-B inactivation and IB activity.
FIG. 7 shows immunostaining of GKN2 expression in gastric cancer tissue. (A) GKN2 expression in gastric epithelial cells. (B) GKN2 expression in GKN2 gastric cancer tissue. (C) GKN2 negative staining in GKN2 gastric cancer tissues.

본 발명은 GKN2(Gastrokine 2)를 유효성분으로 포함하는 항암 보조제를 제공함에 그 특징이 있으며, 보다 구체적으로는 GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 항암 보조제를 제공함에 그 특징이 있다. The present invention provides an anticancer adjuvant comprising GKN2 (Gastrokine 2) as an active ingredient. More particularly, the present invention provides an anticancer adjuvant comprising a GKN2 (Gastrokine 2) protein or a polynucleotide encoding the GKN2 protein There are features.

본 발명자들은 대한민국등록특허 제10-1215069호를 통하여 GKN1이 항암용 조성물로 기능할 수 있음을 규명한 바 있다. The present inventors have found that GKN1 can function as an anticancer composition through Korean Patent No. 10-1215069.

보호 및 수복 기전은 위 점막이 벗겨진 부위에 상피 세포의 이동을 촉진시키고, 점액 생산을 증가시키며, 상피 증식과 분화 프로그램을 재설정하여 위점막의 무결정을 복원시키는 기능을 한다. 이때 GKN1은 외부 항원, 세균과 위산에 노출된 위 점막을 보호하기 위한 점막 장벽 기능을 한다. GKN1의 불활성화는 위 점막 부위의 암을 유발하거나 위 손상을 유발할 수 있으며 이는 결과적으로 위암과 관련된 유전적 변화를 야기할 수 있을 것이다. 한편, 헬리코박터 파이로리균에 감염되거나 위암에 걸린 위 조직에서는 GKN1과 GKN2의 발현이 감소되는데, 이는 GKN2의 발현이 GKN1 의 발현과 연관성이 있음을 의미하며, 이를 위암 예측 및 진단을 위한 도구로 사용할 수 있음을 고안할 수 있다. 그러나, GKN2가 위 점막의 항상성 유지에 어떠한 역할을 하는지는 아직 명확히 규명되지 않고 있는 실정이다. The protective and restorative mechanism promotes the migration of epithelial cells to the area where the gastric mucosa is removed, increases mucus production, and restores the epithelial proliferation and differentiation program, thereby restoring the undetermined crystal of the gastric mucosa. At this time, GKN1 functions as a mucosal barrier to protect the gastric mucosa exposed to external antigens, bacteria and gastric acid. Inactivation of GKN1 may cause cancer of the gastric mucosa or induce stomach damage, which may result in genetic changes associated with gastric cancer. On the other hand, expression of GKN1 and GKN2 is decreased in H. pylori-infected or stomach-stomach stomach tissue, indicating that expression of GKN2 is associated with expression of GKN1, which can be used as a tool for predicting and diagnosing stomach cancer Can be devised. However, the role of GKN2 in the maintenance of gastric mucosal homeostasis has not yet been clarified.

본 발명자들은 GKN1이 비종양성 위 점막세포주 HFE-145와 AGS 위암 세포주에서 세포 증식을 억제하고 세포사멸을 유도하여 종양 억제 기능을 가지고 있음을 보고한 바 있다. 본 발명에서 본 발명자들은 GKN2가 위 점막세포의 항상성 유지를 위한 GKN1의 저해제로 작용할 수 있는지 확인하였다. The inventors of the present invention have reported that GKN1 inhibits cell proliferation and induces apoptosis in the non-gonadal gastric mucosal cell line HFE-145 and AGS gastric cancer cell line to have a tumor suppressor function. In the present invention, the present inventors have confirmed that GKN2 can act as an inhibitor of GKN1 for maintaining homeostasis of gastric mucosal cells.

그 결과, GKN2 단독으로는 세포 생존, 증식, 세포사멸에 어떠한 영향을 미치지 않았으나, GKN2가 GKN1에 의해 유도되는 세포 생존, 세포 증식 및 세포사멸을 억제하는 것으로 나타났다(도 1 및 도 2 참조). As a result, although GKN2 alone did not affect cell survival, proliferation and apoptosis, GKN2 inhibited GKN1-induced cell survival, cell proliferation and apoptosis (see FIGS. 1 and 2).

세포 주기 분석에서 GKN1은 G2/M 상태의 세포 수를 현저하게 증가시키는 것으로 나타났는데, GKN2는 GKN1에 의해 유도된 G2/M arrest를 저해하고 GKN1에 의한 G0/G1 및 G2/M과 관계된 세포 주기 조절자들의 발현 변화를 저해하는 것으로 나타났다(도 3 참조).In the cell cycle analysis, GKN1 significantly increased the number of G2 / M cells. GKN2 inhibited G2 / M arrest induced by GKN1 and inhibited G0 / G1 and G2 / M related cell cycle Inhibiting changes in the expression of the regulators (see FIG. 3).

이들 결과는 shGKN1과 anti-miR-185 형질주입에 따른 GKN1 silencing 효과와 일치하는 것으로, GKN2가 GKN1 종양 억제 활성을 조절하여 위 점막 상피 세포의 항상성을 유지하는데 중요한 역할을 한다고 예측할 수 있었다.These results are consistent with the effect of GKN1 silencing upon shGKN1 and anti-miR-185 transfection, suggesting that GKN2 plays an important role in regulating gastric epithelial cell homeostasis by regulating GKN1 tumor suppressor activity.

또한, GKN2가 GKN1에 의해 조절되는 후생적 변화에 미치는 영향을 확인해 보고자, 본 발명자들은 GKN2가 miR-185, DNMT1, EZH2의 발현 조절에 미치는 영향을 확인하였다. 그 결과는 예상한 바와 같이, GKN2가 GKN1에 의해 유도된 miR-185 발현을 감소시키고, GKN1에 의한 DNMT1과 EZH2 발현 억제 효과를 저해하는 것으로 나타났다. GKN1은 c-Myc에 결합하여 c-Myc을 하향 조절함으로써 miR-185의 발현을 증가시키는데, 본 발명자들은 GKN2 단독으로는 c-Myc의 발현에 별다른 영향을 미치지 않으나, GKN1에 의한 c-Myc 활성 억제효과는 저해하는 것을 알 수 있었다(도 4B 참조). 이들 결과로부터 본 발명자들은 GKN2가 GKN1에 의해 유도되는 miR-185 의존적 종양 억제 활성을 저해한다는 것을 알 수 있었다.In addition, in order to confirm the effect of GKN2 on the welfare change regulated by GKN1, the present inventors confirmed the effect of GKN2 on miR-185, DNMT1 and EZH2 expression control. The results show that GKN2 reduces GKN1-induced miR-185 expression and inhibits the effect of GKN1 on DNMT1 and EZH2 expression, as expected. GKN1 binds to c-Myc and down-regulates c-Myc to increase miR-185 expression. We do not affect the expression of c-Myc by GKN2 alone, but the c-Myc activity by GKN1 Inhibitory effect was inhibited (see Fig. 4B). From these results, the present inventors have found that GKN2 inhibits GKN1-induced miR-185-dependent tumor suppressor activity.

이에 본 발명자들은 GKN2와 GKN1 발현간의 상관관계를 확인하고자, 50 개의 비종양성 위 점막 조직에서 GKN2와 GKN1의 mRNA 및 단백질 발현 양상을 비교하였다. 흥미롭게도, GKN2와 GKN1의 발현에는 유의한 상관관계가 확인되었는데(P=0.0074, 표 2 참조), 이를 통하여 정상 위 점막 조직의 항상성 유지를 위해 GKN1과 함께 GKN2가 발현되어야 한다는 것을 알 수 있었다. The present inventors compared the mRNA and protein expression patterns of GKN2 and GKN1 in 50 non-gonadal gastric mucosal tissues in order to confirm the correlation between GKN2 and GKN1 expression. Interestingly, there was a significant correlation between the expression of GKN2 and GKN1 (P = 0.0074, see Table 2), indicating that GKN2 should be expressed with GKN1 to maintain homeostasis of normal gastric mucosal tissues.

한편, CagA 양성 헬리코박터 파이로리 균에 감염되지 않은 점막 조직에 비해 헬리코박터 파이로리균에 감염된 위 점막 조직에서 GKN1 단백질 발현이 현저히 낮다는 것은 확인되었으나 (P=0.0013), GKN2 mRNA와 단백질 발현은 CagA 헬리코박터 파이로균의 감염과 상관관계가 없는 것으로 나타났다(P=0.3136, P=0.4668, 도 5B 참조). On the other hand, GKN1 mRNA and protein expression was significantly lower in GKN1 mucosal tissues infected with Helicobacter pylori than in mucosal tissues not infected with CagA positive Helicobacter pylori (P = 0.0013), but the expression of GKN2 mRNA and protein was detected by CagA Helicobacter pylori (P = 0.3136, P = 0.4668, see Fig. 5B).

GKN1과 GKN2는 특히 위 전정부와 위저부의 표면 점막 세포에 발현되는데, GKN1과 같이 GKN2도 위암 발병에 따라 하향 조절되는 것으로 나타났다. GKN2는 위 종양과 무병 조직에서 현저한 발현 양상 차이가 확인되었는데, GKN2는 위 암 조직에서 그 발현이 현저히 감소되고, TFF1 발현과 함께 림프절 전이와 깊은 상관관계가 있음을 알 수 있었다. 한편, GKN2의 손실은 장형 위암의 짧은 생존 기간과 관계되어 있고, GKN1의 발현 감소는 GKN2와 관계된 것으로 확인되었다. 본 발명에서 GKN2 발현의 감소는 169개의 위암 샘플 중 134개(79.3%) 샘플에서 확인되어, 위암 세포 분화와 밀접한 관계가 있는 것으로 나타났다. GKN1이 GKN2의 발현에 어떠한 영향을 미치는지 확인하고자 GKN2 mRNA와 단백질 발현양을 GKN1 형질주입된 AGS 세포주에서 조사해 본 결과, GKN1 발현은 GKN2의 mRNA와 단백질 발현을 모두 시간 의존적으로 증가시키는 것으로 나타났다(P=0.01, 도 6A, 6B 참조). 그리고 HFE-145 세포에서 GKN1 silencing은 GKN2 발현을 감소시키는 것으로 나타났다(도 6D 참조).GKN1 and GKN2 are expressed on surface mucosal cells, especially in gastric and gastric mucosa. GKN2, like GKN1, is also down-regulated by gastric cancer. GKN2 was found to be significantly different in gastric and disease-free tissues. GKN2 was significantly decreased in gastric cancer tissues, and TFF1 expression was closely correlated with lymph node metastasis. On the other hand, the loss of GKN2 is related to the short survival period of long gastric cancer, and the decrease of GKN1 expression is related to GKN2. In the present invention, the decrease in GKN2 expression was observed in 134 (79.3%) samples of 169 gastric cancer samples, showing a close relationship with gastric cancer cell differentiation. In order to examine the effect of GKN1 on GKN2 expression, GKN2 mRNA and protein expression levels were examined in AGS cell line injected with GKN1 transcript, and GKN1 expression was found to increase both mRNA and protein expression of GKN2 in a time-dependent manner (P = 0.01, Figs. 6A and 6B). And GKNl silencing in HFE-145 cells decreased GKN2 expression (see Figure 6D).

GKN1이 GKN2의 발현을 조절하는 기전이 NF-B 신호전달 경로를 불활성화시킴으로써 유도되는지 확인하고자, AGS 세포주에서 TNF-a와 GKN1이 p-p65, p65, IB의 발현에 미치는 영향을 확인하였는데, GKN1은 p-p65와 p65의 발현을 저해하고, IB의 발현을 증가시켰으나 TNF-a는 p-p65와 p65의 발현을 증가시키고, IB의 발현을 저해하는 것으로 나타났다(도 6E). 그리고, HFE-145 세포주에서 shGKN1에 의해 억제된 GKN1의 발현은 p-65와 p65 발현을 증가시키고, IB의 발현을 감소시키는 것으로 나타났다(도 6E). 또한, TNF-a는 HFE-145 및 AGS 세포주 모두에서 GKN2 mRNA와 단백질 발현을 저해한 반면, GKN1은 GKN2의 발현을 증가시키는 것으로 나타났다(도 6C). 이러한 결과를 종합하면, GKN2 발현은 일부 GKN1 의존적 방식으로 조절되고, 이는 NF-B 신호 전달 경로를 불활성화시키고, IB를 활성화시키는 방식으로 조절된다는 것을 알 수 있었다. 즉, GKN2와 GKN1은 위 상피 세포의 항상성을 유지시키기 위해서 음성 피드백(negative feedback) 저해 관계에 있는 것을 알 수 있었다. 그러나, GKN1 발현은 GKN2와 헬리코박터 파이로리균의 CagA와 연관되어 있고, GKN2 발현과 헬리코박터 파이로리균의 CagA와는 별다른 상관관계가 없는 것으로 나타나 GKN2 의 발현 조절에는 GKN1 이외에 다른 단백질이나 신호전달계가 관여한다고 할 수 있다. We examined the effect of GKN1 on the expression of p-p65, p65, and IB in AGS cell lines in order to determine whether the mechanism of GKN1 expression is induced by inactivating the NF-B signaling pathway. GKN1 inhibited the expression of p-p65 and p65 and increased the expression of IB, but TNF-a increased the expression of p-p65 and p65 and inhibited the expression of IB (Fig. 6E). And, the expression of GKN1 inhibited by shGKN1 in the HFE-145 cell line increased p-65 and p65 expression and decreased IB expression (Fig. 6E). In addition, TNF-a inhibited GKN2 mRNA and protein expression in both HFE-145 and AGS cell lines, while GKN1 increased expression of GKN2 (Fig. 6C). Taken together, these results indicate that GKN2 expression is regulated in some GKN1-dependent manner, which is regulated in such a way as to inactivate the NF-B signaling pathway and activate IB. In other words, it was found that GKN2 and GKN1 had a negative feedback inhibition relationship in order to maintain the gastric epithelial homeostasis. However, GKN1 expression is associated with GKN2 and CagA of Helicobacter pylori, and there is no correlation between GKN2 expression and CagA of Helicobacter pylori. Therefore, other proteins or signal transduction systems besides GKN1 may be involved in the regulation of GKN2 expression have.

상기와 같은 연구 결과를 통해, 본 발명자들은 GKN1을 유효성분으로 포함하는 항암제와 GKN2를 병용 투여하면 GKN1에 의해 유도되는 부작용을 감소 또는 완화시키는 것을 알 수 있었다. 바람직하게, 상기 부작용은 위암 주위 비종양성 위 점막에서의 위축성 위염과 전이성 위암 환자에서 전이된 장기나 조직에 있는 정상세포의 사멸일 수 있다. 즉, 위암 치료에 있어서 GKN1을 투여하면 위암 주위 비종양성 위 점막에서 과도한 세포사멸이 일어나 위축성 위염의 부작용이 발생할 수 있고, 위암이 복강, 림프절, 폐, 간, 뇌 등의 다른 장기나 조직으로 전이되는 전이성 위암에 있어서도 GKN1을 항암제로 사용할 때 전이된 장기나 조직의 암세포 주변 정상세포에서 과도한 세포사멸을 유도하는 부작용이 발생할 수 있다. 이 경우 GKN1의 조절 기능을 갖는 GKN2를 병용 투여한다면, GKN1은 암세포의 세포사멸을 유도하고, GKN2는 정상 세포가 세포사멸하는 부작용을 억제할 수 있을 것이다. As a result of the above study, the inventors of the present invention found that administration of GKN2 in combination with an anticancer agent containing GKN1 as an active ingredient reduces or alleviates the side effects induced by GKN1. Preferably, the side effect may be the death of atrophic gastritis in a nonsmatic gastric mucosa around the stomach and death of normal cells in metastatic organs or tissues in patients with metastatic gastric cancer. That is, when GKN1 is administered in the treatment of gastric cancer, excessive cell apoptosis may occur in the nonsmatic gastric mucosa around the stomach cancer, resulting in adverse effects of atrophic gastritis. When gastric cancer is metastasized to other organs or tissues such as abdominal cavity, lymph node, The use of GKN1 as an anticancer agent may cause side effects that induce excessive apoptosis in normal cells surrounding cancer cells or metastasized organs or tissues. In this case, when GKN2 having a regulatory function of GKN1 is administered in combination, GKN1 induces apoptosis of cancer cells, and GKN2 may suppress the side effect of apoptosis of normal cells.

따라서, 본 발명은 항암제와 병용되는 GKN2(Gastrokine 2) 단백질 또는 GKN 2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 항암 보조제를 제공할 수 있다. Accordingly, the present invention can provide an anti-cancer adjuvant containing, as an active ingredient, a GKN2 (Gastrokine 2) protein or a polynucleotide encoding a GKN2 protein used in combination with an anticancer agent.

바람직하게, 상기 GKN2 단백질은 서열번호 1의 아미노산 서열로 이루어질 수 있고, 상기 GKN2 단백질을 암호화하는 폴리뉴클레오티드는 서열번호 2의 염기서열로 이루어질 수 있다. Preferably, the GKN2 protein may comprise the amino acid sequence of SEQ ID NO: 1, and the polynucleotide encoding the GKN2 protein may comprise the nucleotide sequence of SEQ ID NO: 2.

