KR101527749B1 - Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760 - Google Patents

Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760 Download PDF

Info

Publication number
KR101527749B1
KR101527749B1 KR1020120136577A KR20120136577A KR101527749B1 KR 101527749 B1 KR101527749 B1 KR 101527749B1 KR 1020120136577 A KR1020120136577 A KR 1020120136577A KR 20120136577 A KR20120136577 A KR 20120136577A KR 101527749 B1 KR101527749 B1 KR 101527749B1
Authority
KR
South Korea
Prior art keywords
mir
seq
nucleotide sequence
inhibitor
inhibitor consisting
Prior art date
Application number
KR1020120136577A
Other languages
Korean (ko)
Other versions
KR20140068731A (en
Inventor
배영석
김수영
이영훈
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to KR1020120136577A priority Critical patent/KR101527749B1/en
Publication of KR20140068731A publication Critical patent/KR20140068731A/en
Application granted granted Critical
Publication of KR101527749B1 publication Critical patent/KR101527749B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물에 관한 것이다. 본 발명에 따른 miR-186, miR-216b, miR-337-3p 및 miR-760 억제제는 세포에서 CKIIα 유전자의 발현을 증가시킴으로써, ROS의 생성을 감소시키고, p53 및 p21의 발현을 감소키켜 세포 노화를 예방 또는 치료하는 효과가 우수하다. 따라서, 본 발명은 세포 노화 치료제로 유용하게 사용될 수 있다. The present invention relates to a composition for preventing or treating cellular senescence comprising as an active ingredient a nucleic acid molecule inhibitor consisting of miR-186, miR-216b, miR-337-3p and miR-760. The miR-186, miR-216b, miR-337-3p and miR-760 inhibitors according to the present invention increase the expression of the CKII a gene in the cell, thereby reducing the production of ROS and decreasing the expression of p53 and p21 The effect of preventing or treating aging is excellent. Therefore, the present invention can be usefully used as a therapeutic agent for cell senescence.

Description

miR-186, miR-216b, miR-337-3p 및 miR-760 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물{Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760}The present invention relates to a composition for preventing or treating cellular senescence comprising miR-186, miR-216b, miR-337-3p and miR-760 inhibitor as an active ingredient. 337-3p and miR-760}

본 발명은 miR-186, miR-216b, miR-337-3p 및 miR-760 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating cellular senescence comprising miR-186, miR-216b, miR-337-3p and miR-760 inhibitor as an active ingredient.

노화란 시간이 지남에 따라 일어나는 신체의 모든 생리적 변화를 통칭하는 것으로 개체에 따라 수많은 요인에 의해 매우 다양하게 일어나는 생명 현상이다.암, 심혈관계 부전증, 비만, 비-알코올성 지방 간 등 많은 질환을 가져다주는, 세포, 조직 및 기관의 퇴화와 연관이 있을 뿐만 아니라 대부분의 생리학적 성능 한도가 쇠약해지는 것과 연관이 있다. 노화는 개체마다 그 양상과 속도가 다르고, 한 개체 내에서도 각 조직마다 그 양상이 다르므로 노화를 개체 수준에서 연구하는 것은 많은 어려움이 있다. 한편, 노화 현상을 구체적으로 살펴보면 각 구성기관 및 조직의 기능 변화가 일어나는 것으로, 이는 구성단위인 세포들의 기능 변화에 기인한다. 즉, 뇌의 신경세포 소실로 인해 인지기능이 저하된다든지, 피하 지방 세포의 소실로 피부의 탄력이 감소한다든지, 모근 멜라닌 세포가 멜라닌 색소 생성 능력을 소실함으로써 머리가 희어지는 등, 개체의 노화는 결국 그 개체를 구성하는 세포들의 노화에 기인한다.Aging refers to all the physiological changes of the body that occur over time. It is a life phenomenon that occurs in a wide variety of ways depending on the individual. It causes many diseases such as cancer, cardiovascular insufficiency, obesity, and non-alcoholic fatty liver Not only is it associated with degeneration of cells, tissues and organs, but also with the debilitating of most physiological performance limits. It is difficult to study aging at the individual level, since aging varies in appearance and speed from individual to individual and varies from organization to organization. On the other hand, when the aging phenomenon is specifically examined, functional changes of the constituent organs and tissues occur, which is caused by a change in the function of the constituent cells. That is, whether the cognitive function is lowered due to loss of brain nerve cells, the skin elasticity is reduced due to the disappearance of subcutaneous adipocytes, or the head is whitened by the loss of the melanin pigment production ability of the hair follicle melanin cells, Eventually, it is due to the aging of the cells that make up the individual.

한편, 단백질 키나아제 CKII (이하, CKII라 함)는 수많은 세포기질 및 핵 단백질의 인산화를 촉매화하는 보편적인 세린/트레오닌 키나아제이다. CKII는 2개의 활성 서브유닛(α 및/또는 α`) 및 두개의 조절 서브유닛(β 및 β`)으로 구성되었다. 조절 서브유닛인 β 및 β`은 4량체 형성 및 이에 따라 기질 인식을 유도함으로써, α 및 α` 서브유닛의 촉매활성을 유도한다. CKIIα 서브유닛의 과발현은 Myc 유전자의 과발현 마우스에서 종양을 형성하게 한다. 또한, 최근에 CKII는 세포 성장 및 증식뿐 아니라, 항-세포자멸활성(anti-apoptotic activities)에 중요한 역할을 한다는 것이 밝혀졌다. 보통의 초기의 세포에서, 세포분열 사이클은 제한된 숫자의 분열 후 중단된다. 상기 세포들은 비가역적인 세포 노화(cellular senescence)의 상태에 들어서게 된다. 세포 노화는 산화 스트레스 및 종양 형성 활성에 의하여 일어날 수 있다. 노화는 큰 납작한 세포 형상 및 노화-연관 β-갈락토시다제(galactosidase)활성(SA-β-gal)과 같은 분자 및 표현형에 의하여 규정할 수 있다. 인간 폐 CKII 활성은 늙은 인간 폐 섬유아 세포(IMR-90) 및 나이 든 랫트 조직에서 하향조절되고, CKII 활성을 억제하는 경우, 인간 섬유아 세포(IMR-90) 및 인간 대장암세포(HCT116)의 시기에 이른 노화가 유도된다는 것이 밝혀졌다. CKII의 억제에 의하여 유도된 노화에서 p53-p21Cip1/WAF1-RB 경로는 필수적이다. SIRT1(silent information regulator 2; Sir2 의 유사체)의 하향 조절에 의한 p53의 아세틸화 및 NADPH 옥시다제의 활성에 의한 초산화 음이온(Superoxide anion)의 생성은 CKII 억제에 의하여 노화된 세포에서 p53의 안정화의 상향 활성자로써 기능한다. 세포가 노화하는 동안 DNA 메틸화가 CKIIα 및 CKIIα` 유전자의 침묵(silencing)에 관련된다(Ambros, The functions of animal microRNAs, Nature 431 (2004) 350-355., 및 M. Ruzzene, L.A. Pinna, Addiction to protein kinase CK2: a common denominator of diverse cancer cells?, Biochim Biophys. Acta 2010 (1804) 499-504.). 그러나, 상기의 정확한 기작은 아직 밝혀지지 않았다.On the other hand, protein kinase CKII (hereinafter referred to as CKII) is a universal serine / threonine kinase that catalyzes the phosphorylation of numerous cell substrates and nuclear proteins. CKII consisted of two active subunits (alpha and / or alpha) and two regulatory subunits beta and beta. The regulatory subunits β and β 'induce catalytic activity of α and α` subunits by inducing tetramer formation and thus substrate recognition. Overexpression of the CKII [alpha] subunit causes tumors to form in the over-expressing mouse Myc gene. In addition, it has recently been shown that CKII plays an important role in anti-apoptotic activities as well as cell growth and proliferation. In normal early cells, the cell division cycle is stopped after a limited number of divisions. The cells become irreversible cellular senescence. Cell senescence can be caused by oxidative stress and tumorigenic activity. Aging can be defined by molecules and phenotypes such as large flat cell morphology and aging-associated [beta] -galactosidase activity (SA-beta-gal). Human pulmonary CKII activity is downregulated in old human lung fibroblasts (IMR-90) and aged rat tissues and decreases in human fibroblast (IMR-90) and human colorectal cancer cells (HCT116) It is found that early aging is induced. The p53-p21Cip1 / WAF1-RB pathway is essential in aging induced by inhibition of CKII. The uptake of p53 by acetylation of the SIRT1 (silent information regulator 2; analog of Sir2) and the production of superoxide anion by the activity of NADPH oxidase inhibited the stabilization of p53 in senescent cells by inhibition of CKII It functions as an upstream activator. The DNA methylation is involved in CKII α and silence (silencing) of CKII α` genes during cell aging (Ambros, The functions of animal microRNAs ,. Nature 431 (2004) 350-355, and M. Ruzzene, LA Pinna, Addiction to protein kinase CK2: a common denominator of diverse cancer cells ?, Biochim Biophys. Acta 2010 (1804) 499-504.). However, the precise mechanism described above is not yet known.

이에 본 발명자들은, 생체 내에서 miR-186, miR-216b, miR-337-3p 및 miR-760이 CKIIα의 발현을 억제하여 세포노화를 유발한다는 것을 확인하고, miR-186, miR-216b, miR-337-3p 및 miR-760를 억제함으로써, CKIIα 활성을 증가시켜, ROS의 생성을 억제하고, 이에 따라 p53 및 p21의 발현을 감소시켜 세포 노화를 억제한다는 것을 확인함으로써 본 발명을 완성하게 되었다.Thus, the present inventors confirmed that miR-186, miR-216b, miR-337-3p and miR-760 inhibit the expression of CKII alpha in vivo and induce cell senescence, by confirming that by inhibiting miR-337-3p, and miR-760, by increasing the CKII α activity, inhibit the production of ROS, thereby inhibiting cellular senescence by reducing the expression of p53 and p21, thereby completing the present invention .

따라서, 본 발명의 목적은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a composition for preventing or treating cell senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

본 발명은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물을 제공한다.The present invention provides a composition for preventing or treating cellular senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760 억제제는 세포에서 서로 조합하여, CKIIα 유전자의 발현을 증가시킴으로써, ROS의 생성을 억제하고, p53 및 p21의 발현을 억제함으로써 세포 노화를 예방 또는 치료하여 세포 노화 관련 질환에 대한 치료제로 유용하게 사용할 수 있다.The miR-186, miR-216b, miR-337-3p and miR-760 inhibitors of the present invention inhibit the production of ROS by increasing the expression of the CKII alpha gene in combination with each other in the cells and suppress the expression of p53 and p21 Thereby preventing or treating cell senescence and thus being useful as a therapeutic agent for diseases related to cell senescence.

도 1은 노화유도를 유발하는 miRNA의 서열 및 이의 표적서열인 CKIIα 3`UTR 서열을 나타낸 도이다.
도 2는 본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우, CKIIα의 단백질 발현 수준을 나타낸 도이다.
도 3은 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우, CKII 단백질의 활성 수준을 나타낸 도이다.
도 4는 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우, SA-β-gal 활성 수준을 나타낸 도이다.
도 5는 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우, p53 및 p21의 단백질 발현 수준을 나타낸 도이다.
도 6은 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우, 활성산소(ROS)의 생성 수준을 나타낸 도이다.
도 7은 HCT116 세포에 miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제자를 함께 처리한 경우, CKIIα의 단백질 발현 수준을 나타낸 도이다.
도 8은 miR-186, miR-216b, miR-337-3p 및 miR-760를 함께 HCT116 세포에 공-형질감염한 경우 또는 miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제자를 처리한 경우, 루시퍼아제 어세이의 결과를 나타낸 도이다.
도 9는 CKIIα siRNA를 HCT116 세포에 형질감염하고, miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제제를 처리한 경우, SA-β-gal 활성(A), p53 및 p21의 단백질 발현 수준(B) 및 활성산소(ROS)의 생성 수준(C)을 나타낸 도이다.
Figure 1 shows the sequences of miRNAs inducing senescence induction and their target sequence CKII < RTI ID = 0.0 >3'UTR< / RTI >
Figure 2 is a graph depicting protein expression levels of CKII alpha when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760 of the present invention.
Figure 3 is a graph showing the activity levels of CKII protein when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 4 shows SA-beta-gal activity levels when co-transfected into HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 5 shows protein expression levels of p53 and p21 when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 6 is a graph showing levels of production of reactive oxygen species (ROS) when co-transfected into HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
FIG. 7 is a graph showing the protein expression level of CKII a when HCT116 cells are treated with antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760.
Figure 8 shows the effect of co-transfection of miR-186, miR-216b, miR-337-3p and miR-760 co-transfected into HCT116 cells or of miR-186, miR- Figure 5 shows the results of luciferase assay when antisense inhibitors are treated.
Figure 9 shows that SA-β-gal activity (A), p53 and miR-186 were measured when HCT116 cells were transfected with CKIIα siRNA and antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR- (B) and active oxygen (ROS) production level (C) of p21.

본 발명은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating cell senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제는 CKIIα 유전자의 발현을 증가시키고, ROS의 생성을 억제하고, p53 및 p21의 발현을 억제하는 효과가 우수하다. 따라서, 본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제는 세포 노화 및 세포 노화 관련 질환의 예방 또는 치료에 유용하게 사용될 수 있다.Inhibitors of nucleic acid molecules composed of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention increase the expression of CKII alpha gene, inhibit the production of ROS and inhibit the expression of p53 and p21 . Accordingly, the inhibitor of the nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention can be usefully used for preventing or treating cell senescence and cell senescence-related diseases.

상기 세포 노화 관련 질환은 베체트병, 관절류머티즘, 교원병, 크론병, 궤양성 대장염, 간염, 신장염, 당뇨병, 백내장, 아토피성피부염, 기미, 주근깨, 주름, 골다공증등이 있으나, 이에 한정되지 않는다. The cell senescence-related diseases include but are not limited to Behcet's disease, arthritis rheumatism, collagen disease, Crohn's disease, ulcerative colitis, hepatitis, nephritis, diabetes, cataract, atopic dermatitis, spots, freckles, wrinkles and osteoporosis.

본 발명에서 이용할 수 있는 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제는 miR-186, miR-216b, miR-337-3p 및 miR-760에 대한 안티센스 서열로 구성될 수 있다. 바람직하게는 서열번호 1의 miR-186, 서열번호 2의 miR-216b, 서열번호 3의 miR-337-3p 및 서열번호 4의 miR-760 안티센스 서열을 갖는 억제제이다. 본 발명의 안티센스 서열은 18 내지 100nt(nucleotide)길이를 가질 수 있으며, 바람직하게는 19 내지 25nt 길이, 더욱 바람직하게는 21, 22 또는 23nt 길이를 가진다. Inhibitors of nucleic acid molecules comprised of miR-186, miR-216b, miR-337-3p and miR-760 that can be used in the present invention are antisense to miR-186, miR-216b, miR-337-3p and miR- Sequence. Preferably, miR-186 of SEQ ID NO: 1, miR-216b of SEQ ID NO: 2, miR-337-3p of SEQ ID NO: 3, and miR-760 antisense sequence of SEQ ID NO: The antisense sequence of the present invention may have a nucleotide length of 18 to 100 nt, preferably 19 to 25 nt, more preferably 21, 22 or 23 nt in length.

또한, 상기 안티센스 서열은 RNA, DNA, PNA(peptide nucleic acids) 또는 LNA(locked nucleic acid)와 같은 형태로 구성될 수 있다.In addition, the antisense sequence may be in the form of RNA, DNA, peptide nucleic acids (PNA), or locked nucleic acid (LNA).