또한 본 발명에 따른 상기 GKN2 단백질은 바람직하게 서열번호 1의 아미노산 서열을 갖는 폴리펩티드에 대해 기능적 동등물일 수 있다. 상기 '기능적 동등물'이란, 아미노산의 부가, 치환 또는 결실의 결과, 서열번호 1로 표시되는 아미노산 서열과 적어도 60%, 바람직하게는 70%, 보다 바람직하게는 80% 이상의 서열 상동성을 갖는 것으로서 본 발명의 GKN2와 실질적으로 동질의 활성을 나타내는 폴리펩티드를 말한다. 여기서, '실질적으로 동질의 활성'이란 상기에서 기재한 GKN2의 활성을 의미한다. 상기 기능적 동등물에는, 예를 들어, 본 발명에 따른 GKN2의 아미노산 서열의 아미노산 중 일부가 치환되거나, 결실 또는 부가된 아미노산 서열 변형체가 포함될 수 있다. 아미노산의 치환은 바람직하게는 보존적 치환일 수 있으며, 천연에 존재하는 아미노산의 보존적 치환의 예는 다음과 같다; 지방족 아미노산(Gly, Ala, Pro), 소수성 아미노산(Ile, Leu, Val), 방향족 아미노산(Phe, Tyr, Trp), 산성 아미노산(Asp, Glu), 염기성 아미노산(His, Lys, Arg, Gln, Asn) 및 황함유 아미노산(Cys, Met). 아미노산의 결실은 바람직하게는 본 발명의 GKN2의 활성에 직접 관여하지 않는 부분에 위치할 수 있다. 또한 상기 기능적 동등물의 범위에는 GKN2의 기본 골격 및 이의 생리 활성을 유지하면서 폴리펩티드의 일부 화학 구조가 변형된 폴리펩티드 유도체도 포함될 수 있다. 예를 들어, 본 발명의 폴리펩티드의 안정성, 저장성, 휘발성 또는 용해도 등을 변경시키기 위한 구조변경 및 생리활성을 유지하면서 다른 단백질과 융합으로 만들어진 융합단백질 등이 이에 포함될 수 있다.In addition, the GKN2 protein according to the present invention may preferably be a functional equivalent to a polypeptide having the amino acid sequence of SEQ ID NO: 1. The 'functional equivalent' means a polypeptide having at least 60%, preferably 70%, more preferably 80% or more sequence homology with the amino acid sequence of SEQ ID NO: 1 as a result of addition, substitution or deletion of amino acid Refers to a polypeptide exhibiting substantially the same activity as GKN2 of the present invention. Here, 'substantially homogenous activity' means the activity of GKN2 described above. Such functional equivalents may include, for example, amino acid sequence variants in which some of the amino acids of the amino acid sequence of GKN2 according to the invention are substituted, deleted or added. Substitution of amino acids can be preferably conservative substitutions, and examples of conservative substitutions of amino acids present in nature are as follows: (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of the amino acid may preferably be located at a site that is not directly involved in the activity of GKN2 of the present invention. The functional equivalents may also include polypeptide derivatives in which some of the chemical structures of the polypeptides are modified while maintaining the basic skeleton of GKN2 and its physiological activity. For example, the polypeptide of the present invention may include a fusion protein made by fusion with another protein while maintaining structural stability and physiological activity to change the stability, shelf-life, volatility, or solubility of the polypeptide of the present invention.

또한 상기 GKN2(Gastrokine 2) 단백질을 암호화하는 폴리뉴클레오티드는 플라스미드 또는 바이러스 벡터와 같은 발현 벡터 내로 공지의 방법에 의해 도입시킨 후 상기 발현 벡터를 당업계에 공지된 다양한 방법으로 형질도입(transduction) 또는 형질주입(transfection)에 의해 발현형으로 표적 세포 내에 도입시킬 수 있다.The polynucleotide encoding the GKN2 (Gastrokine 2) protein may be introduced into an expression vector such as a plasmid or a viral vector by a known method, and then the expression vector may be transduced or transfected by various methods known in the art Can be introduced into the target cell in an expression form by transfection.

플라스미드 발현 벡터는 사람에게 사용할 수 있는 FDA의 승인된 유전자 전달방법이며 사람 세포에 직접적으로 플라스미드 DNA를 전달하는 방법으로(Nabel, E. G. et al., Science, 249:1285-1288, 1990), 플라스미드 DNA는 바이러스 벡터와는 달리 균질하게 정제될 수 있는 장점이 있다. 본 발명에서 사용할 수 있는 플라스미드발현 벡터로는 당업계에 공지된 포유동물 발현 플라스미드를 사용할 수 있으며, 본 발명의 일실시예에서는 pcDNA3.1(Invitrogen) 플라스미드를 사용하여 GKN2 유전자가 삽입된 재조합 발현벡터인 pcDNA3.1-GKN2를 제조하였다.The plasmid expression vector is an FDA approved gene transfer method that can be used for human, and is a method of directly delivering plasmid DNA to human cells (Nabel, EG et al., Science, 249: 1285-1288, 1990) Has the advantage that it can be homogeneously purified, unlike the viral vector. As a plasmid expression vector that can be used in the present invention, mammalian expression plasmids known in the art may be used. In one embodiment of the present invention, a recombinant expression vector in which a GKN2 gene is inserted using pcDNA3.1 (Invitrogen) RTI ID = 0.0 > pcDNA3.1-GKN2 < / RTI >

본 발명에 따른 핵산을 포함하는 플라스미드 발현 벡터(plasmid expression vector)는 당업계에 공지된 방법, 예를 들어 이에 한정되지는 않으나, 일시적 형질주입(transient transfection), 미세주사, 형질도입(transduction), 세포융합, 칼슘 포스페이트 침전법, 리포좀 매개된 형질주입(liposome-mediated transfection), DEAE 덱스트란-매개된 형질주입(DEAE Dextran- mediated transfection), 폴리브렌-매개된 형질주입(polybrene-mediated transfection), 전기침공법(electroporation), 유전자 건(gene gun) 및 세포 내로 DNA를 유입시키기 위한 다른 공지의 방법에 의해 종양세포 내로 도입할 수 있다(Wu. et al., J. Bio. Chem., 267:963-967, 1992; Wu. et al., Bio. Chem., 263:14621-14624, 1988). 바람직하게는, 일시적 형질주입방법을 사용할 수 있다.A plasmid expression vector containing the nucleic acid according to the present invention may be prepared by a method known in the art such as, but not limited to, transient transfection, microinjection, transduction, Such as cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, Can be introduced into tumor cells by electroporation, gene gun, and other known methods for introducing DNA into cells (Wu et al., J. Bio. Chem., 267: 963-967, 1992; Wu et al., Bio. Chem., 263: 14621-14624, 1988). Preferably, a transient transfusion method can be used.

또한 상기 GKN2를 발현시킬 수 있는 벡터는 공지의 방법에 의해 세포, 조직 또는 체내로 투여될 수 있는데, 예를 들면, 국소적으로, 비경구, 경구, 비강, 정맥, 근육 내, 피하 내 또는 다른 적절한 수단에 의해 투여될 수 있다. In addition, the vector capable of expressing GKN2 may be administered into cells, tissues or the body by a known method, for example, topically, parenterally, orally, nasally, intravenously, intramuscularly, subcutaneously, May be administered by any suitable means.

한편, 본 발명은 GKN1(Gastrokine 1) 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드와 GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 위암 예방 또는 치료용 조성물을 제공한다. Meanwhile, the present invention provides a composition for preventing or treating gastric cancer, comprising a polynucleotide encoding GKN1 (Gastrokine 1) protein or GKN1 protein and a polynucleotide encoding GKN2 (Gastrokine 2) protein or GKN2 protein.

또한, 본 발명은 GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 위 점막 항상성 유지를 위한 조성물을 제공한다. The present invention also provides a composition for gastric mucosal homeostasis comprising as an active ingredient a polynucleotide encoding GKN2 (Gastrokine 2) protein or GKN2 protein.

상기 위암 예방 또는 치료용 조성물은 암을 예방 및 치료할 수 있는 약학적 조성물로 사용될 수 있으며, 상기 위 점막 항상성 유지를 위한 조성물은 위 점막이 정상 기능을 갖도록 무력해진 기능을 회복할 수 있는 약학적 조성물 또는 건강기능식품용 조성물로 사용할 수 있다.The composition for preventing or treating gastric cancer may be used as a pharmaceutical composition capable of preventing and treating cancer, and the composition for gastric mucosa homeostasis may be a pharmaceutical composition capable of restoring the function of being inactivated so that the gastric mucosa has normal function Or as a composition for health functional foods.

상기 약학적 조성물은 약학적으로 허용되는 담체를 추가로 포함할 수 있다. 상기에서 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등과 같은 경구 투여용 담체 및 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995). 본 발명에 따른 약학적 조성물은 상술한 바와 같은 약학적으로 허용되는 담체와 함께 당업계에 공지된 방법에 따라 적합한 형태로 제형화 될 수 있다. 즉, 본 발명의 약학적 조성물은 공지의 방법에 따라 다양한 비경구 또는 경구 투여용 형태로 제조될 수 있으며, 비경구 투여용 제형의 대표적인 것으로는 주사용 제형으로 등장성 수용액 또는 현탁액이 바람직하다. 주사용 제형은 적합한 분산제 또는 습윤제 및 현탁화제를 사용하여 당업계에 공지된 기술에 따라 제조할 수 있다. 예를 들면, 각 성분을 식염수 또는 완충액에 용해시켜 주사용으로 제형화될 수 있다. 또한 경구 투여용 제형으로는, 이에 한정되지는 않으나, 분말, 과립, 정제, 환약 및 캡슐 등이 있다.The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, water for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols And may further contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995). The pharmaceutical composition according to the present invention, together with a pharmaceutically acceptable carrier as described above, may be formulated into a suitable form according to a method known in the art. That is, the pharmaceutical composition of the present invention can be prepared in various parenteral or oral administration forms according to known methods, and isotonic aqueous solutions or suspensions are preferred for injection formulations typical of parenteral administration formulations. The injectable formulations may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. Formulations for oral administration also include, but are not limited to, powders, granules, tablets, pills, and capsules.

상기와 같은 방법으로 제형화된 약학적 조성물은 유효량으로 경구, 경피, 피하, 정맥 또는 근육을 포함한 여러 경로를 통해 투여될 수 있다. 상기에서 '유효량' 이란 환자에게 투여하였을 때, 예방 또는 치료 효과를 나타내는 양을 말한다. 본 발명에 따른 약학적 조성물의 투여량은 투여 경로, 투여 대상, 연령, 성별 체중, 개인차 및 질병 상태에 따라 적절히 선택할 수 있다. 바람직하게는, 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있으나, 바람직하게는 1~10000/체중kg/day, 더욱 바람직하게는 10~1000/체중kg /day의 유효용량으로 하루에 수회 반복 투여될 수 있다. 또한 본 발명의 항암용 조성물은 암을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병행하여 투여할 수도 있다.The pharmaceutical composition formulated as described above may be administered in an effective amount through various routes including oral, transdermal, subcutaneous, intravenous, or muscular. The term " effective amount " as used herein refers to an amount that shows a preventive or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention can be appropriately selected depending on the route of administration, subject to be administered, age, gender, individual difference, and disease state. Preferably, the pharmaceutical composition of the present invention may contain the active ingredient in an amount of 1 to 10000 / kg body weight / day, more preferably 10 to 1000 / kg body weight / day, May be repeatedly administered several times a day at an effective dose of < RTI ID = 0.0 > The anticancer composition of the present invention may also be administered in combination with a known compound having an effect of preventing, ameliorating or treating cancer.

또한, 본 발명은 위암 조직에는 GKN1 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 처리하고, 위암 및 전이암 주변의 정상 점막 및 조직 부위에는 GKN2 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 처리하는 위암 치료방법을 제공한다. The present invention also provides a method for treating gastric cancer, which comprises treating a gastric cancer tissue with a polynucleotide encoding a GKN1 protein or a GKN1 protein and treating a polynucleotide encoding a GKN2 protein or a GKN2 protein with a normal mucosa and a tissue region around the gastric cancer and metastatic cancer .

바람직하게는, 상기 위암 치료방법은 위암 내시경 시술 단계에서 활용할 수 있다. 이와 같은 치료 방법은, 위암 조직에는 GKN1 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 주입 또는 살포하고, 위암 주변의 정상 위 점막 부위에는 GKN2 단백질 또는 GKN 2 단백질을 암호화하는 폴리뉴클레오티드를 주입 또는 살포함으로써, 위암 세포는 GKN1에 의해 효과적으로 사멸하고, 위암 주변 정상 위 점막 및 전이암 주위 정상 조직은 GKN2와 GKN1의 상호 작요에 의한 항상성 유지를 통해 GKN1에 의한 위축성 위염과 암 주위 정상세포의 사멸과 같은 부작용을 완화시키는 효과가 있다.
Preferably, the gastric cancer treatment method can be utilized in the gastrointestinal endoscopic procedure. In such a therapeutic method, a polynucleotide encoding GKN1 protein or GKN1 protein is injected or sprayed into the gastric cancer tissue, and a polynucleotide encoding GKN2 protein or GKN2 protein is injected or sprayed into the normal gastric mucosa around the gastric cancer, The gastric cancer cells are effectively killed by GKN1, normal tissues surrounding the normal gastric mucosa around the stomach cancer and metastatic cancer surrounding the gastrointestinal tract maintain the homeostasis by the interaction of GKN2 and GKN1, resulting in side effects such as atrophic gastritis caused by GKN1 and death of surrounding normal cells There is a mitigating effect.

이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited to these embodiments.

<실시예 1>&Lt; Example 1 >

GKN2가 GKN1에 의한 세포증식 및 세포사멸 활성에 미치는 영향 분석Effect of GKN2 on cell proliferation and apoptotic activity by GKN1

GKN2가 GKN1에 의한 세포 증식 및 세포사멸 활성에 미치는 영향을 알아보기 위하기 AGS 위암 세포주에 GKN1과 GKN2 투여에 따른 세포 생존률, 세포 증식 및 군락 형성 분석을 하였다.
To investigate the effect of GKN2 on cell proliferation and cell killing activity by GKN1, cell viability, cell proliferation and community formation were analyzed by GKN1 and GKN2 administration in AGS gastric cancer cell lines.

1-1. AGS 위암 세포주 형질 주입1-1. AGS gastric cancer cell line transfusion

이를 위하여 GKN1 과 GKN2 를 발현하지 않는 AGS 위암 세포주를 사용하였으며, 상기 세포주는 37, 5% CO2 조건에서 열로 불활성화된 10% FBS가 보충된 RPMI-1640 배지를 이용하여 배양하였다. 한편, GKN1, GKN2의 cDNA를 발현 벡터인 pcDNA3.1 (Invitrogen, Carlsbad, CA, USA)에 클로닝하고, 이들 발현 벡터 2을 각각 공벡터 형질주입 세포주, GKN1 형질주입 세포주, GKN2 형질주입 세포주, GKN1 및 GKN2 형질주입 세포주의 4개의 그룹으로 나누어, 60mm 직경의 접시에 배양한 AGS 세포에 제조자 방식에 따라 Lipofectamine Plus 형질주입 시약(Invitrogen)을 이용하여 형질주입하였다.
For this, an AGS gastric cancer cell line that does not express GKN1 and GKN2 was used. The cell line was cultured in RPMI-1640 medium supplemented with heat-inactivated 10% FBS at 37, 5% CO 2 . On the other hand, cDNAs of GKN1 and GKN2 were cloned into an expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) and these expression vectors 2 were respectively inserted into a vector vector transfected cell line, GKN1 transfected cell line, GKN2 transfected cell line, GKN1 And GKN2 transfected cell line, and transfected into AGS cells cultured in a 60 mm diameter dish using Lipofectamine Plus transfection reagent (Invitrogen) according to the manufacturer's protocol.

1-2. 세포 생존률 분석1-2. Cell survival analysis

GKN1, GKN2, GKN1 및 GKN2가 각각 형질주입된 AGS 위암 세포주의 세포 생존률은 MTT [3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide]를 이용하여 분석하였는데, 형질주입 후 24, 48, 72 시간에 분석하였다. 흡광도는 분광광도계를 이용하여 540nm에서 측정하였으며, 공벡터를 형질주입한 세포주의 생존률을 대조군으로 측정하였다.
The cell viability of the AGS gastric cancer cell line transfected with GKN1, GKN2, GKN1 and GKN2 was analyzed using MTT [3- (4,5 dimethylthiazol-2-yl) -2,5-diphenyltetrazoliumbromide] , 48, 72 hours. Absorbance was measured at 540 nm using a spectrophotometer, and the survival rate of the cell line transfected with the vector was measured as a control.

1-3. 세포 증식 측정1-3. Cell proliferation measurement

GKN1과 GKN2가 세포 증식에 미치는 영향을 분석하기 위하여, BrdU (bromodeoxyuridine) 융합 분석을 실시하였다. 형질 주입 후 24, 28, 72 시간이 경과한 후 BrdU 세포 증식 분석 키트(Millipore, Billerica, MA, USA)로 제조자 방식에 따라 분석하였으며, 흡광도는 분광광도계를 이용하여 450nm에서 측정하였고, 공벡터를 형질주입한 세포주를 대조군으로 하였다.
To analyze the effect of GKN1 and GKN2 on cell proliferation, BrdU (bromodeoxyuridine) fusion analysis was performed. After 24, 28, and 72 hours of transfection, the cells were analyzed with a BrdU cell proliferation assay kit (Millipore, Billerica, MA, USA) according to the manufacturer's method. Absorbance was measured at 450 nm using a spectrophotometer. The transfected cell line was used as a control.

1-4. 군락 형성 분석1-4. Cluster formation analysis

시험관 내에서 단일 세포의 증식 능력을 측정하기 위하여 플레이트 상의 군락 형성을 분석하였다. 이를 위하여 형질 주입된 AGS 세포 1×103을 6-well 플레이트에 분주하고 RPMI 1640 배지에서 2주간 배양하며 군락 형성을 분석하였다. 군락들은 1% 포름알데히드로 고정하고, 0.5% 크리스탈 바이올렛 용액으로 염색한 후 군락 측정 프로그램을 이용하여 측정하였다.
In order to measure the proliferative ability of a single cell in vitro, colonization on the plate was analyzed. For this, 1 × 10 3 transfected AGS cells were seeded in 6-well plates and cultured in RPMI 1640 medium for 2 weeks. The colonies were fixed with 1% formaldehyde, stained with 0.5% crystal violet solution, and then measured using a community measurement program.

상기와 같은 실험 결과, GKN1을 단독으로 형질 주입한 AGS 세포주의 경우 세포 생존, 세포 증식이 시간이 경과함에 따라 현저히 감소하였으나, GKN2를 단독으로 형질 주입한 AGS 세포주는 세포 생존과 증식에 어떠한 영향을 나타내지 않는 것으로 확인되었다. 또한, GKN1과 GKN2를 모두 형질 주입한 AGS 세포주의 경우 GKN1이 세포 생존과 증식에 미치는 영향을 GKN2이 저해하는 것으로 나타났다(도 1A, 1B 참조). 군락 형성 분석에서도 GKN1의 단독 발현의 경우 AGS 세포의 군락 형성 수와 크기를 현저히 감소시키는 것으로 나타났으나, GKN2를 GKN1과 함께 형질 전환한 경우 GKN1의 군락 형성 감소 효과는 억제되는 것으로 확인되었다(도 1C 참조).
As a result of the above experiment, the AGS cell line transfected with GKN1 alone significantly decreased cell survival and cell proliferation over time. However, the AGS cell line transfected with GKN2 alone had no effect on cell survival and proliferation Respectively. In addition, GKN2 inhibited the effect of GKN1 on cell survival and proliferation in AGS cell lines transfected with both GKN1 and GKN2 (see FIGS. 1A and 1B). In the case of GKN1 alone, the expression of GKN1 was decreased in the number and size of the AGS cells. However, when the GKN2 was transformed with GKN1, 1C).