또한, 본 발명에서 사용되는 miR-186, miR-216b, miR-337-3p 및 miR-760 억제제는 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 일부 염기서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, miR-186, miR-216b, miR-337-3p 및 miR-760 핵산분자의 억제제와 기능적으로 동일한 작용을 할 수 있는 변이체(variants)를 포함하는 개념이다.The miR-186, miR-216b, miR-337-3p, and miR-760 inhibitors used in the present invention may also be used as functional equivalents of the nucleic acid molecules constituting them, for example miR-186, miR- MiR-216b, miR-337-3p and miR-760 (SEQ ID NO: 2), although some base sequences of the 337-3p and miR-760 nucleic acid molecules were modified by deletion, substitution or insertion, Is a concept that includes variants that can function in the same way as an inhibitor of a nucleic acid molecule.

본 발명의 상기 핵산분자는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다. 또한, 본 발명의 조성물은 핵산 분자 자체뿐만 아니라, 세포 내에서 본 발명의 발현율을 증가시킬 수 있는 기타의 물질, 예를 들어 화합물, 천연물, 신규 단백질 등을 포함할 수 있다.The nucleic acid molecule of the present invention can be isolated or prepared using standard molecular biology techniques, such as chemical synthesis methods or recombinant methods, or commercially available. In addition, the composition of the present invention may contain not only the nucleic acid molecule itself, but also other substances capable of increasing the expression rate of the present invention in a cell, for example, a compound, a natural product, a novel protein and the like.

한편, 본 발명의 조성물 내 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제는 세포 내 발현을 위한 벡터에 포함되어 제공될 수 있다.Meanwhile, inhibitors of miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules in the composition of the present invention can be provided in a vector for intracellular expression.

본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제는 DNA 및 DEAE-덱스트란의 복합체, DNA 및 핵 단백질의 복합체, DNA 및 지질의 복합체 등의 다양한 형질전환 기술을 이용하여 세포 내로 도입시킬 수 있는데, 이를 위해 상기 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자는 세포 내로의 효율적인 도입을 가능하게 하는 전달체 내에 포함된 형태일 수 있다. 상기 전달체는 바람직하게는 벡터이며, 바이러스 벡터 및 비바이러스 벡터 모두 사용 가능하다. 바이러스 벡터(viral vector)로서 예를 들면, 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 및 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으며, 바람직하게는 렌티바이러스 벡터이지만, 이에 제한되는 것은 아니다. 렌티바이러스는 레트로바이러스의 일종으로 핵공(nucleopore)이나 완전한 핵막으로의 능동 도입을 가능하게 하는 사전-통합 복합체(바이러스 "쉘(shell)")의 친핵성으로 인해 분열 세포 뿐만 아니라 미분열 세포도 감염시킬 수 있는 특징이 있다.Inhibitors of the miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules of the present invention can be used in a variety of forms such as complexes of DNA and DEAE-dextran, complexes of DNA and nuclear proteins, complexes of DNA and lipids The miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules may be introduced into cells using transformation techniques, . The carrier is preferably a vector, and both viral vectors and non-viral vectors are usable. As the viral vector, for example, lentivirus, retrovirus, adenovirus, herpes virus and avipox virus vector can be used, Preferably a lentiviral vector, but is not limited thereto. Lentiviruses are a type of retrovirus that is not only a mitotic cell but also a mitotic cell due to the nucleophilicity of a nucleopore or a pre-integrated complex (a virus "shell") that allows active incorporation into a complete nuclear membrane There is a feature that can be made.

또한, 상기 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제를 포함하는 벡터는 선별마커를 추가로 포함하는 것이 바람직하다. 본 발명에서 용어 "선별마커(selection marker)"란 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산분자가 도입되어 형질전환된 세포의 선별을 용이하게 하기 위한 것이다. 본 발명의 벡터에서 사용할 수 있는 선별마커로는 벡터의 도입 여부를 용이하게 검출 또는 측정할 수 있는 유전자라면, 특별히 한정되지 않으나, 대표적으로 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 GFP(녹색 형광 단백질), 퓨로마이신(puromycin), 네오마이신(Neomycin: Neo), 하이그로마이신(hygromycin: Hyg), 히스티디놀 디하이드로게나제(histidinol dehydrogenase gene: hisD) 및 구아닌 포스포리보실트랜스퍼라제(guanine phosphosribosyltransferase: Gpt) 등이 있으며, 바람직하게는 GFP(녹색 형광 단백질) 및 퓨로마이신 마커를 사용할 수 있다.It is also preferred that the vector comprising the inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules further comprises a selectable marker. The term "selection marker" in the present invention is intended to facilitate selection of transformed cells with the introduction of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules. The selection marker which can be used in the vector of the present invention is not particularly limited as long as it is a gene capable of easily detecting or measuring the introduction of a vector, but it is typically a gene having resistance to drug resistance, nutritional requirement, cytotoxic agent, Such as GFP (green fluorescent protein), puromycin, neomycin (Neo), hygromycin (Hyg), histidinol Histidinol dehydrogenase gene hisD) and guanine phosphosribosyltransferase (Gpt). Preferably, GFP (green fluorescent protein) and puromycin marker can be used.

한편, 본 발명의 조성물 내 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제는 세포에 도입된 형태로 제공될 수 있다.Meanwhile, inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules in the composition of the present invention can be provided in a form introduced into a cell.

본 발명에서 용어 "도입"은 형질감염(transfection) 또는 형질도입(transduction)에 의해 외래 DNA를 세포로 유입시키는 것을 의미한다. 형질감염은 칼슘 포스페이트-DNA 공침전법, DEAE-덱스트란-매개 형질감염법, 폴리브렌-매개 형질감염법, 전기충격법, 미세주사법, 리포좀 융합법, 리포펙타민 및 원형질체 융합법 등의 당분야에 공지된 여러 방법에 의해 수행될 수 있다. 또한, 형질도입은 감염(infection)을 수단으로 하여 바이러스 또는 바이러스 벡터 입자를 사용하여 세포 내로 유전자를 전달시키는 것을 의미한다.The term "introduction" in the present invention means introduction of foreign DNA into a cell by transfection or transduction. The transfection can be carried out in the presence or absence of a sugar such as calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposomal fusion, lipofectamine and protoplast fusion Can be carried out by various methods known in the art. Transfection also refers to the transfer of genes into cells using virus or viral vector particles as a means of infection.

이러한 방법을 통해 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제가 도입된 세포는 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제가 높은 수준으로 발현할 수 있게 되며, 이러한 노화된 세포에 이식함으로써, 세포 노화를 억제시킬 수 있다. 그러므로, miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제가 도입된 세포를 포함하는 본 발명의 조성물은 세포 노화 관련 질환의 세포치료제로 이용될 수 있다.
Cells into which miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecule inhibitors were introduced by this method were identified as miR-186, miR-216b, miR-337-3p and miR- The inhibitor can be expressed at a high level, and transplantation into such aged cells can inhibit cell senescence. Therefore, the composition of the present invention comprising cells into which an inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules are introduced can be used as a cell therapy agent for a cell senescence-related disease.

한편, 본 발명의 miR-186, miR-216b, miR-337-3p 및 miR-760로 이루어진 핵산 분자의 억제제를 포함하는 조성물은 약학적으로 허용가능한 담체를 추가로 포함할 수 있으며, 담체와 함께 제제화될 수 있다. 본 발명에서 용어, "약학적으로 허용가능한 담체"란 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 말한다. 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로오스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.Meanwhile, a composition comprising an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention may further comprise a pharmaceutically acceptable carrier, Can be formulated. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not irritate the organism and does not interfere with the biological activity and properties of the administered compound. Examples of the pharmaceutical carrier which is acceptable for the composition to be formulated into a liquid solution include sterilized and sterile water, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

본 발명의 조성물은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산분자의 억제제를 유효성분으로 포함하는 어떠한 제형으로도 적용가능하며, 경구용 또는 비경구용 제형으로 제조할 수 있다. 본 발명의 약학적 제형은 구강(oral), 직장(rectal), 비강(nasal), 국소(topical; 볼 및 혀 밑을 포함), 피하, 질(vaginal) 또는 비경구(parenteral; 근육내, 피하 및 정맥내를 포함) 투여에 적당한 것 또는 흡입(inhalation) 또는 주입(insufflation)에 의한 투여에 적당한 형태를 포함한다.The composition of the present invention can be applied to any formulation containing an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient, and can be manufactured into an oral or parenteral formulation can do. The pharmaceutical formulations of the present invention may be administered orally, rectally, nasal, topical (including under the ball and tongue), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous And intravenous), or forms suitable for administration by inhalation or insufflation.

본 발명의 경구 투여용 제형으로는, 예를 들어 정제, 트로키제, 로렌지, 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 경질 또는 연질 캡슐, 시럽 또는 엘릭시르제로 제제화할 수 있다. 정제 및 캡슐 등의 제형으로 제제화하기 위해, 락토오스, 사카로오스, 소르비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제, 디칼슘 포스페이트와 같은 부형제, 옥수수 전분 또는 고구마 전분과 같은 붕괴제, 스테아르산 마스네슘, 스테아르산 칼슘, 스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유를 포함할 수 있으며, 캡슐제형의 경우 상기 언급한 물질 외에도 지방유와 같은 액체 담체를 더 함유할 수 있다.Formulations for oral administration of the present invention may be formulated, for example, as tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. A binder such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin, an excipient such as dicalcium phosphate, a disintegrating agent such as corn starch or sweet potato starch, Calcium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of a capsule formulation, in addition to the above-mentioned materials, a liquid carrier such as a fatty oil may be further contained.

본 발명의 비경구 투여용 제형으로는, 피하주사, 정맥주사 또는 근육내 주사 등의 사용 형태, 좌제 주입방식 또는 호흡기를 통하여 흡입이 가능하도록 하는 에어로졸제 등 스프레이용으로 제제화할 수 있다. 주사용 제형으로 제제화하기 위해서는 본 발명의 조성물을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알의 단위 투여용으로 제제화할 수 있다. 좌제로 주입하기 위해서는, 코코아버터 또는 다른 글리세라이드 등 통상의 좌약 베이스를 포함하는 좌약 또는 체료 관장제와 같은 직장투여용 조성물로 제제화할 수 있다. 에어로졸제 등의 스프레이용으로 제형화하는 경우, 분산된 농축물 또는 습윤 분말이 분산되도록 추진제 등이 첨가제와 함께 배합될 수 있다.
The formulation for parenteral administration of the present invention may be formulated for use such as subcutaneous injection, intravenous injection or intramuscular injection, suppository injection system, or aerosol formulation for allowing inhalation through a respiratory apparatus. For formulation into injectable formulations, the compositions of the present invention may be formulated as solutions or suspensions in water with stabilizers or buffers in water, and formulated for unitary administration of ampoules or vials. For injection into suppositories, it may be formulated into rectal compositions such as suppositories or enema preservatives, including conventional suppository bases such as cocoa butter or other glycerides. When formulated for spraying, such as an aerosol formulation, a propellant or the like may be formulated with the additive such that the dispersed concentrate or wet powder is dispersed.

또한, 본 발명은 miR-186, miR-216b, miR-337-3p 및 miR-760로 구성된 핵산 분자의 억제제를 포유동물에 투여하는 단계를 포함하는, 세포 노화 예방 또는 치료방법을 제공한다.The invention also provides a method of preventing or treating cellular senescence comprising the step of administering to a mammal an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760.

본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 포유동물에게 본 발명 miRNA 핵산분자의 억제제를 도입하는 것을 의미하며, miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제는 바이러스성 또는 비바이러스성 기술에 의한 운반 또는 miR-186, miR-216b, miR-337-3p 및 miR-760 핵산 분자의 억제제를 발현하는 세포의 이식을 포함한다. As used herein, the term "administering" means introducing an inhibitor of the miRNA nucleic acid molecule of the invention into mammals in any suitable manner, and the expression of miR-186, miR-216b, miR-337-3p and miR- Inhibitors include delivery by viral or non-viral techniques or transplantation of cells expressing inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules.

본 발명의 치료방법은 본 발명의 세포 노화 예방 또는 치료 조성물을 치료적 유효량으로 투여하는 것을 포함한다. 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다. 또한, 경우에 따라, 본 발명의 조성물과 함께 공지의 세포 노화 예방 또는 치료제를 병용 투여하여 항암 효과를 증대시킬 수 있다.The method of treatment of the present invention comprises administering a therapeutically effective amount of the composition for preventing or treating cellular senescence of the present invention. It will be apparent to those skilled in the art that the appropriate total daily dose may be determined by the practitioner within the scope of sound medical judgment. The specific therapeutically effective amount for a particular patient will depend upon a variety of factors, including the type and extent of the response to be achieved, the specific composition, including whether or not other agents are used, the age, weight, general health status, sex and diet, The route of administration and the fraction of the composition, the duration of the treatment, the drugs used or co-used with the specific composition, and the like, well known in the medical arts. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned factors. In addition, the anticancer effect can be enhanced by administering a combination of the composition of the present invention and a known prophylactic or therapeutic agent for cell senesis.

본 발명의 암의 치료 방법은 세포 노화 관련 질환에 걸린 임의의 포유동물에 적용가능하며, 포유동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
The method of treating cancer of the present invention is applicable to any mammal afflicted with a cell senescence-related disease, and the mammal includes not only humans and primates but also livestock such as cows, pigs, sheep, horses, dogs and cats.

이하, 본 발명을 실시예에 의하여 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

[[ 실시예Example 1]  One] miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760의 -760 CKIICKII α의 조절 확인.Confirmation of α.

1. 재료 및 준비.1. Materials and Preparation.

HCT116 인간 대장암 세포를 10%의 FBS(fetal bovine serum)를 포함하는 DMEM(Dulbecco's modified Eagle's medium)에서 5 %의 CO2, 37℃의 조건으로 배양하였다. miR-186, miR-216b, miR-337-3p 및 miR-760 모방체 및 대조군 miRNA를 Genolution Inc(Seoul, Korea)에서 구입하여 사용하였다. 상기 네 개의 miRNA들의 안티센스 저해제를 Panagene Inc(Seoul, Korea)로부터 구입하였고, 하기의 실험 시 사용한 안티센스 저해제의 구조를 표 1에 나타내었고, 이의 안티센스 서열을 서열번호 1 내지 4로 나타내었다.HCT116 human colon cancer cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS (fetal bovine serum) at 5% CO 2 at 37 ° C. miR-186, miR-216b, miR-337-3p and miR-760 mimic and control miRNA were purchased from Genolution Inc (Seoul, Korea) and used. Antisense inhibitors of the four miRNAs were purchased from Panagene Inc (Seoul, Korea). The structures of the antisense inhibitors used in the following experiments are shown in Table 1, and their antisense sequences are shown in SEQ ID NOS: 1 to 4.

안티센스Antisense 억제제의 구조 Structure of inhibitor miRmiR -186 -186 안티센스Antisense 억제제 Inhibitor RRRQRRKKRRRRRQRRKKRR -- OOOO -- CCAAAAGGAGAATTCTTTCCAAAAGGAGAATTCTTT miRmiR -216b -216b 안티센스Antisense 억제제 Inhibitor RRRQRRKKRRRRRQRRKKRR -- OOOO -- TTGCCTGCAGAGATTTTGCCTGCAGAGATT miRmiR -337-3p -337-3p 안티센스Antisense 억제제 Inhibitor RRRQRRKKRRRRQRRKKR -- OOOO -- GAAAGGCATCATATAGGAGAAAGGCATCATATAGGA miRmiR -760 -760 안티센스Antisense 억제제 Inhibitor RRRQRRKKRRRRRQRRKKRR -- OOOO -- TCCCCACAGACCCAGAGCCGTCCCCACAGACCCAGAGCCG

(표 1에서 RRRQRRKKRR는 세포 투과 펩타이드(cell penetrating peptide)이고, OO는 AEEA 링커이다)(In Table 1, RRRQRRKKRR is a cell penetrating peptide and OO is an AEEA linker)

상기 miRNA들을 리포펙타민 RNAi max(Invitrogen, Carlsbad, CA)를 이용하여 최종농도 40nM로 HCT116 세포에 형질감염(transfection)하였다. 형질감염된 세포는 기존논문 FEBS Lett. 585 (2011) 3360-3366(S.Y. Jang, S.Y. Kim, Bae, Y.S. p53 deacetylation by SIRT1 decreases during protein kinase CKII downregulation-mediated cellular senescence)의 방법에 따라 제조하였다. 형질감염 48시간 후, 세포들을 수확하였다.
The miRNAs were transfected into HCT116 cells at a final concentration of 40 nM using lipofectamine RNAi max (Invitrogen, Carlsbad, Calif.). The transfected cells were analyzed by the conventional method FEBS Lett. P53 deacetylation by SIRT1 during protein kinase CKII downregulation-mediated cellular senescence). Forty-eight hours after transfection, cells were harvested.