1-5. 세포사멸 분석1-5. Cell death analysis

GKN1은 위암 세포의 세포사멸 효과가 있는 것으로 알려져 있다. 이에 본 발명자들은 GKN2가 GKN1의 위암 세포 세포사멸에 어떠한 영향을 미치는지 알아보고자 하였다. 세포사멸은 Annexin-V를 이용하여 확인하였는데, Annexin V는 세포에 결합하여 세포막의 포스파티딜세린을 염색하고, PI(propidium iodide)는 손상된 세포막과 함께 세포의 DNA를 염색하는 기능을 한다. Annexin-V 염색은 제조자(BD Biosciences, San Jose, CA, USA) 방식에 따라 실시하였다.GKN1 is known to have apoptotic effects on gastric cancer cells. Therefore, the present inventors investigated how GKN2 affects GKN1 cell death in gastric cancer cells. The cell death was confirmed by Annexin-V. Annexin V binds to cells to stain phosphatidylserine, and PI (propidium iodide) functions to stain DNA of cells with damaged cell membrane. Annexin-V staining was performed according to the manufacturer (BD Biosciences, San Jose, CA, USA).

Annexin-V 염색을 위하여 상기 형질주입된 AGS 세포주를 PBS로 2번 세척하고, 100의 결합 버퍼에서 재현탁하였다. 이 후 100의 상층액을 400의 블라킹 용액과 혼합하고, 1/ml 농도의 Annexin V-FITC 5, 2/ml 농도의 PI 5를 상기 혼합한 용액에 첨가하여 암실 조건에서 15분간 반응시킨 후, 형광 활성화 세포 분류기(BD Biosciences)를 이용하여 분석하였다. PI 염색 없이 형광 양성인 세포만을 세포사멸하는 세포로 취급하였다. For the Annexin-V staining, the transfected AGS cell line was washed twice with PBS and resuspended in 100 binding buffers. Then, 100 supernatants were mixed with 400 blaking solutions, Annexin V-FITC 5 at a concentration of 1 / ml, PI 5 at a concentration of 2 / ml was added to the mixed solution, and the mixture was allowed to react for 15 minutes in a dark room , And fluorescence activated cell sorter (BD Biosciences). Only cells that were fluorescently positive without PI staining were treated as apoptotic cells.

한편, 본 발명자들은 caspase-3와 -7의 활성을 Apo-One Homogeneous Caspase 3/7 분석 키트(Promega Corporation, Madison, WI, USA)를 사용하여 제조자 방식에 따라 수행하였다. Meanwhile, the present inventors performed the activity of caspase-3 and -7 using the Apo-One Homogeneous Caspase 3/7 assay kit (Promega Corporation, Madison, WI, USA) according to the manufacturer's method.

또한, 세포사멸과 연관된 단백질의 발현을 웨스턴 블라팅을 이용하여 분석하였다. 이를 위하여, GKN1 또는 GKN2를 형질주입한 AGS 세포를 용해시킨 후 10% 폴리아크릴아미드 겔로 분리하고 Hybond PVDF 멤브레인(Amersham Pharmacia Biotech, Piscataway, NJ, USA)으로 전기영동 하였다. 이 후 멤브레인을 블라킹하고, 세포사멸과 관련된 단백질에 대한 항체와 반응시켰다. caspase-8 항체(Santa Cruz Biotechnology, Santa Cruz, CA, USA), caspase-3 항체, cleaved caspase-3 항체, PARP 항체, cleaved PARP 항체(Cell Signaling, Danvers, MA, USA) 및 GAPDH 항체(Abcam, Cambridge, UK), mouse IgG 항체, rabbit IgG 항체(Sigma) 및 ECL plus Western blotting detection system (Amersham Pharmacia Biotech, Piscataway, NJ, USA)을 이용하였고, 웨스턴 브라팅 밴드 강도는 LAS 3000 (Fuji Film, Japan)으로 정량화하였다.
In addition, expression of proteins associated with apoptosis was analyzed using Western blotting. For this, AGS cells transfected with GKN1 or GKN2 were lysed and separated into 10% polyacrylamide gels and electrophoresed on Hybond PVDF membrane (Amersham Pharmacia Biotech, Piscataway, NJ, USA). The membranes were then blaked and reacted with antibodies against proteins associated with apoptosis. (CAP), caspase-3 antibody, cleaved caspase-3 antibody, PARP antibody, cleaved PARP antibody (Cell Signaling, Danvers, MA, USA) and GAPDH antibody (Abcam, Western blotting detection system (Amersham Pharmacia Biotech, Piscataway, NJ, USA) was used, and the Western blotting band intensity was measured using LAS 3000 (Fuji Film, Japan, USA), mouse IgG antibody, rabbit IgG antibody ).

그 결과, GKN1을 형질주입한 AGS 세포주에서 세포사멸을 나타내는 세포의 수와 caspase3/7 활성이 현저히 증가한 것으로 나타났다. 그러나, GKN2를 단독으로 형질주입하거나 GKN2와 GKN1을 함께 형질주입한 AGS 세포주는 세포사멸이 유도되지 않았고, caspase-3/7 활성도 관찰되지 않았다(도 2A, 2B 참조). 또한, GKN1 형질주입된 세포에서 caspase-8, caspase-3, PARP의 절단된 형태가 확인되었으나, GKN2를 단독으로 형질주입하거나 GKN2와 GKN1을 함께 형질주입한 세포에서는 이러한 변화가 관찰되지 않았다. As a result, the number of cells showing apoptosis and caspase 3/7 activity were significantly increased in AGS cell line transfected with GKN1. However, AGS cell line transfected with GKN2 alone or transfected with GKN2 and GKN1 did not induce apoptosis, and caspase-3/7 activity was not observed (see FIGS. 2A and 2B). In addition, cleaved forms of caspase-8, caspase-3 and PARP were observed in GKN1-transfected cells, but these changes were not observed in cells transfected with GKN2 alone or transfected with GKN2 and GKN1.

이와 같은 결과를 종합하여 볼 때, 본 발명자들은 세포 생존, 세포 증식 및 세포 사멸과 관련한 GKN1의 활성을 GKN2가 저해하는 효과를 가지고 있음을 확인하였다.
Taken together with these results, the present inventors confirmed that GKN2 has an inhibitory effect on GKN1 activity related to cell survival, cell proliferation and apoptosis.

<실시예 2>&Lt; Example 2 >

GKN2가 GKN1에 의해 유도된 G2/M arrest에 미치는 영향 분석Effects of GKN2 on G2 / M arrest induced by GKN1

GKN2가 GKN1에 의해 유도된 G2/M arrest에 미치는 영향을 분석하기 위하여, 유세포 분석을 실시하였다. 세포 주기 분석을 위해 상기 실시예 1-1에서 형질주입된 AGS 세포를 모아 암실 조건에서 45분간 PI 염색하였다. 세포 주기상의 각 상태에 따른 세포의 비율을 FACSCalibur Flow Cytometer with CellQuest 3.0 software (BD Biosciences)로 측정하였으며, 실험은 3번 반복 실시하였다. In order to analyze the effect of GKN2 on G2 / M arrest induced by GKN1, flow cytometry analysis was performed. For cell cycle analysis, the AGS cells transfected in the above Example 1-1 were collected and stained for PI for 45 minutes in a dark room. The ratio of cells according to each state in the cell cycle was measured with FACSCalibur Flow Cytometer with CellQuest 3.0 software (BD Biosciences), and the experiment was repeated three times.

그 결과, GKN1은 G2/M 상태에 있는 세포 수를 현저히 증가시키는 것으로 나타났으나, GKN2 자체는 세포 주기에 어떠한 영향도 미치지 않는 것으로 나타났다. 한편, GKN1과 GKN2를 함께 형질주입한 세포에서는 GKN2가 GKN1에 의해 유도된 G2/M arrest를 효과적으로 저해하는 것으로 확인되었다(도 3 참조).
As a result, GKN1 was shown to significantly increase the number of cells in the G2 / M state, but GKN2 itself had no effect on the cell cycle. On the other hand, it was confirmed that GKN2 effectively inhibited GKN1-induced G2 / M arrest in cells transfected with GKN1 and GKN2 (see FIG. 3).

이에 본 발명자들은 GKN1과 GKN2가 세포 주기를 조절하는데 어떠한 영향을 미치는지 좀 더 명확히 하고자, G0/G1 상태의 단백질인 p53, p21, p16, CDK4 및 cyclin D1의 발현양과 G2/M 상태의 단백질인 cdc2, cdc25c, cyclin B 및 cyclin E의 발현양을 GKN1, GKN2 또는 GKN1 및 GKN2 형질주입한 후 24, 48 시간 경과한 AGS 세포주에서 관찰하였다. 이를 위하여 상기 실시예 1-5에 기재된 웨스턴 블라팅 방법으로 실험하였는데, 이때 사용된 p53 항체 및 p21 항체는 Santa Cruz Biotechnology에서 구입하여 사용하였고, p16 항체, CDK4 항체, cyclin D1 항체, cdc2 항체, cdc25c 항체, cyclin B 항체 및 cyclin E 항체는 Cell Signaling에서 구입하여 사용하였다. 또한, 단백질 밴드는 ECL 시약(Amersham Pharmacia Biotech)으로 가시화하였다.Therefore, in order to clarify the effect of GKN1 and GKN2 on the regulation of cell cycle, the inventors of the present invention examined the expression levels of p53, p21, p16, CDK4 and cyclin D1 in the G0 / G1 state and cdc2 , cdc25c, cyclin B and cyclin E were observed in AGS cell lines 24, 48 hours after GKN1, GKN2 or GKN1 and GKN2 transfection, respectively. The p53 antibody and the p21 antibody were purchased from Santa Cruz Biotechnology, and the p16 antibody, CDK4 antibody, cyclin D1 antibody, cdc2 antibody, cdc25c Antibodies, cyclin B and cyclin E antibodies were purchased from Cell Signaling. Protein bands were also visualized with ECL reagent (Amersham Pharmacia Biotech).

그 결과, G2/M arrest와 관련하여 GKN1은 CDK4, p-cdc2, cdc25c, cyclin A와 cyclin B의 발현은 하향 조절하였고, p53, p21 및 p16의 발현은 상향 조절하였다. 한편, GKN2는 세포 주기와 관련된 상기 단백질의 발현에 별다른 영향을 미치지 않았다. 그러나, GKN2와 GKN1을 함께 형질주입한 AGS 세포주에서는 GKN1에 의한 G0/G1 및 G2/M과 관련된 세포 주기 조절자들의 발현 변화를 GKN2가 효과적으로 저해하는 것으로 확인되었다(도 3B 참조). 즉, GKN2 단독으로는 세포 주기가 세포 사멸에 어떠한 직접적인 영향을 미치지 아니하였으나, GKN2는 위암 세포주에서 GKN1의 항증식 활성을 억제하고 세포사멸을 저해하는 것을 알 수 있었다.
As a result, GKN1 regulated the expression of CDK4, p-cdc2, cdc25c, cyclin A and cyclin B and regulated the expression of p53, p21 and p16 in relation to G2 / M arrest. On the other hand, GKN2 did not significantly affect the expression of the protein in relation to the cell cycle. However, it has been found that GKN2 effectively inhibits GKN1-induced changes in the expression of G0 / G1 and G2 / M-related cell cycle regulators in AGS cell lines transfected with GKN2 and GKN1 (see FIG. 3B). In other words, although GKN2 alone did not directly affect cell death, GKN2 inhibited the antiproliferative activity of GKN1 and inhibited apoptosis in gastric cancer cell lines.

<실시예 3>&Lt; Example 3 >

GKN2가 GKN1에 의해 유도된 miR-185 발현 및 DNMT1, EZH2 발현에 미치는 영향Effects of GKN2 on GKN1-induced miR-185 expression and DNMT1 and EZH2 expression

GKN1은 miR-185의 발현 유도 및 DNMT1, EZH2 발현을 저해하는 것으로 알려져 있다. 이에 본 발명자들은 GKN2가 GKN1의 이러한 발현 유도에 어떠한 영향을 미치는지 확인해 보고자 하였다.GKN1 is known to inhibit miR-185 expression and DNMT1 and EZH2 expression. Therefore, the present inventors tried to confirm how GKN2 affects the induction of GKN1 expression.

이를 위하여 본 발명자들은 GKN1, GKN2, GKN1 및 GKN2가 각각 형질주입된 AGS 위암 세포주에서 miR-185 발현이 어떻게 변화하는 Q-PCR을 이용하여 정량분석하였다. 이 경우, 인간 U6 mRNA 를 대조군으로 사용하였다. 데이터는 2-CTmethod에 기초한 internal calibrator로 상대적인 양을 기록하였다. PCR에 사용된 프라이머는 하기 표 1에 기재된 바와 같다.
For this purpose, we quantitatively analyzed the expression of miR-185 in AGS gastric cancer cell lines transfected with GKN1, GKN2, GKN1 and GKN2, respectively, using Q-PCR. In this case, human U6 mRNA was used as a control. The data were recorded relative to an internal calibrator based on the 2- CT method. The primers used in the PCR are as shown in Table 1 below.

PrimerPrimer NameName SequenceSequence (5'→3')(5 '- &gt; 3') GKN1GKN1 F: CTTCGGGGTACCATGCTTGCCTACTCCTCTGTCCAC
R: GTTGCCCTCGAGTTAGTTCTCCACCGTGTCTCCACA
F: CTTCGGGGTACCATGCTTGCCTACTCCTCTGTCCAC
R: GTTGCCCTCGAGTTAGTTCTCCACCGTGTCTCCACA
shGKN1shGKN1 GCCCAAACAAAGTCGATGAC   GCCCAAACAAAGTCGATGAC GKN2GKN2 F: CTTCGGGGTACCATGCTTGCCTACTCCTCTGTCCAC
R: GTTGCCCTCGAGTTAGTTCTCCACCGTGTCTCCACA
F: CTTCGGGGTACCATGCTTGCCTACTCCTCTGTCCAC
R: GTTGCCCTCGAGTTAGTTCTCCACCGTGTCTCCACA
GAPDHGAPDH F: AAATCAAGTGGGGCGATGCTG
R: GCAGAGATGATGACCCTTTTG
F: AAATCAAGTGGGGCGATGCTG
R: GCAGAGATGATGACCCTTTTG
miR-185_RTmiR-185_RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACG ACTCAGGAA   GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACG ACTCAGGAA miR-185miR-185 F: CAATGGAGAGAAAGGCAGTTCC
R: AATCCATGAGAGATCCCTACCG
F: CAATGGAGAGAAAGGCAGTTCC
R: AATCCATGAGAGATCCCTACCG
U6U6 F: ATTGGAACGATACAGAGAAGATT
R: GGAACGCTTCACGAATTT
F: ATTGGAACGATACAGAGAAGATT
R: GGAACGCTTCACGAATTT

실험 결과, GKN1을 형질주입한 AGS 세포주에서는 miR-185의 양이 현저히 증가하였으나, GKN2를 형질주입한 AGS 세포에서는 miR-185의 양에 어떠한 변화도 관찰되지 않았다. 한편, GKN2와 GKN1을 함께 형질주입한 경우 GKN2는 GKN1에 의해 유도된 miR-185의 발현을 완전히 하향 조절하는 것으로 나타났다(도 4A 참조). As a result, the amount of miR-185 was significantly increased in the AGS cell line transfected with GKN1, but the amount of miR-185 was not observed in the AGS cell transfected with GKN2. On the other hand, when both GKN2 and GKN1 were transfected, GKN2 completely down-regulated the expression of GKN1-induced miR-185 (see FIG. 4A).

GKN1은 c-Myc에 결합하여 c-Myc의 발현을 감소시키고 miR-185의 발현을 증가시키는 것으로 알려져 있는데, 본 발명자들은 GKN2을 형질주입한 세포주에서 c-Myc의 발현에는 별다른 차이가 없음을 확인하였고, 다만 GKN2는 GKN1에 의해 유도된 c-Myc의 발현 억제를 저해하는 것을 확인하였다(도 4B 참조).
It is known that GKN1 binds to c-Myc and decreases the expression of c-Myc and increases the expression of miR-185. The present inventors confirmed that there is no difference in the expression of c-Myc in GKN2 transfected cell lines , But GKN2 inhibited GKN1-induced inhibition of c-Myc expression (see FIG. 4B).

한편, 본 발명자들은 GKN1에 의한 DNMT1 및 EZH2의 발현 변화에 미치는 GKN2의 영향을 확인하기 위하여 웨스턴 블라팅을 상기 실시예 1-5에 기재된 방법에 따라 실시하였다. DNMT1 항체 및 EZH2 항체는 BD Biosciences에서 구입하여 사용하였고, 단백질 밴드는 ECL 시약((Amersham Pharmacia Biotech)으로 가시화하였다.On the other hand, the present inventors performed Western blotting according to the method described in Example 1-5 to confirm the effect of GKN2 on changes in expression of DNMT1 and EZH2 by GKN1. DNMT1 and EZH2 antibodies were purchased from BD Biosciences and protein bands were visualized with ECL reagent (Amersham Pharmacia Biotech).

그 결과, GKN1은 DNMT1과 EZH2의 발현을 감소시켰으나, GKN2는 DNMT1 및 EZH2의 발현을 증가시키는 것으로 확인되었다. 한편, GKN2와 GKN1을 함께 형질주입한 AGS 세포에서는 GKN2가 GKN1에 의한 DNMT1 및 EZH2의 발현 감소를 억제하는 것으로 나타났다(도 4B 참조).
As a result, GKN1 reduced the expression of DNMT1 and EZH2, but GKN2 increased the expression of DNMT1 and EZH2. On the other hand, in AGS cells transfected with GKN2 and GKN1, GKN2 inhibited the decrease of expression of DNMT1 and EZH2 by GKN1 (see FIG. 4B).