2. 2. HCT116HCT116 인간 대장암 세포에서  In human colon cancer cells 웨스턴Western 브롯팅을Brotting 이용한  Used miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 에 의한 By -760 CKIICKII α의 발현 억제 확인α suppression

단백질 수준에서 miR-186, miR-216b, miR-337-3p 및 miR-760에 의하여, CKIIα의 발현이 억제됨을 확인하기 위하여, 웨스턴 브롯팅을 수행하였다. At the protein level Western blotting was performed to confirm that the expression of CKII alpha was inhibited by miR-186, miR-216b, miR-337-3p and miR-760.

보다 구체적으로, 접시에서 형질감염된 세포들을 차가운 PBS로 세척하고, 고무찰자(rubber policeman)로 스크래핑(scraping)하여 상기 세포를 수집하고, 100 μl의 차가운 RIPA(radio immunoprecipitation assay) 완충액[50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.5 mM PMSF, 1 μg/ml aprotinin, 1 μg/ml leupeptin, 1 μg/ml pepstatin]에서 세포를 용해시켰다. Bradford protein dye reagent (Bio-Rad, Hercules, CA)를 이용하여 상청액의 단백질 농도를 결정하였다. 상기 상청액을 동등한 단백질 농도로 맞추었고, 공지된 방법에 의하여 면역 블롯팅을 수행하였다. 이때, Santa Cruz Biotechnology (Santa Cruz, CA)에서 구입한 CKIIα, CKIIβ, p53, p21Cip1/WAF1, 및 β-actin에 특이적인 항체를 사용하였고, 항-HA 항체로 Roche(Basel, switzerland)에서 구입한 것을 사용하였다. 노화유도를 유발하는 miRNA의 서열 및 이의 표적서열인 CKIIα 3`UTR 서열은 도 1에 나타내었고, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체를 모두 공-형질감염한 세포에서 CKIIα의 단백질 발현 수준을 도 2에 나타내었다.More specifically, the cells transfected in the dish were washed with cold PBS, scraped with a rubber policeman to collect the cells and washed with 100 μl of cold radioimmunoprecipitation assay (RIPA) buffer [50 mM Tris- Cells were cultured in HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.5 mM PMSF, 1 μg / ml aprotinin, 1 μg / ml leupeptin, 1 μg / ml pepstatin . The protein concentration of the supernatant was determined using a Bradford protein dye reagent (Bio-Rad, Hercules, Calif.). The supernatant was adjusted to an equivalent protein concentration and immunoblotting was performed by known methods. At this time, antibodies specific for CKIIα, CKIIβ, p53, p21Cip1 / WAF1, and β-actin purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.) Were used and anti-HA antibodies purchased from Roche (Basel, Switzerland) . The sequences of miRNAs inducing senescence induction and its target sequence, CKII? 3'UTR sequence are shown in FIG. 1 and miR-186, miR-216b, miR-337-3p and miR-760 mimics are all co- The level of protein expression of CKII a in one cell is shown in Fig.

도 2에 나타난 바와 같이, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체를 모두 공-형질감염한 세포에서 CKIIα의 단백질 발현 수준이 음성대조군에 비하여 50% 까지 감소함을 확인하였고, 양성대조군인 CKIIα에 대한 siRNA를 형질감염한 세포와 비교하여 단백질 발현 수준이 거의 동일하게 감소함을 확인하였다.As shown in Fig. 2, the expression levels of CKII [alpha] in cells co-transfected with miR-186, miR-216b, miR-337-3p and miR-760 mimics were reduced to 50% , And the expression level of the protein was substantially reduced compared with cells transfected with siRNA against CKII a positive control group.

상기의 결과 miR-186, miR-216b, miR-337-3p 및 miR-760가 CKIIα의 발현을 억제함을 확인하여, 상기 miR-186, miR-216b, miR-337-3p 및 miR-760가 세포의 노화를 유발할 수 있음을 확인하였다.
The above result confirming that miR-186, miR-216b, miR-337-3p and miR-760 suppress the expression of CKII alpha, miR-186, miR-216b, miR-337-3p and miR-760 can induce cell senescence.

3. 3. miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 -760 모방체의Imitative CKIICKII 단백질 억제 활성 측정 Measurement of protein inhibitory activity

miR-186, miR-216b, miR-337-3p 및 miR-760의 세포 노화와 관련된 역할을 확인하기 위하여, [γ-32P]ATP 및 1mM의 합성 CKII 펩티드 기질(펩티드 서열:RRREEETEEE)을 이용하여 CKII 단백질의 포스포트랜스퍼라제(phosphotransferase) 활성을 측정하였다. 이의 결과를 도 3에 나타내었다. To confirm the role of miR-186, miR-216b, miR-337-3p and miR-760 in cell senescence, [γ-32P] ATP and 1 mM of synthetic CKII peptide substrate (peptide sequence: RRREEETEEE) The phosphotransferase activity of the CKII protein was measured. The results are shown in Fig.

도 3에 나타난 바와 같이, 4개의 miRNA를 형질감염한 세포들의 추출물에서 CKII 단백질활성은, miRNA를 도입하지 않은 대조군의 추출물에 비하여 40%까지 저하됨을 확인하였다.
As shown in Fig. 3, the activity of CKII protein in the extracts of cells transfected with four miRNAs was found to be lowered to 40% as compared with that of the control without miRNA.

[[ 실시예Example 2]  2] HCT116HCT116 인간 대장암 세포에서  In human colon cancer cells miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 -760 모방체의Imitative 노화  Aging 유발능Inducibility 확인 Confirm

1.One. miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 -760 모방체의Imitative SASA -β--β- galgal 활성 확인 Verify Active

miR-186, miR-216b, miR-337-3p 및 miR-760 모방체가 대장암 세포에서 노화를 유발한다는 사실을 확인하기 위하여, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체를 2일 동안, 형질감염 후, SA-β-gal 활성을 측정하였다. 상기 측정방법은 기존 논문인 FEBS Lett. 584 (2010) 3137-3142(S.M. Jeon, S.J. Lee, T.K. Kwon, et al., NADPH oxidase is involved in protein kinase CKII downregulation-mediated senescence through elevation of the level of reactive oxygen species in human colon cancer cells)에 따랐다. 상기 SA-β-gal 활성을 측정결과를 도 4에 나타내었다.In order to confirm that miR-186, miR-216b, miR-337-3p and miR-760 mimic induce senescence in colon cancer cells, miR-186, miR-216b, miR-337-3p and miR- After 2 days of transfection, transfection, SA-β-gal activity was measured. The measurement method is described in FEBS Lett. 584 (2010) 3137-3142 (SM Jeon, SJ Lee, TK Kwon, et al., NADPH oxidase is involved in protein kinase CKII downregulation-mediated senescence through elevation of the levels of reactive oxygen species in human colon cancer cells) . The result of measurement of SA-beta-gal activity is shown in FIG.