<< 실시예Example 4> 4>

정상 위 점막에서의 In the normal gastric mucosa GKN1GKN1 , , GKN2GKN2  And CagACagA 발현 분석 Expression analysis

정상 위 점막에서 GKN1, GKN2 및 헬리코박터 파이로리균 CagA의 발현 양상을 50개의 비종양성 위 점막 조직에서 웨스턴 블라팅의 방법으로 분석하였다. 상기 조직들은 우선 액체 질소에서 절구와 절구공이를 이용하여 고운 파우더 형태로 준비한 후, 1 x 단백질 저해제 혼합물 (Roche)이 첨가된 차가운 Nonidet P-40 용해 버퍼로 현탁시키고 , 12% 폴리아크릴아미드 겔을 이용하여 상기 실시예 1-5에 기재된 방식에 따라 웨스턴 블라팅하였다. GKN1 단일항원 항체(Sigma-Aldrich), GKN2 단일클론 항체(Abcam), CagA 항체 (Santa Cruz) 및 GAPDH 항체(Abcam)와 같은 1차 항체를 사용하였으며, 항-마우스, 항-래빗, 서양고추냉이 과산화효소(horseradish peroxidase)가 결합된 항-마우스 IgG를 2차 항체로 사용하였다. 본 실험은 한국의 가톨릭대학교 의과대학(CUMC09U089)의 기관감사위원회의 승인 하에 진행되었고, 본 실험에 사용된 샘플을 채취한 환자는 모두 가족력이 없는 것으로 확인되었다.Expression patterns of GKN1, GKN2 and H. pylori CagA in normal gastric mucosa were analyzed by Western blotting in 50 non - naturopous gastric mucosal tissues. The tissues were first prepared in the form of a fine powder using a mortar and a mortar in liquid nitrogen, suspended in a cold Nonidet P-40 dissolution buffer containing 1 x protein inhibitor mixture (Roche), and 12% polyacrylamide gel Western blotting was performed according to the method described in Example 1-5. Primary antibodies such as GKN1 monoclonal antibody (Sigma-Aldrich), GKN2 monoclonal antibody (Abcam), CagA antibody (Santa Cruz) and GAPDH antibody (Abcam) were used and anti-mouse, anti-rabbit, Anti-mouse IgG conjugated with horseradish peroxidase was used as the secondary antibody. This study was conducted under the approval of the Institutional Audit Committee of the Catholic University of Korea (CUMC09U089) in Korea and it was confirmed that all the patients who took the samples used in this experiment had no family history.

한편, mRNA 정량 분석을 위하여 동결된 50개의 비종양 위 점막 샘플로부터 추출된 mRNA를 정량한 후, cDNA를 Roche Molecular System (Roche, Mannheim, Germany)의 제조자 방식에 따라 역전사 키트를 사용하여 합성하였다. 한편, cDNA 50 ng을 Fullvelocity SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA, USA)와 20 pM/의 순방향 및 역방향 프라이머와 혼합한 후, Stratagene Mix 3000P Q-PCR system을 이용하여 Q-PCR 분석하였다. 본 실험에 사용된 프라이머는 상기 표 1에 기재하였다. 본 실험에서 SYBR Green 분석을 위한 프라이머는 유전자 특이적 비상동성 DNA 서열을 기초로 디자인하였다. 유전자 발현양의 정량 분석을 위하여 스탠다드 커브 방법을 이용하였으며, 2회 실험을 통한 평균값을 나타내었다. Meanwhile, mRNA extracted from 50 non-tumor gastric mucosa samples frozen for quantitative analysis of mRNA was quantitated and cDNA was synthesized using a reverse kits according to the manufacturer's method of Roche Molecular System (Roche, Mannheim, Germany). On the other hand, 50 ng of cDNA was mixed with forward and reverse primers of 20 pM / and full-rate SYBR Green QPCR Master Mix (Stratagene, La Jolla, Calif., USA), followed by Q-PCR analysis using Stratagene Mix 3000P Q- Respectively. The primers used in this experiment are shown in Table 1 above. In this experiment, primers for SYBR Green analysis were designed based on gene-specific, non-homologous DNA sequences. Standard curve method was used for quantitative analysis of gene expression level and the average value was shown through two experiments.

그 결과, GKN1과 GKN2의 발현은 50개의 비종양 위점막 조직 샘플 중 각각 47(94%)개 및 48(96%)개의 샘플에서 확인되었다. 그러나 헬리코박터 파이로리균의 CagA의 경우는 25(50%)개의 조직에서만 확인되었고, GKN2가 발현되는 48개의 위 점막 조직 샘플 중 24(50%)개의 샘플에서 확인되었다(표 2 참조). 이를 통계적으로 분석하면 GKN1과 GKN2의 발현은 밀접한 상관관계가 있는 것으로 확인되었다(P=0.0074)(표 2 참조). 한편, GKN1 단백질의 발현 정도는 CagA가 발현된 위 점막 조직에서 현저히 낮은 것으로 확인되었으나(P=0.0013), GKN2 mRNA와 단백질 발현은 CagA 발현과 별다른 상관관계를 나타내지는 않는 것으로 확인되었다(P=0.3136 및 P=0.4668)(도 5B 참조). 이들 결과로부터 본 발명자들은 헬리코박터 파이로리균의 CagA가 GKN1의 발현의 조절에는 연관이 있으나, GKN2의 발현에는 별다른 상관관계가 없는 것으로 판단하였다.
As a result, expression of GKN1 and GKN2 was confirmed in 47 (94%) and 48 (96%) samples, respectively, of 50 non-tumor gastric mucosal tissue samples. However, CagA of Helicobacter pylori was identified only in 25 (50%) tissues and was found in 24 (50%) samples of 48 gastric mucosal tissues expressing GKN2 (see Table 2). Statistical analysis showed that there was a close correlation between GKN1 and GKN2 expression (P = 0.0074) (see Table 2). On the other hand, the expression level of GKN1 protein was found to be significantly lower in gastric mucosal tissues expressing CagA (P = 0.0013), but GKN2 mRNA and protein expression did not show any significant correlation with CagA expression (P = 0.3136 And P = 0.4668) (see FIG. 5B). From these results, we have determined that CagA of Helicobacter pylori is involved in the regulation of GKN1 expression but not in the expression of GKN2.


GKN2GKN2 P P valuevalue
++ -- GKN1GKN1 ++ 4646 1One 0.00740.0074 -- 22 1One CagACagA ++ 2424 1One 1One -- 2424 1One

<< 실시예Example 5> 5>

GKN1GKN1 this GKN2GKN2 발현에 미치는 영향 분석 Analysis of effects on expression

상기 실시 예들을 통하여 GKN2가 GKN1의 활성에 영향을 미치는 것을 확인하였는데, GKN1이 GKN2의 발현에 미치는 영향을 분석하기 위하여 형질주입한 AGS 세포의 시간 변화에 따른 발현양 변화를 real-time RT-PCR과 웨스턴 블라팅으로 관찰하였다. GKN2 유전자 발현은 KATO-III 위암 세포주에서 NF-B의 p50 및 p65 서브유닛에 의해 현저히 감소되고, NF-B 특이적 저해제인 IB는 GKN2의 발현을 증가시킨다는 연구 결과에 기초하여 본 발명자들은 GKN1에 의한 GKN2 발현 조절이 NF-B 경로를 불활성화시킴으로써 이루어지는지 확인해 보았다. In order to analyze the effect of GKN2 on the expression of GKN2, the expression level of the transfected AGS cells was measured by real-time RT-PCR And western blotting. Based on the findings that GKN2 gene expression is markedly reduced by p50 and p65 subunits of NF-B in KATO-III gastric cancer cell lines and that IB, an NF-B specific inhibitor, increases GKN2 expression. And the expression of GKN2 was induced by inactivation of the NF-B pathway.

이를 위하여, 본 발명자들은 p-p65, p65 및 IB의 발현에 TNF-a와 GKN1이 미치는 영향을 비교하고, 이들이 HFE-145 세포 및 AGS 세포에서 GKN2에 어떠한 영향을 미치는지 real-time RT-PCR과 웨스턴 블라팅으로 관찰하였다. real-time RT-PCR을 위하여, HFE-145 및 AGS 세포주에 GKN1 또는 shGKN1을 형질주입하고 TNF-a를 처리한 후 mRNA 발현양 변화를 관찰하였다. real-time RT-PCR은 SYBR Green Q-PCR Master Mix (Stratagene, La Jolla, CA, USA)를 이용하여 제조자 방식에 따라 실시하였다. GKN2 mRNA 발현은 SYBR Green Q-PCR로 정량화하고 이를 GAPDH로 정상화하였다. 본 실험에 사용된 프라이머는 상기 표 1에 도시되었고, 웨스턴 블라팅에는 p-p65 (Cell Signaling Technology)와 p65 and IB(Santa Cruz Biotech) 항체를 사용하였다.To this end, we compared the effects of TNF-a and GKN1 on the expression of p-p65, p65 and IB and examined the effect of GKN2 on HFE-145 cells and AGS cells using real-time RT-PCR And observed with Western blotting. For real-time RT-PCR, HFE-145 and AGS cell lines were transfected with GKN1 or shGKN1 and TNF-a treatment was performed. Real-time RT-PCR was performed using SYBR Green Q-PCR Master Mix (Stratagene, La Jolla, CA, USA) according to the manufacturer's protocol. GKN2 mRNA expression was quantitated by SYBR Green Q-PCR and normalized by GAPDH. The primers used in this experiment are shown in Table 1, and p-p65 (Cell Signaling Technology) and p65 and IB (Santa Cruz Biotech) antibodies were used for Western blotting.

그 결과, GKN1의 발현 증가는 GKN2의 mRNA와 단백질 발현을 시간 의존적으로 증가시키는 것으로 나타났다(도 6A, 6B 참조). GKN1에 의한 GKN2의 발현 조절을 명확히 하고자 AGS 세포에서 p-p65, p65 및 IB의 발현에 TNF-a와 GKN1이 미치는 영향을 확인해 본 결과, TNF-a는 p-p65와 p65 의 발현을 증가시키고, IB의 발현을 감소시키고, GKN1의 발현은 p-p65와 p65 의 발현을 감소시키고, IB의 발현을 증가시키는 것으로 나타났다. 또한, HFE-145 세포주에서 shGKN1에 의해 저해된 GKN1의 발현은 감소된 p-p65 및 p65의 발현을 증가시키고, 증가된 IB의 발현은 감소시키는 것을 확인할 수 있었다(도 6E 참조).As a result, an increase in the expression of GKN1 showed a time-dependent increase in mRNA and protein expression of GKN2 (see FIGS. 6A and 6B). In order to clarify the regulation of GKN2 expression by GKN1, we examined the effect of TNF-a and GKN1 on the expression of p-p65, p65 and IB in AGS cells. As a result, TNF-a increased the expression of p-p65 and p65 , Decreased the expression of IB, and the expression of GKN1 decreased the expression of p-p65 and p65 and increased the expression of IB. In addition, it was confirmed that expression of GKN1 inhibited by shGKN1 in the HFE-145 cell line increased expression of reduced p-p65 and p65 and decreased expression of IB (see Fig. 6E).

한편, 본 발명자들은 GKN1 및 TNF-a가 GKN2의 mRNA 및 단백질 발현에 미치는 영향을 확인하였다. 그 결과, HFE-145 및 AGS 세포주 모두에서 TNF-a가 GKN2의 발현을 감소시키는 것을 확인하였고, 이와 반대로 GKN1은 AGS 세포에서 GKN2의 발현을 증가시키는 것으로 확인되었다(도 6C 참조). 그러나 HFE-145 세포주에서 GKN1을 silencing 한 결과, GKN2의 발현이 감소되는 것으로 확인되었다(도 6D 참조). 또한 GKN1 형질주입한 AGS 세포에 TNF-a를 처리한 경우 GKN2의 발현이 회복되는 것으로 확인되었다. 이들 결과들을 통하여 GKN1은 NF-B의 경로를 불활성화시키고 IB를 활성화시킴으로써 GKN2의 발현을 증가시키는 것을 알 수 있었다.
On the other hand, the present inventors confirmed the effect of GKN1 and TNF-a on mRNA and protein expression of GKN2. As a result, it was confirmed that TNF-a reduced the expression of GKN2 in both HFE-145 and AGS cell lines, and conversely, GKN1 increased the expression of GKN2 in AGS cells (see FIG. 6C). However, silencing of GKN1 in the HFE-145 cell line resulted in a decrease in the expression of GKN2 (see FIG. 6D). In addition, the expression of GKN2 was restored when TNF-a was treated with AGS cells injected with GKN1. These results indicate that GKN1 inactivates NF-B pathway and activates IB to increase GKN2 expression.

<< 실시예Example 6>  6>

면역조직화학적 분석에 의한 위암 세포주에서의 Immunohistochemical analysis of gastric cancer cell lines GKN1GKN1  And GKN2GKN2 의 발현 분석Expression analysis

면역조직화학적 분석을 위해, 포르말린 용액으로 고정한 후 파라핀 처리된 169개의 위암조직 샘플을 함유하도록 조직 마이크로어레이 수여부 블락을 설계하였다. 시판 마이크로어레이 기기(Beecher Instruments, Micro-Array Technologies, Silver Spring, MD, USA)를 이용하여 각 암 조직으로부터 직경 2mm로 3개의 조직 코어를 취해 새로운 수여부 파라핀 블락으로 옮기고, 각 종양 근처에 위치한 정상 위 점막의 조직 코어 하나도 수여부 블락으로 옮겼다. 모든 샘플은 사용 전 날 2 ?m 절편으로 절단하여 표준 프로토콜에 따라 보관해 두었다. 또한 면역조직화학 시그널을 최대화하기 위해서, 구연산염 버퍼에서 항원 회복하는 방법과 biotinylated tyramide로 시그널을 증폭하는 방법을 둘 다 사용하였는데, 구체적으로 열로 유발된 에피토프(epitope) 회복 방법은 10 mmol/L 구연산염 버퍼(pH 6.0)로 채운 Coplin 용기에 슬라이드를 담그고, 700W 전자 레인지안의 압력 쿠커(Nordic Ware, Minneapolis, MN, USA)에서 30분 동안 버퍼를 끓여 수행한 다음, Coplin 용기를 20분 동안 식혔다. 그리고 streptavidin-peroxidase와 biotinylated tyramide를 함유하는 Renaissance TSA Indirect Kit(NEN Life Science, Boston, A, USA)를 사용하였는데, 우선 슬라이드를 PBS로 헹군 다음, 내인성 페록시다아제(endogenous peroxidase) 활성을 제거하기 위해 PBS로 희석된 1% H2O2에 담가 실온에서 15분간 처리하였다. 그리고 슬라이드를 TNT 버퍼(0.1 mol/L Tris-HCl, pH 7.4, 0.15 mol/L NaCl, 0.05% Tween 20)로 20분간 세척한 다음, TNB 버퍼(0.1 mol/L Tris-HCl, pH 7.4, 0.15 mol/L NaCl, 0.5% blocking reagent)로 처리하였다. 이후 절편을 GKN1 항체(1/100; Sigma-Aldrich Co, St. Louis, MO, USA)와 함께 4에서 밤새 배양하고, biotinylated goat anti-mouse 항체(Sigma, St. Louis, MO, USA)를 이용하여 검출한 다음, 페록시다아제 연결된 아비딘-비오틴 복합체와 함께 배양하였다. 디아미노벤지딘을 색원체로 이용하였고, 슬라이드는 메이어 헤마토크실린 용액으로 대비 염색하였다. 항원 염색 결과 분석은 세포질의 30% 이상이 양성으로 염색되었을 때 양성이라고 간주하였으며, 두 명의 병리학자가 독립적으로 검토하였다. 음성 대조군으로, 일차 항체를 비면역성 혈청으로 대체한 것을 이용하였다. GKN2의 발현 양상을 이전의 GKN1 발현 데이터와 비교해 보았다. For immunohistochemical analysis, a tissue microarray receiving block was designed to contain 169 gastric cancer tissue samples that were fixed with formalin solution and then paraffin-treated. Three tissue cores of 2 mm in diameter were taken from each cancer tissue using a commercially available microarray instrument (Beecher Instruments, Micro-Array Technologies, Silver Spring, MD, USA) and transferred to a freshly received paraffin block. One of the tissue cores of the gastric mucosa was also transferred to the ingestion block. All samples were cut into 2-μm sections before use and stored according to standard protocols. In order to maximize the immunohistochemical signal, both the method of recovering the antigen in the citrate buffer and the method of amplifying the signal by the biotinylated tyramide were used. Specifically, the heat-induced epitope recovery method was performed using 10 mmol / L citrate buffer (pH 6.0), the buffer was boiled for 30 minutes in a pressure cooker (Nordic Ware, Minneapolis, MN, USA) in a 700 W microwave oven, and then the Coplin container was allowed to cool for 20 minutes. (NEN Life Science, Boston, A, USA) containing streptavidin-peroxidase and biotinylated tyramide. First, the slide was rinsed with PBS and then the endogenous peroxidase activity was removed In 1% H 2 O 2 diluted in PBS for 15 min at room temperature. The slides were washed with TNT buffer (0.1 mol / L Tris-HCl, pH 7.4, 0.15 mol / L NaCl, 0.05% Tween 20) for 20 minutes, mol / L NaCl, 0.5% blocking reagent). The sections were incubated overnight at 4 ° C with GKN1 antibody (1/100; Sigma-Aldrich Co, St. Louis, Mo., USA) and incubated with biotinylated goat anti-mouse antibody (Sigma, St. Louis, Mo., USA) And then incubated with the peroxidase-linked avidin-biotin complex. Diaminobenzidine was used as a coloring material, and the slide was subjected to contrast dyeing with a Meyer hematocillin solution. Antigen staining analysis was positive when more than 30% of cytoplasm was stained positive, and two pathologists examined independently. As a negative control, the primary antibody was replaced with a nonimmune serum. The expression pattern of GKN2 was compared with the expression data of the former GKN1.

그 결과, 위 점막 세포의 세포질에서 중간 이상의 강도를 나타내는 GKN2의 조직 염색이 명확하게 관찰되었다(도 7 참조). 한편, 169개의 위암 조직 샘플 중 상부 위암 12 (75%)예와 하부 위암 114 (74.5%) 예에서 GKN2 발현이 감소된 것으로 확인되었다. Lauren's 분류에 따르면, GKN2는 71개의 장형(intestinal type) 위암 중 11개 (15.5%)의 샘플에서 발현되었고, 98개의 미만형(diffused type)의 위암 중 32개 (32.7%)의 샘플에서 발현되었다(표 3 참조). 통계적으로 GKN2 단백질의 발현 변화와 종양의 위치, 크기, 림프절의 전이를 포함하는 임상 병리학적 척도와의 유의한 상관관계는 없는 것으로 나타났다(Chi-Square test, P>0.05, 표 3 참조). 그러나, GKN2의 발현 감소는 장형(intestinal type)의 위암에서 더 빈번한 것으로 확인되었다(P=0.0114). 이전 연구에서, GKN1의 발현 감소는 169개의 위암 조직 샘플 중 151개(89.3%) 샘플에서 확인되었다. GKN2와 GKN1의 발현 양상을 비교하였을 때, GKN1 및 GKN2 단백질 모두가 염색되지 않은 경우는 119개(70.4%) 예로 GKN1과 GKN2의 발현은 매우 긴밀한 상관관계를 갖는 것으로 나타났다(P=0.0002, 표 3 참조).
As a result, tissue staining of GKN2 showing a moderate-to-moderate intensity in the cytoplasm of gastric mucosal cells was clearly observed (see FIG. 7). On the other hand, GKN2 expression was decreased in 169 gastric cancer tissue samples from upper gastric cancer 12 (75%) and lower gastric cancer 114 (74.5%). According to Lauren's classification, GKN2 was expressed in 11 of 15 (15.5%) of 71 intestinal type gastric cancers and was expressed in 32 of 32 (32.7%) of 98 diffuse type gastric cancers (See Table 3). Statistically, there was no significant correlation between the expression of GKN2 protein and clinicopathological parameters including tumor location, size, and lymph node metastasis (Chi-Square test, P> 0.05, Table 3). However, decreased expression of GKN2 was found to be more frequent in intestinal type gastric cancer (P = 0.0114). In previous studies, decreased expression of GKN1 was found in 151 (89.3%) samples of 169 gastric cancer tissue samples. When GKN2 and GKN1 expression patterns were compared, expression of GKN1 and GKN2 was highly correlated with 119 (70.4%) cases in which neither GKN1 nor GKN2 was stained (P = 0.0002, Table 3 Reference).

ParametersParameters
GKN2GKN2 proteinprotein expressionexpression
++ -- P-value P -value Tumor location Tumor location 0.96430.9643 Upper    Upper 44 1212 Lower    Lower 3939 114114 Size Size 0.68270.6827 <6.5 cm    <6.5 cm 2121 5757 >6.5 cm    > 6.5 cm 2222 6969 No. of metastatic L/N* No. of metastatic L / N * 0.66430.6643 N0 (=0)    N0 (= 0) 00 44 N1 (1 ≤≥6)    N1 (1 &amp;le; 1515 4444 N2 (7≤≥ == 15)    N2 (7? =? = 15) 2626 7474 N3 (>15)    N3 (> 15) 22 44 Differentiation**Differentiation ** 0.01140.0114 Intestinal   Intestinal 1111 6060 Diffuse   Diffuse 3232 6666 GKN1 expression GKN1 expression 0.00020.0002 +   + 1111 77 -   - 3232 119119

* Lymph node , ** Lauren's classification
* Lymph node, ** Lauren's classification

통계분석Statistical analysis

세포 생존, 증식 및 세포사멸에 미치는 GKN1 및 GKN2의 효과는 students t-test로 실시하였다. 데이터는 3번의 독립적 실험 후 평균±표준편차로 표시하였다. GKN1, GKN2, CagA 발현양과 위암의 임상병리학 척도와의 관계는 Spearman correlation test 와 Chi-square test로 확인하였다. P<0.05인 경우에 한하여 통계적 유의성을 인정하였다.
The effects of GKN1 and GKN2 on cell survival, proliferation and apoptosis were assessed by students t-test. Data were presented as mean ± standard deviation after three independent experiments. The relationship between GKN1, GKN2, and CagA expression level and clinicopathological parameters of gastric cancer was confirmed by Spearman correlation test and Chi-square test. P <0.05 was considered statistically significant.