도 4에 나타난 바와 같이, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체를 공-형질감염한 HCT116 세포에서 SA-β-gal은, 상기 miRNA들을 형질감염하지 않은 HCT116 세포에 비하여, 현저히 잘 염색됨을 확인하였다. 상기 결과를 통해, SA-β-gal의 높은 활성은 세포 노화의 지표로 이용할 수 있으므로, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체는 대장암 세포에서 세포 노화를 유발한다는 것을 알 수 있다.As shown in Fig. 4, in the HCT116 cells co-transfected with the miR-186, miR-216b, miR-337-3p and miR-760 mimetics, SA-β-gal inhibited the miRNAs with non- transfected HCT116 The cells were stained significantly better than the cells. The above results indicate that the high activity of SA-β-gal can be used as an indicator of cell senescence, so that miR-186, miR-216b, miR-337-3p and miR-760 mimetics can inhibit cell senescence in colorectal cancer cells .

2.2. miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 -760 모방체의Imitative p53p53  And p21p21 Cip1Cip1 // WAF1WAF1 발현 증진 효과 확인Confirmation of expression enhancement effect

miR-186, miR-216b, miR-337-3p 및 miR-760 모방체가 대장암 세포에서 노화를 유발한다는 사실을 확인하기 위하여, 실시예 2와 동일한 방법으로 웨스턴 블롯팅을 수행하였다. 이 때, p53 및 p21Cip1 / WAF1 에 특이적인 항체를 이용하였고, 웨스턴 블롯 결과를 도 5에 나타내었다.Western blotting was carried out in the same manner as in Example 2 to confirm that miR-186, miR-216b, miR-337-3p and miR-760 mimetics cause senescence in colon cancer cells. At this time, p53 and p21 Cip1 / WAF1 , And Western blot results are shown in Fig.

도 5에 나타난 바와 같이, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체가 공-형질감염된 HCT116 세포에서 p53 및 p21Cip1 / WAF1단백질 발현은, 공-형질감염하지 않은 대조군에 비하여, 증가함을 확인하였다. 상기 결과를 통해, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체가 상호협력하여, CKII 유전자의 발현을 억제하여, p53 및 p21의 발현을 증가시켜 세포 노화를 일으킬 수 있음을 알 수 있다.As shown in Figure 5, p53 and p21 Cip1 / WAF1 protein expression in co-transfected HCT116 cells with miR-186, miR-216b, miR-337-3p and miR-760 mimetics, Compared to the control group. The results show that miR-186, miR-216b, miR-337-3p and miR-760 mimetics cooperate to form CKII It is possible to inhibit the expression of the gene and increase the expression of p53 and p21 to cause cell senescence.

3. miR -186, miR -216b, miR -337-3p 및 miR -760 모방체의 ROS (활성산소) 생성능 확인 3 . miR- 186 , miR- 216b, miR- 337-3p, and miR- 760 mimetics Determination of ROS (active oxygen) production

CKII를 억제하여 세포노화가 유되된 세포에서, ROS 생성은 p53 안정화의 상향 활성자로 알려졌다. 따라서, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체가 ROS 생성을 유도하는지 확인하기 위하여, HCT116 세포들을 CM-H2DCFDA 또는 DHE에서 배양하여 디클로로플루오레세인디아세테이트(DCF) 및 ETH 형광 이미지를 통하여 ROS 생성을 확인하였다. 이의 결과를 도 6에 나타내었다.  In cells with suppressed CKII and aged cells, ROS production is known to be an up-regulator of p53 stabilization. Thus, in order to determine whether miR-186, miR-216b, miR-337-3p and miR-760 mimics induce ROS production, HCT116 cells were cultured in CM-H2DCFDA or DHE to produce dichlorofluorescein diacetate (DCF) ROS production was confirmed by ETH fluorescent image. The results are shown in Fig.

도 6에 나타난 바와 같이, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체를 공-형질전환 또는 상기 miRNA를 모두 처리한 HCT116 세포에서 과산화수소(hydrogen peroxide) 및 초과산화 음이온(superoxide anion)의 수준은, 상기 miRNA를 공-형질전환하지 않은 대조군 또는 상기 miRNA를 처리하지 않은 대조군에 비하여, 유의적으로 증가함을 확인하였다.As shown in FIG. 6, in HCT116 cells co-transfected with the miR-186, miR-216b, miR-337-3p and miR-760 mimetics or both miRNAs were treated with hydrogen peroxide and excess oxidation anion the level of superoxide anion was significantly increased compared to the control group in which the miRNA was not co-transformed or the miRNA-treated control group Respectively.

상기 결과를 통하여, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체는 CKII를 억제하여 ROS의 생성을 유도하는 것을 알 수 있다.
These results show that miR-186, miR-216b, miR-337-3p, and miR-760 mimics induce the production of ROS by inhibiting CKII.

[[ 실시예Example 3]  3] HCT116HCT116 인간 대장암 세포에서  In human colon cancer cells miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -760 억제제의 세포 노화 예방 또는 치료 효과 확인.-760 inhibitor to prevent cell senescence or to confirm the therapeutic effect.

1.One. HCT116HCT116 인간 대장암 세포에서  In human colon cancer cells 웨스턴Western 브롯팅을Brotting 이용한  Used miRmiR -186, -186, miRmiR -216b, miR-337-3p 및 -216b, miR-337-3p and miRmiR -- 760 의760's 안티센스Antisense 억제제에 의한  By inhibitor CKIICKII αalpha 발현양Expression level 증가 확인 Confirm increase

상기 miRNA 억제제가 세포의 노화를 억제할 수 있는지에 대하여 확인하기 위하여, 세포에 표 1의 miRNA의 안티센스 억제제를 처리하여 CKIIα의 단백질 발현 수준을 확인하였다. 이의 결과를 도 7에 나타내었다To confirm whether the miRNA inhibitor could inhibit cell senescence, the cells were treated with an antisense inhibitor of the miRNA of Table 1 to determine the protein expression level of CKII a . The results are shown in Figure 7

도 7에 나타난 바와 같이, miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제제를 처리하는 경우, 대조군 세포에 비해 CKIIα의 단백질 발현 수준이 증진됨을 확인하였다.
As shown in Fig. 7, when the antisense inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 was treated, the level of protein expression of CKII a was enhanced compared to the control cells.

2.2. 루시퍼라제Luciferase 어세이를Assay 이용한 Used miRmiR -186, -186, miRmiR -216b, -216b, miRmiR -337-3p 및 -337-3p and miRmiR -- 760 의760's 안티센스Antisense 억제제에  Inhibitors CKIICKII α의 발현 증가 확인α increased expression

인간의 CKIIα mRNA의 3`UTR을 siCHECK-2 vector (Promega)의 제한 효소 절단 부위인 XhoI/NotI에 삽입함으로써 CKIIα 3`UTR 리포터를 생성하였고, 상기 제한 효소 절단 부위는 레닐라(Renilla) 루시퍼라제 유전자의 다운스트림에 위치한다. 보다 구체적으로, CKIIα의 3` UTR을 증폭을 위하여, 하기의 표 2의 프라이머를 이용하여 PCR을 이용하였고, 이를 siCHECK-2 vector (Promega)에 삽입하여, 세포에 형질감염하였다. CKIIα 3`UTR 리포터가 형질감염된 1 x 105 세포에 miR-186, miR-216b, miR-337-3p 및 miR-760를 공-형질감염하여, 제조자의 프로토콜에 따라, Lipofectamine 2000(invitrogen)을 이용하여 24-웰 플레이트에 두었다. 또한, miR-186, miR-216b, miR-337-3p 및 miR-760 의 안티센스 억제제를 처리한 후, 루시퍼라제 어세이(promega)를 이용하여 반닷불 및 레닐라 루시퍼라제 활성을 측정하였다. 이의 결과를 도 8에 나타내었다.The 3'UTR of human CKII alpha mRNA was inserted into the restriction enzyme cleavage site XhoI / NotI of the siCHECK-2 vector (Promega) to generate a CKII [alpha] 3'UTR reporter. The restriction enzyme cleavage site was Renilla [ It is located downstream of the luciferase gene. More specifically, PCR was performed using the primers shown in Table 2 below to amplify 3 ' UTR of CKII a, which was then transfected into siCHECK-2 vector (Promega). CKII α 3`UTR reporter transfected cells to 1 x 10 5 miR-186, miR-216b, miR-337-3p , and miR-760 a co-transfected with, in the manufacturer's protocol And then placed on a 24-well plate using Lipofectamine 2000 (Invitrogen). In addition, antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 were treated and then half-lit and renilla luciferase activity were measured using luciferase assay (promega). The results are shown in Fig.