이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Catholic University <120> Anti-cancer supplement containing GKN2 <130> PN1309-304 <160> 5 <170> KopatentIn 2.0 <210> 1 <211> 184 <212> PRT <213> Artificial Sequence <220> <223> GKN2 amino acid sequence from homo sapiens <400> 1 Met Lys Ile Leu Val Ala Phe Leu Val Val Leu Thr Ile Phe Gly Ile 1 5 10 15 Gln Ser His Gly Tyr Glu Val Phe Asn Ile Ile Ser Pro Ser Asn Asn 20 25 30 Gly Gly Asn Val Gln Glu Thr Val Thr Ile Asp Asn Glu Lys Asn Thr 35 40 45 Ala Ile Ile Asn Ile His Ala Gly Ser Cys Ser Ser Thr Thr Ile Phe 50 55 60 Asp Tyr Lys His Gly Tyr Ile Ala Ser Arg Val Leu Ser Arg Arg Ala 65 70 75 80 Cys Phe Ile Leu Lys Met Asp His Gln Asn Ile Pro Pro Leu Asn Asn 85 90 95 Leu Gln Trp Tyr Ile Tyr Glu Lys Gln Ala Leu Asp Asn Met Phe Ser 100 105 110 Ser Lys Tyr Thr Trp Val Lys Tyr Asn Pro Leu Glu Ser Leu Ile Lys 115 120 125 Asp Val Asp Trp Phe Leu Leu Gly Ser Pro Ile Glu Lys Leu Cys Lys 130 135 140 His Ile Pro Leu Tyr Lys Gly Glu Val Val Glu Asn Thr His Asn Val 145 150 155 160 Gly Ala Gly Gly Cys Ala Lys Ala Gly Leu Leu Gly Ile Leu Gly Ile 165 170 175 Ser Ile Cys Ala Asp Ile His Val 180 <210> 2 <211> 555 <212> DNA <213> Artificial Sequence <220> <223> GKN2 cDNA sequence from homo sapiens <400> 2 atgaaaatac ttgtggcatt tctggtggtg ctgaccatct ttgggataca atctcatgga 60 tacgaggttt ttaacatcat cagcccaagc aacaatggtg gcaatgttca ggagacagtg 120 acaattgata atgaaaaaaa taccgccatc attaacatcc atgcaggatc atgctcttct 180 accacaattt ttgactataa acatggctac attgcatcca gggtgctctc ccgaagagcc 240 tgctttatcc tgaagatgga ccatcagaac atccctcctc tgaacaatct ccaatggtac 300 atctatgaga aacaggctct ggacaacatg ttctccagca aatacacctg ggtcaagtac 360 aaccctctgg agtctctgat caaagacgtg gattggttcc tgcttgggtc acccattgag 420 aaactctgca aacatatccc tttgtataag ggggaagtgg ttgaaaacac acataatgtc 480 ggtgctggag gctgtgcaaa ggctgggctc ctgggcatct tgggaatttc aatctgtgca 540 gacattcatg tttag 555 <210> 3 <211> 8939 <212> DNA <213> Artificial Sequence <220> <223> GKN2 polynucleotide sequence from homo sapiens <400> 3 aagaatttct taatactctg caagataact agaggtctct aacttacagt tttgtgcagt 60 tttgggcgaa gcttaatgta aaaatttggt taaacttggt aattggggag aatgctttct 120 gagtcttgtt cctcattaat ttctggaaat tgacaccaaa tctaaaggga agaacgaaga 180 aagtcctagg ctgtttgttc tccaagcagg cctccccagc cactgtcttg gcaccccgtc 240 tcatatccgt tccctctgtg gaagaattca gccagcagaa cagtggtgaa aagacattga 300 gttggggccc aactcaggcc ttaaggaagc actcttcctt taggaggaga tgttagaagt 360 ttgtccttgt agagctataa aatgtatgca tagaacaagc atcatgcaat atttttaaag 420 ggtggaaatt aaaatgtcaa gtgcagcata gtacaaatag cagggaatat ttacagagtg 480 accaagtggt gaattttcat tactgactaa tgaacttcat tgatatcagg tatgtggttg 540 gatctcaatt ctgataaagg agtttgctag ggtgtgtcag agatatagac atggtctttt 600 ccaaagtgat catttgaaaa agagatatcc acatcttcaa gcccatataa aggatagaag 660 ctgcacaggg cagctttact tactccagca ccttcctctc ccaggcaaaa tgaaaatact 720 tgtgagtatt tgtttctgct tcttgatact cttgtggtga ctgcttgcag acaatgctca 780 tatctaatat gccatggatt ttgggagtct tagacagata ctgtgcatgc ttctaagctt 840 ctgtgattga attaatgaca tctttggcag aaatagtgtt gaataagtct gacttttttt 900 gtccttttcc tgttttgaga tgtttactta aaagaaaatt caaaaataca aagaaatctc 960 tagataattt tgatttggag gatgtttaat aataatcctt tattatgagc ttcataggga 1020 atttgggcta tttaaaacaa ctacatttgc tatctaagag agaagctgta gtttaaaaat 1080 aatatcagta atagtaataa tagtacctct catttctcaa atgcatacta agccttagac 1140 taagcatatc acatgaataa tttcatctat tcattgcaac aaccctatga gttgagtagt 1200 attctccccg ttttacagat aaggagactg agaggcagag gaatgtgatt ttcccaagcc 1260 cgtaaatgtg ggatttagaa tgtaatttat ccatctgaat ccccacttgc aggcgcaatc 1320 atggcaaatt taagcagcca gagtgtcttc aatgtcctct cattatgact aaattctccc 1380 ttaggacaaa acgttccttc tatggccact ccacccctcc atctgatccc agcctccgta 1440 gttccacatt gcagtgcccc atggacagtg ggctatgttc tgacctagaa tggaattcgc 1500 tcccctagtc tctgtccttt attctcattc agctgctaag ggagaaagca aaatgttaag 1560 tacctctttc taaagtgtta aagactatca gcttaaagag ctccctctct cagggctgtc 1620 ttgattttcc aaattgagac ctaaccctga agcacaaaag tattatataa ccatggtgta 1680 ttaaccacag tgttggaagg gagatcattt tggggcagag gacactcccc aagctctctc 1740 taatcatacc attaaagtgg tttagtcctt cgactacttg ttcaaaccac tattttagac 1800 tcattaacta gaatatacgg gagtatcata tgttgctgga gctggtctgt ggtaagagaa 1860 gatgtatccc tatggaaggc tgaatatcag cacacaggtc tttgttagat gctctactcc 1920 cagtccccag aagagaaata ttaagggtgg gatggaaagg gaagtaggaa agtcccactg 1980 acagttctta aaaatatccc ccttccccaa gactcctttc atcagcagtt ttcaaatgac 2040 agtgcagtca actatgtact gatgtagttt tcagcgatag tacagttcac tgatgttcag 2100 aagagagggt acaaaacctg ggttagcatg ttggaacaga ctcttacaga actacagcaa 2160 aatatcagaa ctgcttcaat gtcagctcac gacctgtggg cccagcactt gtgtgatagt 2220 atcactaagg cataggagaa tatgggggtt ttacttgatg tcagcctcaa aagttaattg 2280 tgctcccaag cattctattt tcatagtttc ccttaggaac ctgtcaggtc tttatcaccc 2340 atgattcatt ttaaatctgt attaccctct cagtcttaag ggattaaagt tttttaaaat 2400 taattaatta attaattatt tttttagagg acacaatttg accactgtta tccaaagcta 2460 gtgtgaatca taccagagta tttccatagt gaaatgaatc cttcactgct catctgcccc 2520 gggtttctcc tactatctac atggttataa tgctagaaag agttgggaat taggtggcaa 2580 ttgtagcacc ctgtgtctgg caaatagaat gaactcaaca aatgcctgtt aaatgagcca 2640 atgtgtgagc caatcaatgt gtgcgtggaa agggagtgct gaccatctgt ggccactcag 2700 tgtctctagg tgtacatttt ctgagatatc tgtgcctttc ctgtccagtg tttcctcctg 2760 tcccacactc aatgactacc ctataaagaa tggatgtggt gggtctgttt ttcaggtggc 2820 atttctggtg gtgctgacca tctttgggat acaatctcat ggatacgagg tgagttggtt 2880 ccttatggac tttatctctt agagatgttg ggagaggaaa gggaaggtac aagagagcct 2940 gaagacagta gagaggccat atgccttatt tgggatggaa tctcagaaat aaccaataat 3000 ggaaataatg agcttggcta ttcctctcca accacaatac ctttgcaaat gtaagccatt 3060 gctttaaaat gtggtcagtc tcatttctct tgtgatatca ctgcttctcc catatataat 3120 atagtaaact ctaaggaaaa gctttgcctt cttatggcat cataagtttt tggattggga 3180 ccccagtgga cagttttagt ttttaatccc ttgttcatag caggcagctg ctttattttg 3240 ttggaagagt tgcctttcaa atatataaga tttatggaaa aacattttgt ctttcttttc 3300 aatctaggtt tttaacatca tcagcccaag caacaatggt ggcaatgttc aggagacagt 3360 gacaattgat aatgaaaaaa ataccgccat cattaacatc catgcaggat catgctcttc 3420 taccacaatt tttgactata aacatgtaag cagcaaatga attttcatat tcatcaggac 3480 tagtttgcta aagagcagag ggatctatat atatatgggg catatatact tgaattctta 3540 gacttaacct tgcaattctt taagaattcc tcactttcac ttttctcttt aaataatcaa 3600 gcaattggtt aaaaaaacaa aaccattttg aagaaaaaca tatgacagga aacatatgca 3660 tttgcttgac cttttcaggt agaaattgga agagtaatgc tattatccca ctacaggctc 3720 agaaagtgca aagaagagta accaaagtcc aaagcaaagc ccggcatgca gacactcaaa 3780 ctcatttgtt gagtgaacaa atgaatgaat agggcttcta acacagaaca tcatgcagaa 3840 aaagaacaat tggtcaggca cagtggctca tgcctgtaat cccagcactt tgggagtctg 3900 aggcgggagg atctcttgag cccaggagtt ggagactggc ctgggcaaca tggcagaatc 3960 ccatctctac caaaaataca aaaattagct gggtgtggtg gtgcgggcct gtggtcccac 4020 ctacttggga ggctgaggtg ggaggattgc tggagcccag gaagtcaagg ctgcagtgag 4080 ctgagactgc accactgcac tccagcctgg gtgacaaaac gagatcctgt ctcaaaaaaa 4140 taaataaata aataattaaa aaatataaaa taataaaaag aacaatcaca aagcaatcac 4200 aacatagcag aaatccagag caactataca catttaatta tgtacatagg gtaggcaaaa 4260 aatcatactt tttctgtaag aaagaaaatc tgctaactaa aagcactaaa ctattttcaa 4320 gtgttagata ctggcattaa caataagtca cagaaacctg ctcagaaaac atatccttca 4380 tcagttattt attcatttgt tttccatttc ttccaccaac gaattatgaa cctgcttcta 4440 cctaggttcc aagctatgca ctatggatat aagtaggttc ctgctcatct cactagactt 4500 ttgaacatga ttttctgtcc cttttcttct agaaatgtct tcacgttcct ctttcccatt 4560 ggtgttggca gttcaatcac acatttgaaa gtatagagtc attagaaaat gtggtttaaa 4620 aggaagtggc actgaaattg tttttaagca actgtcatgg aaatcccaaa actgtcttta 4680 aaaaaaaatg gagaagtgag gatttgcttt aagcttcttc cattatcacc aggctcagcc 4740 tctgtctatt ttttgaattt taggaactga caatttgtga gaattgaaaa ataagaacca 4800 gaaagatttc tattagatac agctttctag ggtatatcat tatttggaac tctgtagaga 4860 caattttcac tccaggtgaa gactcagtgg ccttaggtcc catctggccc cagggtcttc 4920 accctccatt gctctttcaa tcccacctta ttgcaaccca tccctctcca gccagcttgg 4980 gtttgagatg gagaagggat ggggaaaact ggagaggaag aaaagatggc aaatgagggg 5040 aggatagatg agacgtgtgt gagcgtgcat gagtgtgggt atgggtatgc ttatgagagc 5100 tcctaaagca gcactgtcta acagaacttt ctgcagcggt ggaagtgttc tagatttgaa 5160 tttccaatag ggaagccccc agccgcctgt ggttattgag tactcaaaat ttgtaacaga 5220 agtgcatttt aaattttacc taatttgaat ttaaatttag atagtggcat atagctaata 5280 actatcatat tggacagcac agtttttttt ttttgttttt tttttttgac ggagtctcgc 5340 tctgtcaccc aggctggagt ccagtggtgt gatcttggct cactgcaagc tccacctccc 5400 gggttcatgc cattctcctg cctcagcctc ccgagtagct gggactacag gtgcccgcca 5460 ccacgcccgg ctaaattttt tgtattttta gtagagacgg ggtttcacca tgttagccag 5520 gatggtctcg atctcctgac cttgtgatct gcccttctcg gcctcccaaa gtgctgggat 5580 tacaggtgtg agccactgca cctggccagg acagcacagt tctaaaaaat attctattta 5640 ccccaaactg gggaggaagc agaataaaat taatggaaag aagccagatg cagtagctta 5700 cacctctaat ctcagcactt tgggagctca aggtgggtgg atcacttgag atcaggagtt 5760 tgagaccagc ctggctaata tggtgaaact ccatctctac taaacataaa aaattagctg 5820 ttcatggtgg tgcacacctg tagtcccagc tactctggaa gctgaggcaa gagagttgct 5880 tgaaccaggg aggtggaggc ttcagtgagc tgaggttgca ccactgcact ccagcctggg 5940 caacagagtg agagtctgtc tcaaaaaaat aataataatg gtaataataa taataaaata 6000 atggaaagag acagagtagt gcttcttctc aatctttcaa acctcaaact gcagaccctg 6060 gttccatgac atgaaaagca gaatatagtc atgggtttgc acaatttcaa aggggtagaa 6120 atgacaagtg aaaaaatgaa aatgttatgt aaaataagtc aagtggataa agttgattgc 6180 agattggaga gcaatcccac catatattca ctgtgcatgt tcaagtcttt cttccgaggt 6240 tcaggcatca tcttcaccaa gttcagattc agggaactag ggaggaacag taactgtact 6300 cttgctgcct cagggctaca ttgcatccag ggtgctctcc cgaagagcct gctttatcct 6360 gaagatggac catcagaaca tccctcctct gaacaatctc caatggtaca tctatgagaa 6420 acaggtaatt ctggggcact cttgagtatt ctctgttctt aagccaggca atactggtat 6480 ttatggagaa atgaagagtg tgagggagaa gatcatacta tcatgcctta ccataaatgt 6540 gatactcaac ttattaaagt tattaaagtg tttttacttt tattttatta ttttttaaga 6600 gcaggagcaa atcttagctt gatttccacc atatagtcct aaatacaaga atttataata 6660 aattccagtg acattatagc aaggactgat cagcttctct tctcagagca gggctatgag 6720 aaatggtgac tggaacaata ataagagaag ttctaatatt caatgaccca aagatgcaaa 6780 gaaataatac agttgagtga acatatacaa acagtgcact gcggctagag acccaaggtt 6840 taagtctccc tccacaactt cttataggtg ctacctttga catgggactt actttctttg 6900 ggcttcattg ccaccagagg taaaataaca ctggtaatta ctaatgaggc tacttcacag 6960 atagagtgtt caaaaagaga tgatgtcttg agatccctaa gttctttcta tttaataatc 7020 tgaaagagaa aaattgtcac aatttagaat aaggtacacc aatttttgtc aatttatttt 7080 atgttgttct tttctgttat accgatctag gctctggaca acatgttctc cagcaaatac 7140 acctgggtca agtacaaccc tctggagtct ctgatcaaag acgtggattg gttcctgctt 7200 gggtcaccca ttgagaaact ctgcaaacat atccctttgt ataaggggga agtggttgaa 7260 aacacacgtg agtaccaata agtcattcac tcaccaaata ttttctgaaa gctactatgt 7320 gccaggtgct ctgttgggtg ccaagtgaaa tgcaaataaa tgggaacagt actcagttca 7380 gtttgctttg ggaattaatt acatgccatg tgtgtaaatt gtgctaaatt ttaggaatac 7440 agaaatgaat taaacgtctc cagggaacac atagtctagt gaagaagctg acaagtgaaa 7500 agagaggatg gagtaaagga tttctggatg ccaatgaaaa actactcgat tcttgtatac 7560 tttcatatgt aagaatttca agtagcaaaa agtcatctgg gcccttagaa tagcatattt 7620 tgaagataat aagaaggaag tcactaagaa atgctctcag gatctagaat agaattggta 7680 taggaaagag gaggccaagc ggacttacag acagggagta aaaaccctga ttcatctggg 7740 taacatatgc cactgcagat attactgtca tttttataca aagtttctaa atgtggcaga 7800 gcaaccagag tgaaagaggt cgggccaact gatgatgaac acaacaaagg aaatttctca 7860 gagtactgga aggtagataa agaagagttt atgtttatta tatatctact gcccagaaaa 7920 aaattttaag tactcattca taaagtaaat aaaggcacat aggtatgcca ttgacacaga 7980 atggcataat atcactggga ttgagccaac cagcacttcc aaaagttgtc agttttattt 8040 aagctaatgt attattattc taataattcc aataatatat tttttaatgc tctttctctg 8100 aaaaattttc ccttttccag ataatgtcgg tgctggaggc tgtgcaaagg ctgggctcct 8160 gggcatcttg ggaatttcaa tctgtgcaga cattcatgtt taggatgatt agccctcttg 8220 ttttatcttt tcaaagaaat acatccttgg tttacactca aaagtcaaat taaattcttt 8280 cccaatgccc caactaattt tgagattcag tcagaaaata taaatgctgt atttatagat 8340 tttttggtgt ttgttgtttt ttgtaagcag caaagggaat ccaagcaatg tctttgtcac 8400 tatatagaag aaaaaaaatt gccagaattt taaataaggt gcataatgtg tgaaaattcc 8460 cagataatac cactgggtca catgtggact agtcagctgg ggtcgaattt ccatttcttc 8520 gtctgccctc tggaccagct tcccatctaa ccatccaaat atatgggagc aacctgggta 8580 gagaagaggc tcacacggtg gtggccttga cctggccagg ggagggacat agcgtatgct 8640 tatcaaacaa gttgaatgct caggtgaagg cttttagggc cattcatatg agttaaaatg 8700 tcctttaact caccaaagca gtagactcaa cctgaataaa ctttataata atatgtgttg 8760 ccctggagtg agaagggaga aagggagaga ggaaggagca cctaacgtcc aggaaaagat 8820 gcaccatact gaagatcata acaggagtga aagactagaa atgccaagtc aatacatagc 8880 agaaaagcaa cttccaatat ttcaaataaa ttgcacattg tgtacaaatc tcagatcgt 8939 <210> 4 <211> 199 <212> PRT <213> Artificial Sequence <220> <223> GKN1 amino acid sequence from homo sapiens <400> 4 Met Leu Ala Tyr Ser Ser Val His Cys Phe Arg Glu Asp Lys Met Lys 1 5 10 15 Phe Thr Ile Val Phe Ala Gly Leu Leu Gly Val Phe Leu Ala Pro Ala 20 25 30 Leu Ala Asn Tyr Asn Ile Asn Val Asn Asp Asp Asn Asn Asn Ala Gly 35 40 45 Ser Gly Gln Gln Ser Val Ser Val Asn Asn Glu His Asn Val Ala Asn 50 55 60 Val Asp Asn Asn Asn Gly Trp Asp Ser Trp Asn Ser Ile Trp Asp Tyr 65 70 75 80 Gly Asn Gly Phe Ala Ala Thr Arg Leu Phe Gln Lys Lys Thr Cys Ile 85 90 95 Val His Lys Met Asn Lys Glu Val Met Pro Ser Ile Gln Ser Leu Asp 100 105 110 Ala Leu Val Lys Glu Lys Lys Leu Gln Gly Lys Gly Pro Gly Gly Pro 115 120 125 Pro Pro Lys Gly Leu Met Tyr Ser Val Asn Pro Asn Lys Val Asp Asp 130 135 140 Leu Ser Lys Phe Gly Lys Asn Ile Ala Asn Met Cys Arg Gly Ile Pro 145 150 155 160 Thr Tyr Met Ala Glu Glu Met Gln Glu Ala Ser Leu Phe Phe Tyr Ser 165 170 175 Gly Thr Cys Tyr Thr Thr Ser Val Leu Trp Ile Val Asp Ile Ser Phe 180 185 190 Cys Gly Asp Thr Val Glu Asn 195 <210> 5 <211> 6408 <212> DNA <213> Artificial Sequence <220> <223> GKN1 polynucleotide sequence from homo sapiens <400> 5 ataacaccta gtttgagtca acctggttaa gtacaaatat gagaaggctt ctcattcagg 60 tccatgcttg cctactcctc tgtccactgc tttcgtgaag acaagatgaa gttcacagtg 120 agtagatttt tccttttgaa tttaccacca aatgattgga gactgtcaat attctgagat 180 ttaggaggtc tgcttcttat ggccccatca tggaaaattt gttttaaaaa aattctctct 240 tcaaacacat ggacacagag aggggaacaa cacacactag gtcctgttgg ggggtggaga 300 gtgaggggag ggaacttaga ggacaggtca ataggggcag caaaccacca tggcacacat 360 atacctatgt aacaaacctg cacgttctgc acatgtatcc ctttttttta gaagaagaaa 420 taatgaaaaa aaatcttttt tctatttata taatcatggc atttataagc atctctatag 480 agaaggataa ttgtgctgag attagacagc tgtctgagca cctcacactg acctattttt 540 aacaaaatga ctttccgcat cacctgattc cggtctccat gcagggtaag cagttcctaa 600 gccctagaaa gtgccgatca tccctcattc ttgaattcct ccttttattt accaaaattc 660 ctgagcatgt tcaggaaaga tgaaaagctt attatcaaaa taagtggctg agatagactt 720 cttgtcacat ttgttacagt aaaatgggtc tccaagaaag aaagatttgc cttgggctct 780 agcatggcca tttatttaag aaagcatctg aaacatgaag ctaccacagc atctctcctg 840 tggttccaga cagaagcctg agagtctagg aggaggtgga ccgagaaacc ctgccaaagt 900 aactagtagt gccgggtttc tcacaacacg atgcaaaggg gctagaatca gatgactatt 960 ttcatgtttc aacatactac acactggaaa acgttacggc agactctact ttataatggg 1020 gctgcaaatg taaaatgact acctagaact aggtcctctt aatagcagca aagtttaaaa 1080 gggtcagagg gagctccaga cacaggttag atttgatttc tctcctagtt ctgctgtgaa 1140 caagaggtat aagtttggcc aactcactta acccctgaag ctcagttacc ttatctgtaa 1200 aatgattgca ttgtactagg tgttctctaa aatttcttct acctctgact ttttaggaga 1260 ctaattttta actccttttt aagctattgg gagaaaaatt taattttttt tcaaaagtta 1320 ccttgaatct ctagagcagt tctcaaaact attttgtccc aggcaaagga aatgagacta 1380 ggtacccaga atgaggcacc ctgcataaag ctctgtgctc tgaaaaccaa tgtcagggac 1440 cctgtgataa ataattaaac caagtatcct gggacactgc tagtgacatc gcctctgctg 1500 atcactcttg ccagcgagac actctatact tgctttctca tcattggcat ccaaactgcc 1560 tactaatcca ttgctttgga aagttttttt taataaaaag attatttcta ttaggaagaa 1620 aacatcccat gttaaatagg aaaattaact gaaatcattt tcagatgtga tttttagcac 1680 ttatagccat ctcaaaccat agtattcatt tatactatgc tatttattgt aaaacttctt 1740 tttttttcca aggaaaataa gatagtttgc tttattttaa aacagtaact ttcttatatt 1800 ggggcactga ccaaaattca atactggtac aaatatgtta cctaggaggt caaaatatgt 1860 gccaggtgaa ttttctgaat ttctctaaag agagaatttt aaaccttata aaacaattag 1920 aaacaagtga gtgagaggtg agcatcaaca acctgtgtaa cataagccac agtacaaatt 1980 taagctgaat aaccaagcca tgtcagttat cccaaatcat ttttgttaat atttaggagg 2040 atacacatat tttcaataac ttaaaagtga atctttactc ctatctctta atactcgaag 2100 aagtataact ttcttctttt actagattta aataatccaa atatctactc aaggtaggat 2160 gctgtcatta actatagctg agtttatcca aaatagaaaa atcatgaaga tttataaagc 2220 attttaaaaa taatcattta tagcaagtcc ttgaaagctc taaataagaa aggcagttct 2280 ctactttcta ataacaccta tggtttatat tacataatat aattcaacaa aacagcattc 2340 tgaccaatga taatttatag gaaattcatt tgccaagtat atgttttatt ataaagttaa 2400 tattttgacc aatcttaaaa atttttaaac tctattctga catttccaga agtattatct 2460 tagcaaagtc atctttatga taccacttat taaactgaag agaaacaaga tggtacattc 2520 tgggttttac tttaaaaggg atttgattca ataatttgat ttatcactac ttgaaaatta 2580 cattttcttc ctcagtactg gatggcaatg agatgaaagc agctttcctg gctctcaact 2640 tcccttcttc atcaattttt ccagcgtttc ataaggccta cactaaaaat tctaaaacta 2700 tatatcacat taatataatt acttataatt aatcagcaat ttcacattat cgttaaaacc 2760 tttatggtta aaaaatgcaa ggtaagagaa gaaaaaaaca cattgaacta gaactgaaca 2820 cattggtaaa attagtgaat acttttcata agcttggata gaggaagaaa gaagacatca 2880 ttttgccatg taacaggaga ccaatgttat ttgtgatttc agattgtctt tgctggactt 2940 cttggagtct ttctagctcc tgccctagct aactatgtaa gtctcacctt ttcaagtttg 3000 ctaccaaaat gcatttgcaa ggaaatgtga tattaaatca ctctcaatct cttataaact 3060 tcagaatatc aacgtcaatg atgacaacaa caatgctgga agtgggcagc agtcagtgag 3120 tgtcaacaat gaacacaatg tggccaatgt tgacaataac aacggatggg actcctggaa 3180 ttccatctgg gattatggaa atgtaggtag tcaacgtgca attttcactt tattgtttaa 3240 aaatacgatt tctttttaac aaaaaatgtg catgttaacc ataaagaaat taaaaataaa 3300 ttctaattac acatagcata cagttataag taaaggtgac cattttgctc atccgatttt 3360 gttccctaga gataactact gttaataagt gttgcatgat cagttaaaat tcaaaccaac 3420 aaacactatg ttcaagggat tgtgggtata tacaacaaat atgaacatcc ttttgccttg 3480 cctgcagata ccctcaataa tgctgaaaga cttatacaac attactgctt ccaaagctta 3540 gactatctca ctttgttttc aaaggaggtt ttacgacctt ctaaagagat tgaaattgac 3600 atttcaccta aaactcggga aatgtaaatg acaatattaa ttggtaagag aggaaagaag 3660 aaagaaagaa ggaaggaaag aaagaaagaa ggaaggaagg aaagaaagaa agaaagaaag 3720 aaagagagag aaagaaagaa aaagaaaaaa gagagaaaga gagaaggaaa gaaagagaga 3780 aggaaaggaa aagagaagca aagaaagaga ggagcaaaga aaggaacact tagcactagt 3840 taggagaccc aactctggaa ttatcagcta tatatttaac aaacgttata cttttaaata 3900 gcaaactctt tattgtttca attttatctg gtcaattgga aaaataattt ttgtcttatc 3960 tgtctccttg aaatgtgagg atcaaaggag actaaaacat gatagctttt aaagtctatt 4020 tcagtaaaac agacttatat agaggggttt ttatcatgct ggaacctgga aataaagcaa 4080 accagttaga tgctcagtct ctgccctcac agaattgcag tctgtcctca caaatgtcag 4140 caatagatat gattgccaag cagtgcccca tccagtgctc ttatcccagc tcatcacgat 4200 cttggagttc ccatttctct ctgcaggtgg aactgacctc tgataagaaa agctcctcgg 4260 agaacacatg cctcactatt tgccatctac tttaacaggg ctttgctgca accagactct 4320 ttcaaaagaa gacatgcatt gtgcacaaaa tgaacaagga agtcatgccc tccattcaat 4380 cccttgatgc actggtcaag gaaaagaagg taaaaataaa aggcttttta tttttggtga 4440 ggggagaggt tttacatcct tcagtaaata acgagaagat cacagtcatt ccctcttgac 4500 tacagtatgt tgtagtgtgc agcacaaagg gggaagttat tggtgattgc ctgagggaag 4560 gcaacttctg ccacatcaaa tgctgtggct cacacctacc tctacaaccg ctgagcaaag 4620 cacttgaaac cttgactgtt agaggagcaa agctctggtc acaccaatag gagcctcagt 4680 actttgccaa ggacattttt ctgcaagagt tagttagggt tattagattt agcaaatgaa 4740 aatagaagat atccagttag gtttgaattt taggtaagca gcaggtcttt ttagtataat 4800 atatcctatg caatatttgg gatatactaa aaaaagatcc attgtttatc tgaaattcaa 4860 atgtaactgg gtattgtata ttttgtctgg ccatactaat ccaggtgagt ggaaagaaga 4920 gatccataat gttttaaaat atttgcctga gttcatattc ctataactga taaatgagta 4980 cctttcattg acaaggtaga gaaaataaat aaactgcatt ctcagaagat gattattaca 5040 tagtctaatc caaggaatct atgatgacca aatgaggtcc aagttgcaga ataaattaag 5100 cctcagactt ctgtgtttat gagaagctga ggtttcaaac cagctaaatc ccttaggaca 5160 cttagaaatg ctaagatata cagaataagc tagaaatggc tcttcttcat cttgattatg 5220 gaaaaattta gctgagcaac actcactgtt ggcctcgtat acccctcaag tcaacaaacc 5280 actgggcttg gcattcattc tctcccattc ttcctttcta cctctctttt ccacactcag 5340 cttcagggta agggaccagg aggaccacct cccaagggcc tgatgtactc agtcaaccca 5400 aacaaagtcg atgacctgag caagttcgga aaaaacattg caaacatgtg tcgtgggatt 5460 ccaacataca tggctgagga gatgcaaggt gagtagcatc cctactgtgc accccaagtt 5520 agtgctggtg ggattgtcag actatcctcg cgcgtgtcca tagtgggcac cagtgatgca 5580 gggatggtca tcaaggccaa catttgtgca gtgcttgctc tgtgccaggt actgttctat 5640 gtgctttaag tgtgttaact cggttcttca cagcaatctt ataggttcta ttttaatcct 5700 actttatgga tgaggaaact gaggtacaga gaggtcacaa aatccttgcc tgggtcaatt 5760 ccaagcattt tggctgtgga ttctgtgctc ttaaatatta tggaacactg ccttttaagt 5820 gtgaatcaag agtagactca agtcatattc aaaagaatgc atgaatggct aaatgaaaga 5880 agaatgctaa tagaatctat taactttcta tagctcagac aatcacttaa tttctggaca 5940 ttcaaagaac agctgcacac aaacaaagtg tctacctagg gacctaactt aatggcaatt 6000 ttccagatct ctgaattgat tgatttcatc acaacaagta gataaacctt gacattagca 6060 catagctagt ttggaaaccc ctactccccc aatcccctcc aagaaaagag tccttaaata 6120 gacattaata taggcttctt cttttctctt tattagaggc aagcctgttt ttttactcag 6180 gaacgtgcta cacgaccagt gtactatgga ttgtggacat ttccttctgt ggagacacgg 6240 tggagaacta aacaattttt taaagccact atggatttag tcatctgaat atgctgtgca 6300 gaaaaaatat gggctccagt ggtttttacc atgtcattct gaaatttttc tctactagtt 6360 atgtttgatt tctttaagtt tcaataaaat catttagcat tgaattca 6408 <110> Industry Academic