프라이머primer 서열order 서열번호SEQ ID NO: CKIICKII α 3`α 3` UTRUTR 정방향  Forward 프라이머primer 5`-AATCTCGAGCGGCCCTATCTGTCTCCTGAT-3`5`-AATCTCGAGCGGCCCTATCTGTCTCCTGAT-3` 서열번호 5SEQ ID NO: 5 CKIICKII α 3`α 3` UTRUTR 역방향  Reverse 프라이머primer 5`-TCGCGGCCGCCACCAAAGAATTCCAACACTGGATC-3`5`-TCGCGGCCGCCACCAAAGAATTCCAACACTGGATC-3` 서열번호 6SEQ ID NO: 6

도 8에 나타난 바와 같이, 상기 miR-186, miR-216b, miR-337-3p 및 miR-760 를 공-형질감염한 HCT116 세포에서, 다른 miRNA를 형질감염한 대조군과 비교하여 루시퍼라제 활성이 55% 감소함을 확인하였고, miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제제를 처리한 경우, 처리하지 않은 군과 비교하여 루시퍼라제 활성이 220% 증가함을 확인하였다.As shown in Fig. 8, in HCT116 cells co-transfected with miR-186, miR-216b, miR-337-3p and miR-760, luciferase activity was 55 % And that the antisense inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 was treated with a 220% increase in luciferase activity compared to the untreated group .

상기 결과에 의해, miR-186, miR-216b, miR-337-3p 및 miR-760는 CKIIα의 3`UTR 부위를 특이적으로 표적화하여 CKIIα mRNA의 안정성을 감소시킴으로써, 이의 발현을 억제함을 확인하였고, 상기 miRNA의 억제제는 CKIIα의 발현을 증가시켜, 세포 노화 예방 또는 치료 효과가 있음을 확인하였다.By by the result, miR-186, miR-216b , miR-337-3p , and miR-760 are targeted to the site of the CKII 3`UTR α specifically to decrease the stability of the CKII α mRNA, suppress its expression And the inhibitor of the miRNA increased the expression of CKII alpha, confirming that it has the effect of preventing or treating cell senescence.

3. CK Ⅱ-매개 노화 유도 모델에서 miR -186, miR -216b, miR -337-3p 및 miR -760 모방체의 안티센스 RNA 의 노화 유도 억제 확인 3 . CK Ⅱ- in mediating aging induced model miR -186, miR -216b, miR -337-3p of -760 and miR mimics Antisense Confirmation of aging induction inhibition of RNA

miR-186, miR-216b, miR-337-3p 및 miR-760 억제제가 CKⅡ를 발현을 증가시켜 노화를 예방 또는 치료한다는 것을 확인하기 위하여, CKⅡα의 siRNA를 HCT116 세포에 형질감염하였고, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체의 안티센스 억제제를 처리하여, 실시예 2의 방법을 수행하였다. 이의 결과를 도 9에 나타내었다. miR-186, miR-216b, miR-337-3p and miR-760 inhibitors increase expression of CK II to prevent or treat aging , The siRNA of CKIIa was transfected into HCT116 cells and the method of Example 2 was performed by treating antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 mimics . The results are shown in Fig.

도 9 A에 나타난 바와 같이, CKⅡα의 siRNA를 형질감염한 세포의 경우, siRNA를 쪼개서 처리한 대조군에 비하여, SA-ß-gal 활성이 유의적으로 증가함을 확인하였고, 이 후, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체의 안티센스 엑제제를 처리한 경우, SA-ß-gal 활성이 원래 수준으로 회복됨을 확인하였다.As shown in Fig. 9A, in the case of cells transfected with siRNA of CKII?, It was confirmed that the SA-ß-gal activity was significantly increased as compared with the siRNA cleaved control, and miR-186 , the miR-216b, miR-337-3p, and miR-760 mimetics, the SA-ß-gal activity was restored to its original level.

도 9의 B에 나타난 바와 같이, CKⅡα의 siRNA를 형질감염한 세포의 경우, siRNA를 쪼개서 처리한 대조군에 비하여, p53 및 p21Cip1 / WAF1의 발현이 증가함을 확인하였고, 이 후, miR-186, miR-216b, miR-337-3p 및 miR-760 모방체의 안티센스 억제제를 처리한 경우, p53 및 p21Cip1 / WAF1의 발현이 원래의 수준으로 회복됨을 확인하였다.As shown in Fig. 9B, it was confirmed that expression of p53 and p21 Cip1 / WAF1 was increased in cells transfected with siRNA of CKII? Compared with the siRNA cleaved control, and then miR-186 , miR-216b, miR-337-3p and miR-760 mimetics, the expression of p53 and p21 Cip1 / WAF1 recovered to their original levels.

도 9의 C에 나타난 바와 같이, CKⅡα의 siRNA를 형질감염한 세포의 경우, siRNA를 쪼개서 처리한 대조군에 비하여, ROS의 생성이 증가함을 확인하였고, 이 후, miR-186, miR-216b, miR-337-3p 및 miR-760의 안티센스 억제제를 처리한 경우, ROS의 생성이 본래의 수준으로 회복됨을 확인하였다.As shown in Fig. 9C, it was confirmed that the cells transfected with siRNA of CKII? Increased the production of ROS compared to the siRNA cleaved control, and then miR-186, miR-216b, When antisense inhibitors of miR-337-3p and miR-760 were treated, the production of ROS was restored to its original level.

상기 결과는 miR-186, miR-216b, miR-337-3p 및 miR-760 모방체의 안티센스 엑제제가 CKⅡ에 의하여 노화가 유도된 세포의 노화를 억제할 수 있음을 나타낸다.These results indicate that the antisense excipients of miR-186, miR-216b, miR-337-3p and miR-760 mimetics can inhibit senescence-induced senescence by CK II.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760 <130> P-1335 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-186 antisense sequence <400> 1 ccaaaaggag aattcttt 18 <210> 2 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> it is miR-216b antisense sequence <400> 2 ttgcctgcag agatt 15 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-337-3p antisense sequence <400> 3 gaaaggcatc atatagga 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> it is miR-760 antisense sequence <400> 4 tccccacaga cccagagccg 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3`UTR forward primer sequence <400> 5 aatctcgagc ggccctatct gtctcctgat 30 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3`UTR reverse primer sequence <400> 6 tcgcggccgc caccaaagaa ttccaacact ggatc 35 <110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Compositon for anti-aging of cells comprising miR-186, miR-216b,          miR-337-3p and miR-760 <130> P-1335 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-186 antisense sequence <400> 1 ccaaaaggag aattcttt 18 <210> 2 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> it is miR-216b antisense sequence <400> 2 ttgcctgcag agatt 15 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-337-3p antisense sequence <400> 3 gaaaggcatc atatagga 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> it is miR-760 antisense sequence <400> 4 tccccacaga cccagagccg 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3 'UTR forward primer sequence <400> 5 aatctcgagc ggccctatct gtctcctgat 30 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3 'UTR reverse primer sequence <400> 6 tcgcggccgc caccaaagaa ttccaacact ggatc 35

Claims (15)