Cooperation Foundation of Catholic University <120> Anti-cancer supplement containing GKN2 <130> PN1309-304 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 184 <212> PRT <213> Artificial Sequence <220> <223> GKN2 amino acid sequence from homo sapiens <400> 1 Met Lys Ile Leu Val Ala Phe Leu Val Val Leu Thr Ile Phe Gly Ile   1 5 10 15 Gln Ser His Gly Tyr Glu Val Phe Asn Ile Ser Ser Ser Asn Asn              20 25 30 Gly Asn Val Gln Glu Thr Val Thr Ile Asp Asn Glu Lys Asn Thr          35 40 45 Ala Ile Ile Asn Ile His Ala Gly Ser Cys Ser Ser Thr Thr Ile Phe      50 55 60 Asp Tyr Lys His Gly Tyr Ile Ala Ser Arg Val Leu Ser Arg Arg Ala  65 70 75 80 Cys Phe Ile Leu Lys Met Asp His Gln Asn Ile Pro Pro Leu Asn Asn                  85 90 95 Leu Gln Trp Tyr Ile Tyr Glu Lys Gln Ala Leu Asp Asn Met Phe Ser             100 105 110 Ser Lys Tyr Thr Trp Val Lys Tyr Asn Pro Leu Glu Ser Leu Ile Lys         115 120 125 Asp Val Asp Trp Phe Leu Leu Gly Ser Pro Ile Glu Lys Leu Cys Lys     130 135 140 His Ile Pro Leu Tyr Lys Gly Glu Val Val Glu Asn Thr His Asn Val 145 150 155 160 Gly Ala Gly Gly Cys Ala Lys Ala Gly Leu Leu Gly Ile Leu Gly Ile                 165 170 175 Ser Ile Cys Ala Asp Ile His Val             180 <210> 2 <211> 555 <212> DNA <213> Artificial Sequence <220> <223> GKN2 cDNA sequence from homo sapiens <400> 2 atgaaaatac ttgtggcatt tctggtggtg ctgaccatct ttgggataca atctcatgga 60 tacgaggttt ttaacatcat cagcccaagc aacaatggtg gcaatgttca ggagacagtg 120 acaattgata atgaaaaaaa taccgccatc attaacatcc atgcaggatc atgctcttct 180 accacaattt ttgactataa acatggctac attgcatcca gggtgctctc ccgaagagcc 240 tgctttatcc tgaagatgga ccatcagaac atccctcctc tgaacaatct ccaatggtac 300 atctatgaga aacaggctct ggacaacatg ttctccagca aatacacctg ggtcaagtac 360 aaccctctgg agtctctgat caaagacgtg gattggttcc tgcttgggtc acccattgag 420 aaactctgca aacatatccc tttgtataag ggggaagtgg ttgaaaacac acataatgtc 480 ggtgctggag gctgtgcaaa ggctgggctc ctgggcatct tgggaatttc aatctgtgca 540 gacattcatg tttag 555 <210> 3 <211> 8939 <212> DNA <213> Artificial Sequence <220> <223> GKN2 polynucleotide sequence from homo sapiens <400> 3 aagaatttct taatactctg caagataact agaggtctct aacttacagt tttgtgcagt 60 tttgggcgaa gcttaatgta aaaatttggt taaacttggt aattggggag aatgctttct 120 gagtcttgtt cctcattaat ttctggaaat tgacaccaaa tctaaaggga agaacgaaga 180 aagtcctagg ctgtttgttc tccaagcagg cctccccagc cactgtcttg gcaccccgtc 240 tcatatccgt tccctctgtg gaagaattca gccagcagaa cagtggtgaa aagacattga 300 gttggggccc aactcaggcc ttaaggaagc actcttcctt taggaggaga tgttagaagt 360 ttgtccttgt agagctataa aatgtatgca tagaacaagc atcatgcaat atttttaaag 420 ggtggaaatt aaaatgtcaa gtgcagcata gtacaaatag cagggaatat ttacagagtg 480 accaagtggt gaattttcat tactgactaa tgaacttcat tgatatcagg tatgtggttg 540 gatctcaatt ctgataaagg agtttgctag ggtgtgtcag agatatagac atggtctttt 600 ccaaagtgat catttgaaaa agagatatcc acatcttcaa gcccatataa aggatagaag 660 ctgcacaggg cagctttact tactccagca ccttcctctc ccaggcaaaa tgaaaatact 720 tgtgagtatt tgtttctgct tcttgatact cttgtggtga ctgcttgcag acaatgctca 780 tatctaatat gccatggatt ttgggagtct tagacagata ctgtgcatgc ttctaagctt 840 ctgtgattga attaatgaca tctttggcag aaatagtgtt gaataagtct gacttttttt 900 gtccttttcc tgttttgaga tgtttactta aaagaaaatt caaaaataca aagaaatctc 960 tagataattt tgatttggag gatgtttaat aataatcctt tattatgagc ttcataggga 1020 atttgggcta tttaaaacaa ctacatttgc tatctaagag agaagctgta gtttaaaaat 1080 aatatcagta atagtaataa tagtacctct catttctcaa atgcatacta agccttagac 1140 taagcatatc acatgaataa tttcatctat tcattgcaac aaccctatga gttgagtagt 1200 attctccccg ttttacagat aaggagactg agaggcagag gaatgtgatt ttcccaagcc 1260 cgtaaatgtg ggatttagaa tgtaatttat ccatctgaat ccccacttgc aggcgcaatc 1320 atggcaaatt taagcagcca gagtgtcttc aatgtcctct cattatgact aaattctccc 1380 ttaggacaaa acgttccttc tatggccact ccacccctcc atctgatccc agcctccgta 1440 gttccacatt gcagtgcccc atggacagtg ggctatgttc tgacctagaa tggaattcgc 1500 tcccctagtc tctgtccttt attctcattc agctgctaag ggagaaagca aaatgttaag 1560 tacctctttc taaagtgtta aagactatca gcttaaagag ctccctctct cagggctgtc 1620 ttgattttcc aaattgagac ctaaccctga agcacaaaag tattatataa ccatggtgta 1680 ttaaccacag tgttggaagg gagatcattt tggggcagag gacactcccc aagctctctc 1740 taatcatacc attaaagtgg tttagtcctt cgactacttg ttcaaaccac tattttagac 1800 tcattaacta gaatatacgg gagtatcata tgttgctgga gctggtctgt ggtaagagaa 1860 gatgtatccc tatggaaggc tgaatatcag cacacaggtc tttgttagat gctctactcc 1920 cagtccccag aagagaaata ttaagggtgg gatggaaagg gaagtaggaa agtcccactg 1980 acagttctta aaaatatccc ccttccccaa gactcctttc atcagcagtt ttcaaatgac 2040 agtgcagtca actatgtact gatgtagttt tcagcgatag tacagttcac tgatgttcag 2100 aagagagggt acaaaacctg ggttagcatg ttggaacaga ctcttacaga actacagcaa 2160 aatatcagaa ctgcttcaat gtcagctcac gacctgtggg cccagcactt gtgtgatagt 2220 atcactaagg cataggagaa tatgggggtt ttacttgatg tcagcctcaa aagttaattg 2280 tgctcccaag cattctattt tcatagtttc ccttaggaac ctgtcaggtc tttatcaccc 2340 atgattcatt ttaaatctgt attaccctct cagtcttaag ggattaaagt tttttaaaat 2400 taattaatta attaattatt tttttagagg acacaatttg accactgtta tccaaagcta 2460 gtgtgaatca taccagagta tttccatagt gaaatgaatc cttcactgct catctgcccc 2520 gggtttctcc tactatctac atggttataa tgctagaaag agttgggaat taggtggcaa 2580 ttgtagcacc ctgtgtctgg caaatagaat gaactcaaca aatgcctgtt aaatgagcca 2640 atgtgtgagc caatcaatgt gtgcgtggaa agggagtgct gaccatctgt ggccactcag 2700 tgtctctagg tgtacatttt ctgagatatc tgtgcctttc ctgtccagtg tttcctcctg 2760 tcccacactc aatgactacc ctataaagaa tggatgtggt gggtctgttt ttcaggtggc 2820 atttctggtg gtgctgacca tctttgggat acaatctcat ggatacgagg tgagttggtt 2880 ccttatggac tttatctctt agagatgttg ggagaggaaa gggaaggtac aagagagcct 2940 gaagacagta gagaggccat atgccttatt tgggatggaa tctcagaaat aaccaataat 3000 ggaaataatg agcttggcta ttcctctcca accacaatac ctttgcaaat gtaagccatt 3060 gctttaaaat gtggtcagtc tcatttctct tgtgatatca ctgcttctcc catatataat 3120 atagtaaact ctaaggaaaa gctttgcctt cttatggcat cataagtttt tggattggga 3180 ccccagtgga cagttttagt ttttaatccc ttgttcatag caggcagctg ctttattttg 3240 ttggaagagt tgcctttcaa atatataaga tttatggaaa aacattttgt ctttcttttc 3300 aatctaggtt tttaacatca tcagcccaag caacaatggt ggcaatgttc aggagacagt 3360 gacaattgat aatgaaaaaa ataccgccat cattaacatc catgcaggat catgctcttc 3420 taccacaatt tttgactata aacatgtaag cagcaaatga attttcatat tcatcaggac 3480 tagtttgcta aagagcagag ggatctatat atatatgggg catatatact tgaattctta 3540 gacttaacct tgcaattctt taagaattcc tcactttcac ttttctcttt aaataatcaa 3600 gcaattggtt aaaaaaacaa aaccattttg aagaaaaaca tatgacagga aacatatgca 3660 tttgcttgac cttttcaggt agaaattgga agagtaatgc tattatccca ctacaggctc 3720 agaaagtgca aagaagagta accaaagtcc aaagcaaagc ccggcatgca gacactcaaa 3780 ctcatttgtt gagtgaacaa atgaatgaat agggcttcta acacagaaca tcatgcagaa 3840 aaagaacaat tggtcaggca cagtggctca tgcctgtaat cccagcactt tgggagtctg 3900 aggcgggagg atctcttgag cccaggagtt ggagactggc ctgggcaaca tggcagaatc 3960 ccatctctac caaaaataca aaaattagct gggtgtggtg gtgcgggcct gtggtcccac 4020 ctacttggga ggctgaggtg ggaggattgc tggagcccag gaagtcaagg ctgcagtgag 4080 ctgagactgc accactgcac tccagcctgg gtgacaaaac gagatcctgt ctcaaaaaaa 4140 taaataaata aataattaaa aaatataaaa taataaaaag aacaatcaca aagcaatcac 4200 aacatagcag aaatccagag caactataca catttaatta tgtacatagg gtaggcaaaa 4260 aatcatactt tttctgtaag aaagaaaatc tgctaactaa aagcactaaa ctattttcaa 4320 gtgttagata ctggcattaa caataagtca cagaaacctg ctcagaaaac atatccttca 4380 tcagttattt attcatttgt tttccatttc ttccaccaac gaattatgaa cctgcttcta 4440 cctaggttcc aagctatgca ctatggatat aagtaggttc ctgctcatct cactagactt 4500 ttgaacatga ttttctgtcc cttttcttct agaaatgtct tcacgttcct ctttcccatt 4560 ggtgttggca gttcaatcac acatttgaaa gtatagagtc attagaaaat gtggtttaaa 4620 aggaagtggc actgaaattg tttttaagca actgtcatgg aaatcccaaa actgtcttta 4680 aaaaaaaatg gagaagtgag gatttgcttt aagcttcttc cattatcacc aggctcagcc 4740 tctgtctatt ttttgaattt taggaactga caatttgtga gaattgaaaa ataagaacca 4800 gaaagatttc tattagatac agctttctag ggtatatcat tatttggaac tctgtagaga 4860 caattttcac tccaggtgaa gactcagtgg ccttaggtcc catctggccc cagggtcttc 4920 accctccatt gctctttcaa tcccacctta ttgcaaccca tccctctcca gccagcttgg 4980 gtttgagatg gagaagggat ggggaaaact ggagaggaag aaaagatggc aaatgagggg 5040 aggatagatg agacgtgtgt gagcgtgcat gagtgtgggt atgggtatgc ttatgagagc 5100 tcctaaagca gcactgtcta acagaacttt ctgcagcggt ggaagtgttc tagatttgaa 5160 tttccaatag ggaagccccc agccgcctgt ggttattgag tactcaaaat ttgtaacaga 5220 agtgcatttt aaattttacc taatttgaat ttaaatttag atagtggcat atagctaata 5280 actatcatat tggacagcac agtttttttt ttttgttttt tttttttgac ggagtctcgc 5340 tctgtcaccc aggctggagt ccagtggtgt gatcttggct cactgcaagc tccacctccc 5400 gggttcatgc cattctcctg cctcagcctc ccgagtagct gggactacag gtgcccgcca 5460 ccacgcccgg ctaaattttt tgtattttta gtagagacgg ggtttcacca tgttagccag 5520 gatggtctcg atctcctgac cttgtgatct gcccttctcg gcctcccaaa gtgctgggat 5580 tacaggtgtg agccactgca cctggccagg acagcacagt tctaaaaaat attctattta 5640 ccccaaactg gggaggaagc agaataaaat taatggaaag aagccagatg cagtagctta 5700 cacctctaat ctcagcactt tgggagctca aggtgggtgg atcacttgag atcaggagtt 5760 tgagaccagc ctggctaata tggtgaaact ccatctctac taaacataaa aaattagctg 5820 ttcatggtgg tgcacacctg tagtcccagc tactctggaa gctgaggcaa gagagttgct 5880 tgaaccaggg aggtggaggc ttcagtgagc tgaggttgca ccactgcact ccagcctggg 5940 caacagagtg agagtctgtc tcaaaaaaat aataataatg gtaataataa taataaaata 6000 atggaaagag acagagtagt gcttcttctc aatctttcaa acctcaaact gcagaccctg 6060 gttccatgac atgaaaagca gaatatagtc atgggtttgc acaatttcaa aggggtagaa 6120 atgacaagtg aaaaaatgaa aatgttatgt aaaataagtc aagtggataa agttgattgc 6180 agattggaga gcaatcccac catatattca ctgtgcatgt tcaagtcttt cttccgaggt 6240 tcaggcatca tcttcaccaa gttcagattc agggaactag ggaggaacag taactgtact 6300 cttgctgcct cagggctaca ttgcatccag ggtgctctcc cgaagagcct gctttatcct 6360 gaagatggac catcagaaca tccctcctct gaacaatctc caatggtaca tctatgagaa 6420 acaggtaatt ctggggcact cttgagtatt ctctgttctt aagccaggca atactggtat 6480 ttatggagaa atgaagagtg tgagggagaa gatcatacta tcatgcctta ccataaatgt 6540 gatactcaac ttattaaagt tattaaagtg tttttacttt tattttatta ttttttaaga 6600 gcaggagcaa atcttagctt gatttccacc atatagtcct aaatacaaga atttataata 6660 aattccagtg acattatagc aaggactgat cagcttctct tctcagagca gggctatgag 6720 aaatggtgac tggaacaata ataagagaag ttctaatatt caatgaccca aagatgcaaa 6780 gaaataatac agttgagtga acatatacaa acagtgcact gcggctagag acccaaggtt 6840 taagtctccc tccacaactt cttataggtg ctacctttga catgggactt actttctttg 6900 ggcttcattg ccaccagagg taaaataaca ctggtaatta ctaatgaggc tacttcacag 6960 atagagtgtt caaaaagaga tgatgtcttg agatccctaa gttctttcta tttaataatc 7020 agaattgtcac aatttagat aagttagat atgttgttct tttctgttat accgatctag gctctggaca acatgttctc cagcaaatac 7140 acctgggtca agtacaaccc tctggagtct ctgatcaaag acgtggattg gttcctgctt 7200 gggtcaccca ttgagaaact ctgcaaacat atccctttgt ataaggggga agtggttgaa 7260 aacacacgtg agtaccaata agtcattcac tcaccaaata ttttctgaaa gctactatgt 7320 gccaggtgct ctgttgggtg ccaagtgaaa tgcaaataaa tgggaacagt actcagttca 7380 gtttgctttg ggaattaatt acatgccatg tgtgtaaatt gtgctaaatt ttaggaatac 7440 agaaatgaat taaacgtctc cagggaacac atagtctagt gaagaagctg acaagtgaaa 7500 agagaggatg gagtaaagga tttctggatg ccaatgaaaa actactcgat tcttgtatac 7560 tttcatatgt aagaatttca agtagcaaaa agtcatctgg gcccttagaa tagcatattt 7620 tgaagataat aagaaggaag tcactaagaa atgctctcag gatctagaat agaattggta 7680 taggaaagag gaggccaagc ggacttacag acagggagta aaaaccctga ttcatctggg 7740 taacatatgc cactgcagat attactgtca tttttataca aagtttctaa atgtggcaga 7800 gcaaccagag tgaaagaggt cgggccaact gatgatgaac acaacaaagg aaatttctca 7860 gagtactgga aggtagataa agaagagttt atgtttatta tatatctact gcccagaaaa 7920 aaattttaag tactcattca taaagtaaat aaaggcacat aggtatgcca ttgacacaga 7980 atggcataat atcactggga ttgagccaac cagcacttcc aaaagttgtc agttttattt 8040 aagctaatgt attattattc taataattcc aataatatat tttttaatgc tctttctctg 8100 aaaaattttc ccttttccag ataatgtcgg tgctggaggc tgtgcaaagg ctgggctcct 8160 gggcatcttg ggaatttcaa tctgtgcaga cattcatgtt taggatgatt agccctcttg 8220 ttttatcttt tcaaagaaat acatccttgg tttacactca aaagtcaaat taaattcttt 8280 cccaatgccc caactaattt tgagattcag tcagaaaata taaatgctgt atttatagat 8340 tttttggtgt ttgttgtttt ttgtaagcag caaagggaat ccaagcaatg tctttgtcac 8400 tatatagaag aaaaaaaatt gccagaattt taaataaggt gcataatgtg tgaaaattcc 8460 cagataatac cactgggtca catgtggact agtcagctgg ggtcgaattt ccatttcttc 8520 gtctgccctc tggaccagct tcccatctaa ccatccaaat atatgggagc aacctgggta 8580 gagaagaggc tcacacggtg gtggccttga cctggccagg ggagggacat agcgtatgct 8640 tatcaaacaa gttgaatgct caggtgaagg cttttagggc cattcatatg agttaaaatg 8700 tcctttaact caccaaagca gtagactcaa cctgaataaa ctttataata atatgtgttg 8760 ccctggagtg agaagggaga aagggagaga ggaaggagca cctaacgtcc aggaaaagat 8820 gcaccatact gaagatcata acaggagtga aagactagaa atgccaagtc aatacatagc 8880 agaaaagcaa cttccaatat ttcaaataaa ttgcacattg tgtacaaatc tcagatcgt 8939 <210> 4 <211> 199 <212> PRT <213> Artificial Sequence <220> <223> GKN1 amino acid sequence from homo sapiens <400> 4 Met Leu Ala Tyr Ser Ser Val His Cys Phe Arg Glu Asp Lys Met Lys   1 5 10 15 Phe Thr Ile Val Phe Ala Gly Leu Leu Gly Val Phe Leu Ala Pro Ala              20 25 30 Leu Ala Asn Tyr Asn Ile Asn Val Asn Asp Asp Asn Asn Asn Ala Gly          35 40 45 Ser Gly Gln Gln Ser Val Ser Val Asn Asn Glu His Asn Val Ala Asn      50 55 60 Val Asp Asn Asn Asn Gly Trp Asp Ser Trp Asn Ser Ile Trp Asp Tyr  65 70 75 80 Gly Asn Gly Phe Ala Ala Thr Arg Leu Phe Gln Lys Lys Thr Cys Ile                  85 90 95 Val His Lys Met Asn Lys Glu Val Met Pro Ser Ile Gln Ser Leu Asp             100 105 110 Ala Leu Val Lys Glu Lys Lys Leu Gln Gly Lys Gly Pro Gly Gly Pro         115 120 125 Pro Pro Lys Gly Leu Met Tyr Ser Val Asn Pro Asn Lys Val Asp Asp     130 135 140 Leu Ser Lys Phe Gly Lys Asn Ile Ala Asn Met Cys Arg Gly Ile Pro 145 150 155 160 Thr Tyr Met Ala Glu Glu Met Gln Glu Ala Ser Leu Phe Phe Tyr Ser                 165 170 175 Gly Thr Cys Tyr Thr Thr Ser Val Leu Trp Ile Val Asp Ile Ser Phe             180 185 190 Cys Gly Asp Thr Val Glu Asn         195 <210> 5 <211> 6408 <212> DNA <213> Artificial Sequence <220> <223> GKN1 polynucleotide sequence from homo sapiens <400> 5 ataacaccta gtttgagtca acctggttaa gtacaaatat gagaaggctt ctcattcagg 60 tccatgcttg cctactcctc tgtccactgc tttcgtgaag acaagatgaa gttcacagtg 120 agtagatttt tccttttgaa tttaccacca aatgattgga gactgtcaat attctgagat 180 ttaggaggtc tgcttcttat ggccccatca tggaaaattt gttttaaaaa aattctctct 240 tcaaacacat ggacacagag aggggaacaa cacacactag gtcctgttgg ggggtggaga 300 gtgaggggag ggaacttaga ggacaggtca ataggggcag caaaccacca tggcacacat 360 atacctatgt aacaaacctg cacgttctgc acatgtatcc ctttttttta gaagaagaaa 420 taatgaaaaa aaatcttttt tctatttata taatcatggc atttataagc atctctatag 480 agaaggataa ttgtgctgag attagacagc tgtctgagca cctcacactg acctattttt 540 cacctgattc gccctagaaa gtgccgatca tccctcattc ttgaattcct ccttttattt accaaaattc 660 ctgagcatgt tcaggaaaga tgaaaagctt attatcaaaa taagtggctg agatagactt 720 cttgtcacat ttgttacagt aaaatgggtc tccaagaaag aaagatttgc cttgggctct 780 agcatggcca tttatttaag aaagcatctg aaacatgaag ctaccacagc atctctcctg 840 tggttccaga cagaagcctg agagtctagg aggaggtgga ccgagaaacc ctgccaaagt 900 aactagtagt gccgggtttc tcacaacacg atgcaaaggg gctagaatca gatgactatt 960 ttcatgtttc aacatactac acactggaaa acgttacggc agactctact ttataatggg 1020 gctgcaaatg taaaatgact acctagaact aggtcctctt aatagcagca aagtttaaaa 1080 gggtcagagg gagctccaga cacaggttag atttgatttc tctcctagtt ctgctgtgaa 1140 caagaggtat aagtttggcc aactcactta acccctgaag ctcagttacc ttatctgtaa 1200 aatgattgca ttgtactagg tgttctctaa aatttcttct acctctgact ttttaggaga 1260 ctaattttta actccttttt aagctattgg gagaaaaatt taattttttt tcaaaagtta 1320 ccttgaatct ctagagcagt tctcaaaact attttgtccc aggcaaagga aatgagacta 1380 ggtacccaga atgaggcacc ctgcataaag ctctgtgctc tgaaaaccaa tgtcagggac 1440 cctgtgataa ataattaaac caagtatcct gggacactgc tagtgacatc gcctctgctg 1500 atcactcttg ccagcgagac actctatact tgctttctca tcattggcat ccaaactgcc 1560 tactaatcca ttgctttgga aagttttttt taataaaaag attatttcta ttaggaagaa 1620 aacatcccat gttaaatagg aaaattaact gaaatcattt tcagatgtga tttttagcac 1680 ttatagccat ctcaaaccat agtattcatt tatactatgc tatttattgt aaaacttctt 1740 tttttttcca aggaaaataa gatagtttgc tttattttaa aacagtaact ttcttatatt 1800 ggggcactga ccaaaattca atactggtac aaatatgtta cctaggaggt caaaatatgt 1860 gccaggtgaa ttttctgaat ttctctaaag agagaatttt aaaccttata aaacaattag 1920 aaacaagtga gtgagaggtg agcatcaaca acctgtgtaa cataagccac agtacaaatt 1980 taagctgaat aaccaagcca tgtcagttat cccaaatcat ttttgttaat atttaggagg 2040 atacacatat tttcaataac ttaaaagtga atctttactc ctatctctta atactcgaag 2100 aagtataact ttcttctttt actagattta aataatccaa atatctactc aaggtaggat 2160 gctgtcatta actatagctg agtttatcca aaatagaaaa atcatgaaga tttataaagc 2220 attttaaaaa taatcattta tagcaagtcc ttgaaagctc taaataagaa aggcagttct 2280 ctactttcta ataacaccta tggtttatat tacataatat aattcaacaa aacagcattc 2340 tgaccaatga taatttatag gaaattcatt tgccaagtat atgttttatt ataaagttaa 2400 tattttgacc aatcttaaaa atttttaaac tctattctga catttccaga agtattatct 2460 tagcaaagtc atctttatga taccacttat taaactgaag agaaacaaga tggtacattc 2520 tgggttttac tttaaaaggg atttgattca ataatttgat ttatcactac ttgaaaatta 2580 cattttcttc ctcagtactg gatggcaatg agatgaaagc agctttcctg gctctcaact 2640 tcccttcttc atcaattttt ccagcgtttc ataaggccta cactaaaaat tctaaaacta 2700 tatatcacat taatataatt acttataatt aatcagcaat ttcacattat cgttaaaacc 2760 tttatggtta aaaaatgcaa ggtaagagaa gaaaaaaaca cattgaacta gaactgaaca 2820 cattggtaaa attagtgaat acttttcata agcttggata gaggaagaaa gaagacatca 2880 ttttgccatg taacaggaga ccaatgttat ttgtgatttc agattgtctt tgctggactt 2940 cttggagtct ttctagctcc tgccctagct aactatgtaa gtctcacctt ttcaagtttg 3000 ctaccaaaat gcatttgcaa ggaaatgtga tattaaatca ctctcaatct cttataaact 3060 tcagaatatc aacgtcaatg atgacaacaa caatgctgga agtgggcagc agtcagtgag 3120 tgtcaacaat gaacacaatg tggccaatgt tgacaataac aacggatggg actcctggaa 3180 ttccatctgg gattatggaa atgtaggtag tcaacgtgca attttcactt tattgtttaa 3240 aaatacgatt tctttttaac aaaaaatgtg catgttaacc ataaagaaat taaaaataaa 3300 ttctaattac acatagcata cagttataag taaaggtgac cattttgctc atccgatttt 3360 gttccctaga gataactact gttaataagt gttgcatgat cagttaaaat tcaaaccaac 3420 aaacactatg ttcaagggat tgtgggtata tacaacaaat atgaacatcc ttttgccttg 3480 cctgcagata ccctcaataa tgctgaaaga cttatacaac attactgctt ccaaagctta 3540 gactatctca ctttgttttc aaaggaggtt ttacgacctt ctaaagagat tgaaattgac 3600 atttcaccta aaactcggga aatgtaaatg acaatattaa ttggtaagag aggaaagaag 3660 aaagaaagaa ggaaggaaag aaagaaagaa ggaaggaagg aaagaaagaa agaaagaaag 3720 aaagagagag aaagaaagaa aaagaaaaaa gagagaaaga gagaaggaaa gaaagagaga 3780 aggaaaggaa aagagaagca aagaaagaga ggagcaaaga aaggaacact tagcactagt 3840 taggagaccc aactctggaa ttatcagcta tatatttaac aaacgttata cttttaaata 3900 gt; tgtctccttg aaatgtgagg atcaaaggag actaaaacat gatagctttt aaagtctatt 4020 tcagtaaaac agacttatat agaggggttt ttatcatgct ggaacctgga aataaagcaa 4080 accagttaga tgctcagtct ctgccctcac agaattgcag tctgtcctca caaatgtcag 4140 caatagatat gattgccaag cagtgcccca tccagtgctc ttatcccagc tcatcacgat 4200 cttggagttc ccatttctct ctgcaggtgg aactgacctc tgataagaaa agctcctcgg 4260 agaacacatg cctcactatt tgccatctac tttaacaggg ctttgctgca accagactct 4320 ttcaaaagaa gacatgcatt gtgcacaaaa tgaacaagga agtcatgccc tccattcaat 4380 cccttgatgc actggtcaag gaaaagaagg taaaaataaa aggcttttta tttttggtga 4440 ggggagaggt tttacatcct tcagtaaata acgagaagat cacagtcatt ccctcttgac 4500 tacagtatgt tgtagtgtgc agcacaaagg gggaagttat tggtgattgc ctgagggaag 4560 gcaacttctg ccacatcaaa tgctgtggct cacacctacc tctacaaccg ctgagcaaag 4620 cacttgaaac cttgactgtt agaggagcaa agctctggtc acaccaatag gagcctcagt 4680 actttgccaa ggacattttt ctgcaagagt tagttagggt tattagattt agcaaatgaa 4740 aatagaagat atccagttag gtttgaattt taggtaagca gcaggtcttt ttagtataat 4800 atatcctatg caatatttgg gatatactaa aaaaagatcc attgtttatc tgaaattcaa 4860 atgtaactgg gtattgtata ttttgtctgg ccatactaat ccaggtgagt ggaaagaaga 4920 gatccataat gttttaaaat atttgcctga gttcatattc ctataactga taaatgagta 4980 cctttcattg acaaggtaga gaaaataaat aaactgcatt ctcagaagat gattattaca 5040 tagtctaatc caaggaatct atgatgacca aatgaggtcc aagttgcaga ataaattaag 5100 cctcagactt ctgtgtttat gagaagctga ggtttcaaac cagctaaatc ccttaggaca 5160 cttagaaatg ctaagatata cagaataagc tagaaatggc tcttcttcat cttgattatg 5220 gaaaaattta gctgagcaac actcactgtt ggcctcgtat acccctcaag tcaacaaacc 5280 actgggcttg gcattcattc tctcccattc ttcctttcta cctctctttt ccacactcag 5340 cttcagggta agggaccagg aggaccacct cccaagggcc tgatgtactc agtcaaccca 5400 aacaaagtcg atgacctgag caagttcgga aaaaacattg caaacatgtg tcgtgggatt 5460 ccaacataca tggctgagga gatgcaaggt gagtagcatc cctactgtgc accccaagtt 5520 agtgctggtg ggattgtcag actatcctcg cgcgtgtcca tagtgggcac cagtgatgca 5580 gggatggtca tcaaggccaa catttgtgca gtgcttgctc tgtgccaggt actgttctat 5640 gtgctttaag tgtgttaact cggttcttca cagcaatctt ataggttcta ttttaatcct 5700 actttatgga tgaggaaact gaggtacaga gaggtcacaa aatccttgcc tgggtcaatt 5760 ccaagcattt tggctgtgga ttctgtgctc ttaaatatta tggaacactg ccttttaagt 5820 gtgaatcaag agtagactca agtcatattc aaaagaatgc atgaatggct aaatgaaaga 5880 agaatgctaa tagaatctat taactttcta tagctcagac aatcacttaa tttctggaca 5940 ttcaaagaac agctgcacac aaacaaagtg tctacctagg gacctaactt aatggcaatt 6000 ttccagatct ctgaattgat tgatttcatc acaacaagta gataaacctt gacattagca 6060 catagctagt ttggaaaccc ctactccccc aatcccctcc aagaaaagag tccttaaata 6120 gacattaata taggcttctt cttttctctt tattagaggc aagcctgttt ttttactcag 6180 gaacgtgcta cacgaccagt gtactatgga ttgtggacat ttccttctgt ggagacacgg 6240 tggagaacta aacaattttt taaagccact atggatttag tcatctgaat atgctgtgca 6300 gaaaaaatat gggctccagt ggtttttacc atgtcattct gaaatttttc tctactagtt 6360 atgtttgatt tctttaagtt tcaataaaat catttagcat tgaattca 6408