삭제delete 삭제delete 삭제delete 삭제delete 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제를 유효성분으로 포함하는 세포 노화 관련 질환의 예방 또는 치료용 약학 조성물에 있어서, 상기 세포 노화 관련 질환은 베체트병, 관절류머티즘, 교원병, 궤양성 대장염, 간염, 신장염, 당뇨병, 백내장, 아토피성피부염, 기미, 주근깨, 주름 및 골다공증으로 이루어진 군으로부터 선택된 1종 이상인, 세포 노화 관련 질환의 예방 또는 치료용 약학 조성물.A miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, and a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: -760 inhibitor as an active ingredient, wherein the cell senescence-related disease is selected from the group consisting of Behcet's disease, joint rheumatism, collagen disease, ulcerative colitis, hepatitis, nephritis, diabetes, cataract, Dermatitis, rash, spots, freckles, wrinkles, and osteoporosis. 제 5항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 단백질 키나아제인 CKIIα의 발현을 증가시키는 것을 특징으로 하는, 세포 노화 관련 질환의 예방 또는 치료용 약학 조성물.7. The method according to claim 5, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, Wherein the miR-760 inhibitor comprising the nucleotide sequence of SEQ ID NO: 4 increases the expression of the protein kinase CKIIa. 제 5항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 활성산소의 생성을 감소시키는 것을 특징으로 하는, 세포 노화 관련 질환의 예방 또는 치료용 약학 조성물.7. The method according to claim 5, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, Wherein the miR-760 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 4 reduces the production of reactive oxygen species. 제 5항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 p53 및 p21의 발현을 감소시키는 것을 특징으로 하는, 세포 노화 관련 질환의 예방 또는 치료용 약학 조성물.7. The method according to claim 5, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, Wherein the miR-760 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 4 is reduced in the expression of p53 and p21. 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제의 유효량을 포함하는 조성물을 인간을 제외한 포유동물에 투여하는 단계를 포함하는 세포 노화 관련 질환의 예방 또는 치료 방법에 있어서, 상기 세포 노화 관련 질환은 베체트병, 관절류머티즘, 교원병, 크론병, 궤양성 대장염, 간염, 신장염, 당뇨병, 백내장, 아토피성피부염, 기미, 주근깨, 주름 및 골다공증으로 이루어진 군으로부터 선택된 1종 이상인, 세포 노화 관련 질환의 예방 또는 치료 방법.A miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, and a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: -760 inhibitor is administered to a mammal other than a human, comprising the step of administering to a mammal other than a human a composition for preventing or treating a cell senescence-related disease, said cell senescence-related disease comprising Behcet's disease, joint rheumatism, , At least one selected from the group consisting of ulcerative colitis, hepatitis, nephritis, diabetes, cataract, atopic dermatitis, spots, freckles, wrinkles and osteoporosis. 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제를 유효성분으로 포함하는 화장료 조성물.A miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, and a miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: -760 inhibitor as an active ingredient. 제 10항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 단백질 키나아제인 CKIIα의 발현을 증가시키는 것을 특징으로 하는, 조성물.The method of claim 10, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, RTI ID = 0.0 &gt; miR-760 &lt; / RTI &gt; inhibitor consisting of the nucleotide sequence of SEQ ID NO: 4 increases expression of the protein kinase CKIIa. 제 10항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 활성산소의 생성을 감소시키는 것을 특징으로 하는, 조성물.The method of claim 10, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, RTI ID = 0.0 &gt; miR-760 &lt; / RTI &gt; inhibitor consisting of the nucleotide sequence of SEQ ID NO: 제 10항에 있어서, 상기 서열번호 1의 염기서열로 구성된 miR-186 억제제, 서열번호 2의 염기서열로 구성된 miR-216b 억제제, 서열번호 3의 염기서열로 구성된 miR-337-3p 억제제 및 서열번호 4의 염기서열로 구성된 miR-760 억제제는 p53 및 p21의 발현을 감소시키는 것을 특징으로 하는, 조성물.The method of claim 10, wherein the miR-186 inhibitor consisting of the nucleotide sequence of SEQ ID NO: 1, the miR-216b inhibitor consisting of the nucleotide sequence of SEQ ID NO: 2, the miR-337-3p inhibitor consisting of the nucleotide sequence of SEQ ID NO: 3, Gt; miR-760 &lt; / RTI &gt; inhibitor consisting of the nucleotide sequence of SEQ ID NO: 4 reduces the expression of p53 and p21. 삭제delete 삭제delete
KR1020120136577A 2012-11-28 2012-11-28 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760 KR101527749B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120136577A KR101527749B1 (en) 2012-11-28 2012-11-28 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120136577A KR101527749B1 (en) 2012-11-28 2012-11-28 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760

Publications (2)

Publication Number Publication Date
KR20140068731A KR20140068731A (en) 2014-06-09
KR101527749B1 true KR101527749B1 (en) 2015-06-12

Family

ID=51124422

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120136577A KR101527749B1 (en) 2012-11-28 2012-11-28 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760

Country Status (1)

Country Link
KR (1) KR101527749B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210082305A (en) * 2019-12-24 2021-07-05 경북대학교 산학협력단 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110301091A1 (en) * 2008-11-03 2011-12-08 Giammaria Giuliani Compositions and methods for reducing the signs of aging of the skin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110301091A1 (en) * 2008-11-03 2011-12-08 Giammaria Giuliani Compositions and methods for reducing the signs of aging of the skin

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Cell. 2007. Vol.129, pp.1401-1414. *
Cell. 2007. Vol.129, pp.1401-1414.*
Molecules and Cells. 2009. Vol.28, No.4, pp.341-345. *
Molecules and Cells. 2009. Vol.28, No.4, pp.341-345.*

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210082305A (en) * 2019-12-24 2021-07-05 경북대학교 산학협력단 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors
KR102304041B1 (en) * 2019-12-24 2021-09-24 경북대학교 산학협력단 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors

Also Published As

Publication number Publication date
KR20140068731A (en) 2014-06-09

Similar Documents

Publication Publication Date Title
US10633659B2 (en) C/EBPα short activating RNA compositions and methods of use
US20160187319A1 (en) Cell death-inducing agent, cell growth-inhibiting agent, and pharmaceutical composition for treatment of disease caused by abnormal cell growth
US11976280B2 (en) SMAC/Diablo inhibitors useful for treating cancer
Huang et al. LncRNA PVT1 knockdown affects proliferation and apoptosis of uveal melanoma cells by inhibiting EZH2.
CN114585384A (en) Compositions and methods using C/EBP alpha sarRNA
CN112543809A (en) Combination therapy comprising C/EBP alpha sarRNA
US20110124712A1 (en) Anti-cancer composition comprising microrna molecules
Zhang et al. G protein alpha S subunit promotes cell proliferation of renal cell carcinoma with involvement of protein kinase A signaling
KR101413581B1 (en) Compositon for preventing or treating cancer comprising miR-186, miR-216b, miR-337-3p and miR-760
US20150344887A1 (en) siRNA FOR INHIBITION OF USP15 EXPRESSION AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME
KR101527749B1 (en) Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760
US9295709B2 (en) Pharmaceutical composition comprising MicroRNA-30B, MicroRNA-133A, or MicroRNA-202-5P inhibitor for inhibiting cancer
US8188264B2 (en) RNAi mediated knockdown of NuMA for cancer therapy
TWI585204B (en) Short interfering rna for treating cancer
EP4303226A1 (en) Transgene cassettes and epigenetic silencers for the treatment of disorders
US10117903B1 (en) Method for regulating cancer stem cell growth by inhibiting phosphorylation of 120th threonine residue of TSPYL5 protein, a composition containing the peptide sequence functioning to inhibit the phosphorylation and a use thereof
KR101414383B1 (en) Composition for inhibiting expression of Dlk-1 gene
WO2011162419A1 (en) Tumor growth controlling method targeting galactosylceramide expression factor-1
CN116650653A (en) Method for inducing direct reprogramming of human tumor cells into non-tumorigenic differentiated cells by using down-regulating composition
KR20210109184A (en) NEW USE OF miR-125a and let-7e
CN113913513A (en) Application of human DSN1 gene and related product
CN113917146A (en) Application of human POLE2 gene and related product
Dylla et al. 689. Restriction Profiles of Primate TRIM5α on FIV
JP2009225672A (en) GROWTH INHIBITION OF SCIRRHOUS GASTRIC CANCER CELL BY siRNA TO FGFR2
KR20110039527A (en) Anti-cancer composition comprising microrna molecules

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180529

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20190529

Year of fee payment: 5