Claims (11)

항암제와 병용되는 GKN2 (Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 위축성 위염; 위암이 전이된 조직의 세포사멸; 및 장기의 주변 정상세포의 세포사멸로 구성된 군에서 선택된 1종 이상의 GKN1(Gastrokine 1) 부작용의 감소 또는 억제용 항암 보조제.Atrophic gastritis containing, as an active ingredient, a GKN2 (Gastrokine 2) protein or a polynucleotide encoding a GKN2 protein used in combination with an anticancer agent; Cell death of gastric cancer metastatic tissue; And GKN1 (Gastrokine 1) side effects selected from the group consisting of apoptosis of peripheral normal cells of organs. 제1항에 있어서,
상기 GKN2 단백질은 서열번호 1의 아미노산 서열로 이루어진 것을 특징으로 하는 항암 보조제.
The method according to claim 1,
Wherein the GKN2 protein is an amino acid sequence of SEQ ID NO: 1.
제1항에 있어서,
상기 GKN2 단백질을 암호화하는 폴리뉴클레오티드는 서열번호 2의 염기서열로 이루어진 것을 특징으로 하는 항암 보조제.
The method according to claim 1,
Wherein the polynucleotide encoding the GKN2 protein comprises the nucleotide sequence of SEQ ID NO: 2.
제1항에 있어서,
상기 항암 보조제는 GKN1(Gastrokine 1) 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는 항암제 특이적인 보조제인 것을 특징으로 하는 항암 보조제.
The method according to claim 1,
Wherein the anticancer adjuvant is an anticancer agent-specific adjuvant comprising, as an active ingredient, a polynucleotide encoding a GKN1 (Gastrokine 1) protein or a GKN1 protein.
삭제delete 삭제delete 삭제delete 삭제delete GKN2(Gastrokine 2) 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 유효성분으로 포함하는, 위축성 위염; 위암이 전이된 조직의 세포사멸; 및 장기의 주변 정상세포의 세포사멸로 구성된 군에서 선택된 1종 이상의 GKN1(Gastrokine 1) 부작용으로부터 위 점막 보호용 약제학적 조성물.Atrophic gastritis comprising as an active ingredient a polynucleotide encoding GKN2 (Gastrokine 2) protein or GKN2 protein; Cell death of gastric cancer metastatic tissue; And at least one GKN1 (Gastrokine 1) adverse effect selected from the group consisting of apoptosis of peripheral normal cells of organs. 제9항에 있어서,
상기 조성물은 GKN1(Gastrokine 1) 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 더 포함하는 것을 특징으로 하는 조성물.
10. The method of claim 9,
Wherein the composition further comprises a GKNl (Gastrokine 1) protein or a polynucleotide encoding a GKNl protein.
인간을 제외한 포유동물에 있어서,
위암 세포에는 GKN1 단백질 또는 GKN1 단백질을 암호화하는 폴리뉴클레오티드를 처리하고, 위암 세포 주변의 정상 위 점막 또는 위암이 전이된 조직이나 장기의 주변 정상세포에는 GKN2 단백질 또는 GKN2 단백질을 암호화하는 폴리뉴클레오티드를 처리하는 위암 치료방법.
In mammals other than humans,
The gastric cancer cell is treated with a polynucleotide encoding a GKN1 protein or a GKN1 protein and a polynucleotide encoding a GKN2 protein or a GKN2 protein is treated in a normal gastric mucosa around the gastric cancer cell or in a surrounding normal cell of the organ in which the gastric cancer has been transplanted Gastric cancer treatment method.
KR1020130125819A 2013-10-22 2013-10-22 An anti-cancer supplement containing GKN2 KR101848106B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130125819A KR101848106B1 (en) 2013-10-22 2013-10-22 An anti-cancer supplement containing GKN2

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130125819A KR101848106B1 (en) 2013-10-22 2013-10-22 An anti-cancer supplement containing GKN2

Publications (2)

Publication Number Publication Date
KR20150046507A KR20150046507A (en) 2015-04-30
KR101848106B1 true KR101848106B1 (en) 2018-04-11

Family

ID=53037844

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130125819A KR101848106B1 (en) 2013-10-22 2013-10-22 An anti-cancer supplement containing GKN2

Country Status (1)

Country Link
KR (1) KR101848106B1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Menheniott TR, et al. Am J Physiol Gastrointest Liver Physiol. 2013 Jan 15;304(2):G109-21. (2012.11.15. 공개)*

Also Published As

Publication number Publication date
KR20150046507A (en) 2015-04-30

Similar Documents

Publication Publication Date Title
EP1469878B1 (en) Fgfr agonists
US9770482B2 (en) Targeting the EGFR-SGLT1 interaction for cancer therapy
KR101215069B1 (en) A composition comprising Gastrokine 1 for anti-cancer
KR20060095114A (en) A therapeutic agent comprising lipocalin 2 against cancer metastasis, and methods of early diagnosis and inhibition of cancer metastasis using lipocalin 2
AU2003205716A1 (en) FGFR agonists
CN111073979B (en) Gastric cancer treatment method for blocking CCL28 chemotactic pathway
AU2016366515A1 (en) Combined preparations of PKM2 modulators and HMGB1
CN114585384A (en) Compositions and methods using C/EBP alpha sarRNA
US20210087247A1 (en) Mps peptides and use thereof
CN112168969A (en) Inhibition effect of DDIT4L and functional small peptide thereof on glioblastoma
Wang et al. Cancer‐derived IgG involved in cisplatin resistance through PTP‐BAS/Src/PDK1/AKT signaling pathway
ES2791624T3 (en) Methods to treat cancer
CN113209303B (en) WWP1 degradation oncoprotein MUC1 inhibition tumor through lysosome approach and application thereof
Chen et al. Regulation of epidermal growth factor receptor tyrosine kinase inhibitor resistance via Ambra1-mediated autophagy in non-small cell lung cancer
KR101848106B1 (en) An anti-cancer supplement containing GKN2
KR101187576B1 (en) Novel use of erythroid differentiation regulator 1 as an treating agent for cancer
US9150929B2 (en) Anaplastic thyroid cancers harbor novel oncogenic mutations of the ALK gene
US20240075093A1 (en) Compositions and methods of treating a pi3k mediated disease
WO2023118291A1 (en) Use of the negr1 protein and biologically active fragments thereof in the therapeutic treatment of alk-related diseases
US20130190240A1 (en) Tumor growth controlling method targeting galactosylceramide expression factor-1
WO2009062104A2 (en) Aberrant expression of zinc transporter zip4 (slc39a4) significantly contributes to human pancreatic cancer pathogenesis and progression
TWI504404B (en) Pharmaceutical composition for inhibiting proliferation and metastasis of colorectal cancer and metrocarcinoma
KR101462329B1 (en) Composition comprising promoting agent of juxtamembrane 2 in discoidin domain receptor 2 for preventing and treating cancer
Issaq The role of Ral GTPases in human oncogenic transformation
KR20120049857A (en) Composition for protecting cell from radiation comprising fts protein or its expression construct as active ingredient

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant