KR20210082305A - Composition for preventing or treating inflammatory diseases comprising microrna inhibitors - Google Patents

Composition for preventing or treating inflammatory diseases comprising microrna inhibitors Download PDF

Info

Publication number
KR20210082305A
KR20210082305A KR1020190174067A KR20190174067A KR20210082305A KR 20210082305 A KR20210082305 A KR 20210082305A KR 1020190174067 A KR1020190174067 A KR 1020190174067A KR 20190174067 A KR20190174067 A KR 20190174067A KR 20210082305 A KR20210082305 A KR 20210082305A
Authority
KR
South Korea
Prior art keywords
mir
inhibitor
preventing
inflammatory diseases
inhibitors
Prior art date
Application number
KR1020190174067A
Other languages
Korean (ko)
Other versions
KR102304041B1 (en
Inventor
배영석
송준빈
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to KR1020190174067A priority Critical patent/KR102304041B1/en
Publication of KR20210082305A publication Critical patent/KR20210082305A/en
Application granted granted Critical
Publication of KR102304041B1 publication Critical patent/KR102304041B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/48Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/4886Metalloendopeptidases (3.4.24), e.g. collagenase
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2006IL-1
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/204IL-6
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324Foods, ingredients or supplements having a functional effect on health having an effect on the immune system

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Rheumatology (AREA)
  • Zoology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Mycology (AREA)
  • Pain & Pain Management (AREA)
  • Genetics & Genomics (AREA)
  • Polymers & Plastics (AREA)
  • Dermatology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a composition for preventing or treating inflammatory diseases, comprising a microRNA inhibitor as an active component, and more specifically, to a pharmaceutical composition for preventing or treating inflammatory diseases, and a health functional food composition for preventing or alleviating inflammatory diseases, all of which contain a miR-337-3p inhibitor as an active component. The microRNA inhibitor significantly inhibits the expression of inflammation-related factors such as MMP-3, IL-6, and IL-1beta, thereby being able to effectively prevent, alleviate or treat various inflammatory diseases such as rheumatoid arthritis, osteoarthritis, etc.

Description

microRNA 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 조성물{COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS}A composition for preventing or treating inflammatory diseases comprising a microRNA inhibitor as an active ingredient {COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS}

본 발명은 마이크로RNA(microRNA) 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

염증(inflammation)이란, 외상이나 화상과 같은 물리화학적인 요인 또는 세균이나 바이러스와 같은 생물학적 요인 등의 여러 가지 자극에 대한 생체 조직의 방어 반응의 하나로, 조직 변질, 순환장애와 삼출, 조직 증식의 세 가지를 병발하는 복잡한 병변이다.Inflammation is one of the defense responses of living tissues against various stimuli such as physicochemical factors such as trauma or burns, or biological factors such as bacteria or viruses. It is a complex lesion involving branches.

이러한 염증 반응에 관여하는 다양한 인자들이 있다. 먼저, 기질 금속단백질분해효소(Matrix Metalloproteinase-3; MMP-3)는 스트로멜리신-1(Stromelysin-1)이라고도 하며, 성장 인자, 사이토카인, 종양 프로모터 및 발암 유전자 생성물을 포함한 다양한 자극에 반응한다. 특히, MMP-3는 류마티스 관절염(rheumatoid arthritis), 강직성 척추염(ankylosing spondylitis)에 적극적으로 관여하는 효소로, 이를 이용하여 상기 질환들을 진단하고 치료 반응을 예측할 수 있는 주요한 마커가 될 수 있음이 보고되었다 (Best Practice & Research Clinical Rheumatology, 32(4): 550-562, Aaron Lerner et al., BMC Musculoskelet Disord. 2014; 15: 93. Shu Sun et al).There are various factors involved in this inflammatory response. First, matrix metalloproteinase-3 (MMP-3), also called stromelysin-1, responds to a variety of stimuli, including growth factors, cytokines, tumor promoters, and oncogene products. . In particular, it has been reported that MMP-3 is an enzyme actively involved in rheumatoid arthritis and ankylosing spondylitis, and can be a major marker for diagnosing the diseases and predicting the treatment response using the enzyme. (Best Practice & Research Clinical Rheumatology, 32(4): 550-562, Aaron Lerner et al., BMC Musculoskelet Disord. 2014; 15: 93. Shu Sun et al).

인터류킨 6(Interleukin 6; IL-6)는 B 세포의 항체생산세포로의 최종 분화를 유도하는 B 세포 자극인자 2(BSF-2)로 분리한 당단백질로, 인터페론 β2(IFN-β2)와 동일분자이다. IL-6는 T 림프구, B 림프구, 대식세포, 섬유아세포 등 여러 세포에서 생산되는 전염증성 사이토카인(pro-inflammatory cytokine)으로, 면역응답, 조혈계와 신경계 세포의 증식 및 분화, 급성 반응 등에 관여한다. 류마티스 관절염 (Current Opinion in Rheumatology. 18(3):277-281, Nishimoto N), 소아 특발성 관절염(systemic juvenile idiopathic arthritis) (Lancet. 371(9617): 998-1006, Yokota S et al), 전신성 홍반성 루프스 (Lupus. 13(5): 339-43, Tackey E et al), 캐슬만병(Castleman’s disease) (Blood. 106(8): 2627-32, Nishimoto N et al), 베체트병(Internal Medicine. 51(24): 3359-65, Hirohata S et al), 건선(psoriasis) (Protein Sci. 6, 929-55, Simpson et al)과 같은 많은 질병 및 염증 반응과 IL-6가 관련됨이 보고되어, 이러한 질병의 치료법으로 항 IL-6제에 대한 연구가 진행되고 있다. Interleukin 6 (IL-6) is a glycoprotein isolated from B cell stimulatory factor 2 (BSF-2) that induces final differentiation of B cells into antibody-producing cells, and is identical to interferon β2 (IFN-β2). is a molecule IL-6 is a pro-inflammatory cytokine produced by multiple cells such as T lymphocytes, B lymphocytes, macrophages, and fibroblasts, and is involved in immune responses, proliferation and differentiation of hematopoietic and nervous system cells, and acute reactions. do. Current Opinion in Rheumatology. 18(3):277-281, Nishimoto N), systemic juvenile idiopathic arthritis (Lancet. 371(9617): 998-1006, Yokota S et al), systemic redness Lupus reflex (Lupus. 13(5): 339-43, Tackey E et al), Castleman's disease (Blood. 106(8): 2627-32, Nishimoto N et al), Behcet's disease (Internal Medicine. 51(24): 3359-65, Hirohata S et al), psoriasis (Protein Sci. 6, 929-55, Simpson et al), it has been reported that IL-6 is involved with many diseases and inflammatory responses, Research on anti-IL-6 agents is ongoing as a treatment for these diseases.

인터류킨 1베타(Interleukin 1 beta; IL-1β)는 인터류킨 1(interleukin-1; IL-1)의 두 유전자(IL-1α, IL-1β) 중 하나로, 세포 증식, 분화, 아포토시스를 포함한 다양한 세포 활성에 관여하며 염증 반응의 중요한 매개자인 사이토카인이다. IL-1β 또한 류마티스 관절염, 골관절염(Osteoarthritis), 아프타구내염(aphthous stomatitis), 인두염(pharyngitis), 경부 림프절염(adenitis syndrome) 등의 급성 또는 만성 염증성 질환과 관련이 있음이 보고되었다(Blood. 117(14): 3720-3732. Charles A. Dinarello). Interleukin 1 beta (IL-1β) is one of two genes (IL-1α, IL-1β) of interleukin-1 (IL-1), and various cellular activities including cell proliferation, differentiation, and apoptosis It is a cytokine and is an important mediator of the inflammatory response. IL-1β has also been reported to be associated with acute or chronic inflammatory diseases such as rheumatoid arthritis, osteoarthritis, aphthous stomatitis, pharyngitis, and adenitis syndrome (Blood. 117(14)). ): 3720-3732. Charles A. Dinarello).

이러한 염증 반응과 관련된 인자를 조절함으로써, 다양한 염증성 질환을 예방 또는 치료할 수 있는 효과적인 치료 전략의 개발이 요구된다.By regulating the factors related to the inflammatory response, there is a need for the development of effective therapeutic strategies that can prevent or treat various inflammatory diseases.

한국공개특허 제10-2013-0026950호 (2013.03.14. 공개)Korean Patent Publication No. 10-2013-0026950 (published on March 14, 2013)

본 발명의 목적은 마이크로RNA(microRNA) 억제제를 유효성분으로 포함하는 우수한 염증성 질환 예방 또는 치료용 약학 조성물을 제공하는 데에 있다.It is an object of the present invention to provide an excellent pharmaceutical composition for preventing or treating inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

또한, 본 발명의 목적은 마이크로RNA(microRNA) 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 개선용 건강기능식품 조성물을 제공하는 데에 있다.In addition, it is an object of the present invention to provide a health functional food composition for preventing or improving inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

본 발명에 따른 염증성 질환 예방 또는 치료용 약학 조성물은 miR-337-3p 억제제를 유효성분으로 포함할 수 있다.The pharmaceutical composition for preventing or treating inflammatory diseases according to the present invention may include a miR-337-3p inhibitor as an active ingredient.

본 발명에 따른 염증성 질환 예방 또는 개선용 건강기능식품 조성물은 miR-337-3p 억제제를 유효성분으로 포함할 수 있다. The health functional food composition for preventing or improving inflammatory diseases according to the present invention may include a miR-337-3p inhibitor as an active ingredient.

본 발명에 따른 miR-337-3p 억제제를 비롯하여, miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제는 MMP-3, IL-6, IL-1β 등의 염증 관련 인자의 발현을 억제할 수 있다. 이에, 상기 microRNA 억제제를 유효성분으로 포함하여 류마티스 관절염, 골관절염 등의 다양한 염증성 질환의 예방, 개선, 또는 치료용 약학 조성물 또는 건강기능식품 조성물로 활용할 수 있다.One or more microRNA inhibitors selected from the group consisting of miR-337-3p inhibitors, miR-186 inhibitors, miR-216b inhibitors, and miR-760 inhibitors according to the present invention include MMP-3, IL-6, IL-1β, etc. can inhibit the expression of inflammation-related factors. Accordingly, it can be used as a pharmaceutical composition or a health functional food composition for preventing, improving, or treating various inflammatory diseases such as rheumatoid arthritis and osteoarthritis by including the microRNA inhibitor as an active ingredient.

본 발명에 따른 microRNA 억제제를 혼합하여 사용하면, 상기 염증 관련 인자의 발현을 보다 더 효과적으로 억제할 수 있어 염증성 질환의 우수한 치료제로서 활용할 수 있다.When the microRNA inhibitor according to the present invention is mixed and used, the expression of the inflammation-related factor can be more effectively suppressed, and thus it can be utilized as an excellent therapeutic agent for inflammatory diseases.

도 1은 본 발명의 실험예 1에 따른 염증인자 발현 변화 결과를 나타낸다.
도 2는 본 발명의 실험예 2에 따른 염증인자 발현 변화 결과를 나타낸다.
도 3은 본 발명의 실험예 3에 따른 염증인자 발현 변화 결과를 나타낸다.
1 shows the results of changes in the expression of inflammatory factors according to Experimental Example 1 of the present invention.
Figure 2 shows the result of the expression change of the inflammatory factor according to Experimental Example 2 of the present invention.
3 shows the result of the expression change of the inflammatory factor according to Experimental Example 3 of the present invention.

이하, 본 발명을 상세하게 설명하기로 한다.Hereinafter, the present invention will be described in detail.

본 명세서에서, "예방"이란, 본 발명에 따른 약학 조성물 또는 건강기능식품 조성물의 투여에 의해 염증성 질환, 또는 상기 질환의 적어도 하나 이상의 증상의 발생을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다. 또한, 재발을 예방하거나 방지하기 위해 상기 질병에 차도가 있는 대상의 치료를 포함한다.As used herein, "prevention" refers to any action that suppresses or delays the onset of an inflammatory disease, or at least one or more symptoms of the disease by administration of the pharmaceutical composition or health functional food composition according to the present invention . Also included is treatment of a subject in remission of the disease to prevent or prevent recurrence.

본 명세서에서, "치료"란, 본 발명에 따른 약학 조성물의 투여에 의해 염증성 질환, 또는 상기 질환의 적어도 하나 이상의 증상을 완화, 감소, 또는 소멸시키는 등 그 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다.As used herein, "treatment" refers to any act of improving or beneficially changing an inflammatory disease or at least one symptom of the disease, such as alleviating, reducing, or disappearing, by administering the pharmaceutical composition according to the present invention. means

본 명세서에서, "개선"이란, 본 발명에 따른 건강기능식품 조성물의 섭취에 의해 염증성 질환, 또는 상기 질환의 적어도 하나 이상의 증상이 완화, 감소, 또는 소멸시키는 등 그 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다.In the present specification, "improvement" refers to an inflammatory disease, or at least one or more symptoms of the disease by ingestion of the health functional food composition according to the present invention, such as alleviating, reducing, or eliminating the symptoms to improve or beneficially change means all actions.

본 명세서에서, "약학 조성물"이란, 특정한 목적을 위해 투여되는 조성물로, 본 발명의 목적상 염증성 질환, 또는 상기 질환의 적어도 하나 이상의 증상을 예방하거나 또는 치료하기 위해 투여되는 것을 의미한다.As used herein, the term "pharmaceutical composition" refers to a composition administered for a specific purpose, and for the purpose of the present invention, it means to be administered to prevent or treat an inflammatory disease, or at least one or more symptoms of the disease.

본 명세서에서, "건강기능식품"이란, 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 포함하며, 영양 공급 외에도 본 발명의 목적상 염증성 질환의 예방, 생체 방어, 면역, 회복 등의 생체 조절 기능이 효율적으로 나타나도록 가공된 의학, 의료 효과가 높은 식품을 의미한다.As used herein, the term "health functional food" includes food manufactured and processed using raw materials or ingredients useful for the human body according to Act No. 6727 of the Health Functional Food Act, and in addition to nutrition, the purpose of the present invention It refers to foods with high medical and medical effects processed to efficiently exhibit bioregulatory functions such as prevention of inflammatory diseases, body defense, immunity, and recovery.

본 발명은 miR-337-3p 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient.

상기 miR-337-3p 억제제는 microRNA(miRNA)를 억제시킬 수 있는 어떠한 억제제를 포함할 수 있고, 바람직하게는 상기 miR-337-3p의 염기서열의 전부 또는 일부에 상보적으로 결합할 수 있는 핵산 분자로, 안타고미르(antagomir), 안티센스 올리고뉴클레오티드(antisense oligonucleotide)일 수 있으며, 상기 miR-337-3p에 특이적인 siRNA(small interfering RNA), shRNA(short hairpin RNA) 또는 RNA 앱타머일 수 있으나, 이에 제한되는 것은 아니다. The miR-337-3p inhibitor may include any inhibitor capable of inhibiting microRNA (miRNA), and preferably a nucleic acid capable of complementary binding to all or part of the miR-337-3p nucleotide sequence. As a molecule, it may be an antagomir, an antisense oligonucleotide, and may be an siRNA (small interfering RNA), shRNA (short hairpin RNA) or RNA aptamer specific for the miR-337-3p. It is not limited.

상기 안티센스 올리고뉴클레오티드는 타겟으로 하는 miRNA, 특히, miRNA의 선도서열에 대한 상보적인 서열을 가져 miRNA와 이합체(duplex)를 형성할 수 있는 핵산-기반 분자를 포괄하는 것으로, 예를 들어, 리보뉴클레오타이드(RNA), 디옥시리보뉴클레오타이드(DNA), 2'-O-변형 올리고뉴클레오타이드, 포스포로티오에이트-백본 디옥시리보뉴클레오타이드, PNA(peptide nucleic acid) 또는 LNA(locked nucleic acid)일 수 있다.The antisense oligonucleotide includes a nucleic acid-based molecule capable of forming a duplex with a miRNA by having a complementary sequence to the target miRNA, particularly the leader sequence of the miRNA, for example, a ribonucleotide ( RNA), deoxyribonucleotides (DNA), 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, peptide nucleic acid (PNA) or locked nucleic acid (LNA).

보다 바람직하게는, 상기 miR-337-3p 억제제는 서열번호 1 (GAAAGGCATCATATAGGA)을 포함하고, 세포 투과 펩타이드와 AEEA 링커로 연결된 RRRQRRKKR-OO-GAAAGGCATCATATAGGA 구조의 안티센스 억제제일 수 있다. 상기 억제제는 miR-337-3p의 염기서열에 상보적으로 결합함으로써, miR-337-3p의 작용을 억제할 수 있다.More preferably, the miR-337-3p inhibitor may be an antisense inhibitor of the RRRQRRKKR-OO-GAAAGGCATCATATAGGA structure comprising SEQ ID NO: 1 (GAAAGGCATCATATAGGA) and linked to a cell penetrating peptide and an AEEA linker. The inhibitor may inhibit the action of miR-337-3p by complementary binding to the miR-337-3p nucleotide sequence.

본 발명에 따른 염증성 질환 예방 또는 치료용 약학 조성물은 miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제를 더 포함할 수 있다. 바람직하게는 상기 miR-337-3p 억제제와 상기 miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제가 혼합된 것일 수 있다.The pharmaceutical composition for preventing or treating inflammatory diseases according to the present invention may further include one or more microRNA inhibitors selected from the group consisting of a miR-186 inhibitor, a miR-216b inhibitor, and a miR-760 inhibitor. Preferably, the miR-337-3p inhibitor and one or more microRNA inhibitors selected from the group consisting of the miR-186 inhibitor, miR-216b inhibitor, and miR-760 inhibitor may be mixed.

상기 억제제는 miRNA를 억제시킬 수 있는 어떠한 억제제를 포함할 수 있고, 바람직하게는 상기 miR-186, miR-216b, 또는 miR-760의 염기서열의 전부 또는 일부에 상보적으로 결합할 수 있는 핵산 분자로, 안타고미르(antagomir), 안티센스 올리고뉴클레오티드(antisense oligonucleotide)일 수 있으며, 상기 miR-186, miR-216b, 또는 miR-760에 특이적인 siRNA(small interfering RNA), shRNA(short hairpin RNA) 또는 RNA 앱타머일 수 있으나, 이에 제한되는 것은 아니다. The inhibitor may include any inhibitor capable of inhibiting miRNA, preferably a nucleic acid molecule capable of complementary binding to all or part of the base sequence of miR-186, miR-216b, or miR-760. For example, it may be an antagomir, an antisense oligonucleotide, and a small interfering RNA (siRNA), short hairpin RNA (shRNA) or RNA specific for the miR-186, miR-216b, or miR-760. It may be an aptamer, but is not limited thereto.

보다 바람직하게는, 상기 miR-186 억제제는 서열번호 2 (CCAAAAGGAGAATTCTTT)를 포함하고, 세포 투과 펩타이드와 AEEA 링커로 연결된 RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT 구조의 안티센스 억제제, 상기 miR-216b 억제제는 서열번호 3 (TTGCCTGCAGAGATT)을 포함하는 RRRQRRKKRR-OO-TTGCCTGCAGAGATT 구조의 안티센스 억제제, 상기 miR-760 억제제는 서열번호 4 (TCCCCACAGACCCAGAGCCG)를 포함하는 RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG 구조의 안티센스 억제제일 수 있다. 상기 억제제는 miR-186, miR-216b, 또는 miR-760의 염기서열에 상보적으로 결합함으로써, miR-186, miR-216b, 또는 miR-760의 작용을 억제할 수 있다.More preferably, the miR-186 inhibitor comprises SEQ ID NO: 2 (CCAAAAGGAGAATTCTTT), the antisense inhibitor of the RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT structure linked to a cell penetrating peptide and an AEEA linker, the miR-216b inhibitor is SEQ ID NO: 3 (TTGCCTGCAGAGATT) ) an antisense inhibitor of the structure RRRQRRKKRR-OO-TTGCCTGCAGAGATT, the miR-760 inhibitor may be an antisense inhibitor of the structure RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG comprising SEQ ID NO: 4 (TCCCCACAGACCCAGAGCCG). The inhibitor may inhibit the action of miR-186, miR-216b, or miR-760 by complementary binding to the nucleotide sequence of miR-186, miR-216b, or miR-760.

안티센스 서열antisense sequence 안티센스 억제제 구조Antisense inhibitor structure miR-337-3p 억제제miR-337-3p inhibitor 서열번호1 (GAAAGGCATCATATAGGA)SEQ ID NO: 1 (GAAAGGCATCATATAGGA) RRRQRRKKR-OO-GAAAGGCATCATATAGGARRRQRRKKR-OO-GAAAGGCATCATATAGGA miR-186 억제제miR-186 inhibitor 서열번호2 (CCAAAAGGAGAATTCTTT)SEQ ID NO:2 (CCAAAAGGAGAATTCTTT) RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTTRRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT miR-216b 억제제miR-216b inhibitor 서열번호3 (TTGCCTGCAGAGATT)SEQ ID NO:3 (TTGCCTGCAGAGATT) RRRQRRKKRR-OO-TTGCCTGCAGAGATTRRRQRRKKRR-OO-TTGCCTGCAGAGATT miR-760 억제제miR-760 inhibitor 서열번호4 (TCCCCACAGACCCAGAGCCG)SEQ ID NO:4 (TCCCCACAGACCCAGAGCCG) RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCGRRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG

상기 표 1은 본 발명에 따른 microRNA의 안티센스 억제제의 구조를 나타낸 것이다.Table 1 shows the structure of the antisense inhibitor of microRNA according to the present invention.

본 발명에 따른 상기 miRNA는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다. 또한, 본 발명에 따른 조성물은 상기 miRNA 뿐만 아니라 세포 내에서 본 발명의 항염증 활성을 증가시킬 수 있는 기타의 물질, 예를 들어 화합물, 천연물, 신규 단백질 등을 더 포함할 수 있다.The miRNA according to the present invention may be isolated or prepared using standard molecular biology techniques, for example, chemical synthesis or recombinant methods, or commercially available ones. In addition, the composition according to the present invention may further include other substances capable of increasing the anti-inflammatory activity of the present invention in a cell as well as the miRNA, for example, a compound, a natural product, a novel protein, and the like.

본 발명에 따른 약학 조성물에 있어서, 상기 억제제는 MMP-3, IL-6 및 IL-1β로 이루어진 군에서 선택되는 하나 이상의 염증 관련 인자의 발현을 억제시킬 수 있다.In the pharmaceutical composition according to the present invention, the inhibitor may inhibit the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β.

본 발명의 일 실험예에 따르면, 상기 miR-337-3p 억제제는 인간 대장암 세포 (HCT116)와 유방암 세포 (MCF-7)에 처리한 경우, LPS 처리(6 μg/μl)에 의해 유발된 염증 인자 MMP-3, IL-6, IL-1β의 증가된 발현이 유의하게 감소되었고, 상기 miR-337-3p 억제제와 miR-186 억제제, miR-216b 억제제 및 miR-760 억제제를 혼합하여 처리한 경우, 상기 염증 인자의 발현이 더 효과적으로 감소됨을 확인할 수 있었다.According to an experimental example of the present invention, when the miR-337-3p inhibitor was treated with human colorectal cancer cells (HCT116) and breast cancer cells (MCF-7), inflammation induced by LPS treatment (6 μg/μl) The increased expression of factors MMP-3, IL-6, and IL-1β was significantly reduced, and when the miR-337-3p inhibitor was mixed with a miR-186 inhibitor, a miR-216b inhibitor and a miR-760 inhibitor , it was confirmed that the expression of the inflammatory factor was more effectively reduced.

상기와 같은 효과를 이용하여 본 발명에 따른 miR-337-3p 억제제는 염증성 질환의 예방 또는 치료용 약학 조성물로 사용될 수 있다. Using the above effects, the miR-337-3p inhibitor according to the present invention can be used as a pharmaceutical composition for preventing or treating inflammatory diseases.

전술한 바와 같이, 기질 금속단백질분해효소(Matrix Metalloproteinase-3; MMP-3), 인터류킨 6(Interleukin 6; IL-6) 및 인터류킨 1베타(Interleukin 1 beta; IL-1β)는 염증 반응의 주요 매개체로 다양한 염증성 질환과 관련이 있다.As described above, matrix metalloproteinase-3 (MMP-3), interleukin 6 (IL-6) and interleukin 1 beta (IL-1β) are major mediators of the inflammatory response. has been associated with various inflammatory diseases.

상기 염증성 질환(inflammatory diseases)은 세균의 침입 등으로 인해 형성되는 농양의 병리적 상태를 주 병변으로 하는 질병의 총칭으로, 류마티스 관절염, 골관절염, 소아 특발성 관절염, 전신성 홍반성 루프스, 강직성 척추염, 건선, 크론병, 캐슬만병(Castleman’s disease), 경부 림프절염, 인두염, 포도막염, 피부염 및 아프타구내염으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다.The inflammatory diseases are a generic term for diseases whose main lesions are the pathological conditions of abscesses formed due to bacterial invasion, rheumatoid arthritis, osteoarthritis, juvenile idiopathic arthritis, systemic lupus erythematosus, ankylosing spondylitis, psoriasis, It may be selected from the group consisting of Crohn's disease, Castleman's disease, cervical lymphadenitis, pharyngitis, uveitis, dermatitis, and aphthous stomatitis, but is not limited thereto.

본 발명에 따른 약학 조성물은 화학물질, 뉴클레오티드, 안티센스, siRNA 올리고뉴클레오티드 및 천연물 추출물을 유효성분으로 포함할 수 있다. The pharmaceutical composition according to the present invention may include chemicals, nucleotides, antisense, siRNA oligonucleotides, and natural product extracts as active ingredients.

본 발명에 따른 약학 조성물은 약학적 분야의 통상적인 방법에 따라 제조될 수 있다. 상기 약학 조성물은 상기 제형에 따라 약학적으로 허용가능한 적절한 담체와 배합될 수 있고, 필요에 따라, 부형제, 희석제, 분산제, 유화제, 완충제, 안정제, 결합제, 붕해제, 용제 등을 더 포함하여 제조될 수 있다. 상기 "약학적으로 허용 가능한"이란, 상기 약학 조성물에 노출되는 세포나 인간에게 독성이 없는 것을 의미하고, 상기 적절한 담체 등은 본 발명에 따른 억제제의 활성 및 특성을 저해하지 않는 것으로, 투여 형태 및 제형에 따라 달리 선택될 수 있다.The pharmaceutical composition according to the present invention may be prepared according to a conventional method in the pharmaceutical field. The pharmaceutical composition may be combined with a suitable pharmaceutically acceptable carrier according to the formulation, and if necessary, an excipient, diluent, dispersant, emulsifier, buffer, stabilizer, binder, disintegrant, solvent, etc. to be prepared. can The "pharmaceutically acceptable" means that it is not toxic to cells or humans exposed to the pharmaceutical composition, and the appropriate carrier does not inhibit the activity and properties of the inhibitor according to the present invention, and the dosage form and It may be selected differently depending on the formulation.

본 발명에 따른 약학 조성물은 어떠한 제형으로도 적용될 수 있고, 액상 용액으로 제제화되는 조성물에 있어서 허용 가능한 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.The pharmaceutical composition according to the present invention can be applied in any dosage form, and acceptable pharmaceutical carriers in the composition formulated as a liquid solution are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection. Solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.

본 발명에 따른 약학 조성물에 있어서, 상기 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있다. 상기 "약학적으로 유효한 양"이란, 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미한다.In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not cause side effects.

상기 약학 조성물의 유효 용량 수준은 사용 목적, 환자의 연령, 성별, 체중 및 건강 상태, 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 달리 결정될 수 있다. 예를 들어, 일정하지는 않지만 성인의 경우, 본 발명에 따른 억제제가 화합물일 경우 0.1ng/kg 내지 10g/kg, 폴리펩타이드, 단백질 또는 항체일 경우 0.1ng/kg 내지 10g/kg, 안티센스 뉴클레오티드, siRNA, shRNAi, miRNA일 경우 0.01ng/kg 내지 10g/kg의 용량으로 일일 1회 내지 수회 투여될 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The effective dose level of the pharmaceutical composition is determined by the purpose of use, the age, sex, weight and health status of the patient, the type of disease, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment It may be determined differently depending on factors including the duration, formulation or concurrent use of drugs and other factors well known in the medical field. For example, although not constant, in adults, 0.1 ng/kg to 10 g/kg when the inhibitor according to the invention is a compound, 0.1 ng/kg to 10 g/kg for a polypeptide, protein or antibody, antisense nucleotide, siRNA , shRNAi or miRNA may be administered once or several times a day at a dose of 0.01 ng/kg to 10 g/kg. The above dosage does not limit the scope of the present invention in any way.

본 발명에 따른 약학 조성물은 염증성 질환이 발생할 수 있는 임의의 동물에 투여할 수 있고, 상기 동물은 예를 들어, 인간 및 영장류뿐만 아니라 소, 돼지, 말, 개 등의 가축 등을 포함할 수 있다.The pharmaceutical composition according to the present invention may be administered to any animal capable of developing an inflammatory disease, and the animal may include, for example, not only humans and primates, but also livestock such as cattle, pigs, horses, and dogs. .

본 발명에 따른 약학 조성물은 제제 형태에 따른 적당한 투여 경로로 투여될 수 있고, 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다. 투여 방법은 특히 한정할 필요 없이, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 기관지내 흡입, 자궁내 경막 또는 뇌혈관내(intracere-broventricular) 주사 등의 통상적인 방법으로 투여될 수 있다.The pharmaceutical composition according to the present invention may be administered by an appropriate administration route according to the form of the formulation, and may be administered through various routes, either oral or parenteral, as long as it can reach the target tissue. The administration method is not particularly limited, and for example, oral, rectal or intravenous, intramuscular, subcutaneous, endobronchial inhalation, intrauterine dural or intracerebroventricular injection, etc. can be administered in a conventional manner. .

본 발명에 따른 약학 조성물은 염증성 질환 예방 또는 치료를 위하여 단독으로 사용될 수 있고, 수술 또는 다른 약물 치료 등과 병용하여 사용될 수 있다.The pharmaceutical composition according to the present invention may be used alone for preventing or treating inflammatory diseases, or may be used in combination with surgery or other drug treatment.

또한, 본 발명은 miR-337-3p 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 개선용 건강기능식품 조성물을 제공한다. 상기 조성물은 miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제를 더 포함할 수 있다. 이에 상응하는 특징들은 상술된 부분에서 대신할 수 있다.In addition, the present invention provides a health functional food composition for preventing or improving inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient. The composition may further include one or more microRNA inhibitors selected from the group consisting of a miR-186 inhibitor, a miR-216b inhibitor, and a miR-760 inhibitor. Corresponding features may be substituted for the above-mentioned parts.

본 발명에 따른 건강기능식품 조성물에 있어서, 상기 억제제는 MMP-3, IL-6 및 IL-1β로 이루어진 군에서 선택되는 하나 이상의 염증 관련 인자의 발현을 억제시킬 수 있고, 이러한 효과를 이용하여 상기 억제제는 염증성 질환의 예방 또는 개선을 위한 건강기능식품 조성물로 사용될 수 있다.In the health functional food composition according to the present invention, the inhibitor can inhibit the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β, and using this effect, The inhibitor may be used as a health functional food composition for the prevention or improvement of inflammatory diseases.

본 발명에 따른 건강기능식품 조성물에 있어서, 상기 건강기능식품은 분말, 과립, 정제, 캡슐, 시럽 또는 음료 등으로 제조될 수 있고, 상기 건강기능식품이 취할 수 있는 형태에는 제한이 없으며, 통상적인 의미의 식품을 모두 포함할 수 있다. 예를 들어, 음료 및 각종 드링크, 과실 및 그의 가공식품(과일통조림, 잼 등), 어류, 육류 및 그 가공식품(햄, 베이컨 등), 빵류 및 면류, 쿠키 및 스낵류, 유제품(버터, 치즈 등) 등이 가능하며, 통상적인 의미에서의 기능성 식품을 모두 포함할 수 있다. 또한 동물을 위한 사료로 이용되는 식품도 포함할 수 있다.In the health functional food composition according to the present invention, the health functional food may be prepared in powder, granule, tablet, capsule, syrup or beverage, etc., and there is no limitation in the form that the health functional food can take, It can include any food with meaning. For example, beverages and various drinks, fruits and their processed foods (canned fruit, jam, etc.), fish, meat and their processed foods (ham, bacon, etc.), breads and noodles, cookies and snacks, dairy products (butter, cheese, etc.) ), etc. are possible, and may include all functional foods in a conventional sense. It may also include food used as feed for animals.

본 발명에 따른 건강기능식품 조성물은 당업계에서 통상적으로 사용되는 식품학적으로 허용 가능한 식품 첨가제(식품 첨가물) 및 적절한 기타 보조 성분을 더 포함하여 제조될 수 있다. 식품 첨가물로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전청에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정할 수 있다. The health functional food composition according to the present invention may be prepared by further including pharmaceutically acceptable food additives (food additives) and other suitable auxiliary ingredients commonly used in the art. Unless otherwise specified, the suitability as a food additive can be judged according to the standards and standards for the relevant item in accordance with the general rules and general test methods of the Food Additives Code approved by the Food and Drug Administration.

상기 기타 보조 성분은 예를 들어, 향미제, 천연 탄수화물, 감미제, 비타민, 전해질, 착색제, 펙트산, 알긴산, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산화제 등을 추가로 함유할 수 있다. 특히, 상기 천연 탄수화물로는 포도당, 과당과 같은 모노사카라이드, 말토스, 수크로오스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜을 사용할 수 있으며, 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다.The other auxiliary ingredients include, for example, flavoring agents, natural carbohydrates, sweeteners, vitamins, electrolytes, coloring agents, pectic acid, alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents, etc. may further contain. In particular, as the natural carbohydrate, monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol can be used. , as the sweetener, natural sweeteners such as taumatine and stevia extract or synthetic sweeteners such as saccharin and aspartame may be used.

본 발명에 따른 건강기능식품에 함유된 상기 억제제의 유효 용량은 염증성 질환 예방 또는 개선 등 그 사용 목적에 따라 적절하게 조절될 수 있다. The effective dose of the inhibitor contained in the health functional food according to the present invention may be appropriately adjusted according to the purpose of use, such as prevention or improvement of inflammatory diseases.

상기 조성물은 식품을 원료로 하여 일반 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 염증성 질환 예방 또는 개선을 위한 보조제로 섭취될 수 있다.The composition has the advantage that there are no side effects that may occur during long-term administration of general drugs using food as a raw material, and has excellent portability, and can be taken as an adjuvant for preventing or improving inflammatory diseases.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.Hereinafter, to help the understanding of the present invention, examples will be described in detail. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<실험준비 및 방법> 웨스턴 블로팅(western blotting)<Experiment preparation and method> Western blotting

miR-186, miR-216b, miR-337-3p 및 miR-760 모방체 및 대조군 miRNA를 Genolution Inc (Seoul, Korea)에서 구입하여 사용하였다. 상기 네 개의 miRNA들의 안티센스 억제제를 Panagene Inc (Seoul, Korea)로부터 구입하였다. miR-186, miR-216b, miR-337-3p and miR-760 mimics and control miRNAs were purchased from Genolution Inc (Seoul, Korea) and used. Antisense inhibitors of the four miRNAs were purchased from Panagene Inc (Seoul, Korea).

하기 표 2는 본 발명의 일 실험예에 사용된 microRNA 및 microRNA 안티센스 억제제이다. RRRQRRKKRR은 세포 투과 펩타이드(cell penetrating peptide) 이고, OO는 AEEA 링커이다. Table 2 below shows microRNA and microRNA antisense inhibitors used in an experimental example of the present invention. RRRQRRKKRR is a cell penetrating peptide and OO is an AEEA linker.





mimics




mimics
miR-337-3pmiR-337-3p Forward: 5'-CUCCUAUAUGAUGCCUUUCUUC-3'
Reverse: 5'-GAAGAAAGGCAUCAUCUAGGAG-3'
Forward: 5'-CUCCUAUAUGAUGCCUUUCUUC-3'
Reverse: 5'-GAAGAAAGGCAUCAUCUAGGAG-3'
miR-186miR-186 Forward: 5'-CAAAGAAUUCUCCUUUUGGGCU-3'
Reverse: 5'-AGCCCAAAAGGAGAAUUCUUG-3'
Forward: 5'-CAAAGAAUUCUCCUUUUGGGCU-3'
Reverse: 5'-AGCCCAAAAGGAGAAUUCUUG-3'
miR-216bmiR-216b Forward: 5'-AAAUCUCUGCAGGCAAAUGUGA-3'
Reverse: 5'-UCACAUUUGCCUGCAGAGAUUU-3'
Forward: 5'-AAAUCUCUGCAGGCAAAUGUGA-3'
Reverse: 5'-UCACAUUUGCCUGCAGAGAUUU-3'
miR-760miR-760 Forward: 5'-CGGCUCUGGGUCUGUGGGGA-3'
Reverse: 5'-UCCCACAGACCCAGAGCCG-3'
Forward: 5'-CGGCUCUGGGUCUGUGGGGA-3'
Reverse: 5'-UCCCACAGACCCAGAGCCG-3'
negative controlnegative control Forward: 5'-ACGUGACACGUUCGGAGAAUU-3'
Reverse: 5'-UUCUCCGAACGUGUCACGUUU-3'
Forward: 5'-ACGUGACACGUUCGGGAGAAUU-3'
Reverse: 5'-UUCUCCGAACGUGUCACGUUU-3'


antisense inhibitors


antisense inhibitors
miR-337-3pmiR-337-3p RRRQRRKKR-OO-GAAAGGCATCATATAGGA RRRQRRKKR-OO-GAAAGGCATCATATAGGA
miR-186miR-186 RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT miR-216bmiR-216b RRRQRRKKRR-OO-TTGCCTGCAGAGATT RRRQRRKKRR-OO-TTGCCTGCAGAGATT miR-760miR-760 RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG negative controlnegative control RRRQRRKKRR-OO-CTCCCTTCAATC RRRQRRKKRR-OO-CTCCCTTCAATC

HCT116 인간 대장암 세포 및 MCF-7 인간 유방암 세포를 10%의 FBS(fetal bovine serum)를 포함하는 DMEM(Dulbecco's modified Eagle's medium)에서 5%의 CO2, 37℃의 조건으로 배양하였다. 상기 miRNA 및 miRNA 억제제들을 리포펙타민 RNAi max(Invitrogen, Carlsbad, CA)를 이용하여 최종농도 40nM로 상기 세포에 형질감염(transfection)하였다. 형질감염된 세포는 기존논문 FEBS Lett. 585 (2011) 3360-3366(S.Y. Jang, S.Y. Kim, Bae, Y.S. p53 deacetylation by SIRT1 decreases during protein kinase CKII downregulation-mediated cellular senescence)의 방법에 따라 제조하였다. 형질감염 48시간 후, 세포들을 수확하였다.HCT116 human colorectal cancer cells and MCF-7 human breast cancer cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) at 5% CO 2 , and 37° C. conditions. The miRNA and miRNA inhibitors were transfected into the cells using lipofectamine RNAi max (Invitrogen, Carlsbad, CA) at a final concentration of 40 nM. Transfected cells were prepared according to the previous paper FEBS Lett. 585 (2011) 3360-3366 (SY Jang, SY Kim, Bae, YS p53 deacetylation by SIRT1 decreases during protein kinase CKII downregulation-mediated cellular senescence). 48 hours after transfection, cells were harvested.

각각의 단백질 시료를 정량하여 30 μg 씩 SDS 샘플 로딩 완충액 (60 mM 트리스(Tris) pH 6.8, 25% 글리세롤, 2% SDS, 14.4 mM β-메르캅토에탄올, 0.1% 브로모페놀 블루)과 같이 3분간 끓인 후, 8-12% SDS-폴리아크릴아미드 겔에 전기영동 하였다. 이를 니트로셀룰로오스 막에 이동시켜 Ponceau S로 염색하여 확인한 다음, 막을 TBSt (20 mM 트리스-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween20)에 5% 알부민, Bovine (BSA, Amresco, Ohio, USA)을 첨가한 완충액으로 2시간 이상 블로킹한 후 항체에 반응시켰다. 항-MMP-3, IL-6 및 IL-1β 항체의 경우, 1:500-2000으로 희석하여 4℃에서 15시간 동안 반응시킨 후 TBSt 완충액으로 10분씩 3회 세척한 다음 1:2000으로 희석된 항-Mouse IgG 항체로 상온에서 1시간 반응시킨 후 다시 TBSt 완충액으로 10분씩 3회 세척하였다. 항체 반응 후에는 ECL을 처리하여 1시간 감광 후 현상하였다.Quantitate each protein sample and quantify 30 μg of 3 as SDS sample loading buffer (60 mM Tris pH 6.8, 25% glycerol, 2% SDS, 14.4 mM β-mercaptoethanol, 0.1% bromophenol blue). After boiling for minutes, electrophoresis was performed on an 8-12% SDS-polyacrylamide gel. This was transferred to a nitrocellulose membrane and confirmed by staining with Ponceau S, and then the membrane was confirmed by 5% albumin in TBSt (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween20), Bovine (BSA, Amresco, Ohio, USA). After blocking for 2 hours or more with a buffer solution to which was added, the antibody was reacted. In the case of anti-MMP-3, IL-6 and IL-1β antibodies, diluted 1:500-2000, reacted at 4°C for 15 hours, washed 3 times for 10 minutes with TBSt buffer, then diluted 1:2000 After incubation with anti-Mouse IgG antibody at room temperature for 1 hour, it was washed 3 times for 10 minutes each again with TBSt buffer. After the antibody reaction, ECL was treated and photosensitized for 1 hour before development.

<실험예 1> 인간 대장암 세포 (HCT116)와 유방암 세포 (MCF-7)에서 microRNA 또는 microRNA 안티센스 억제제 처리에 따른 염증인자 (MMP-3, IL-6, IL-1β)의 발현 변화 확인<Experimental Example 1> Confirmation of expression changes of inflammatory factors (MMP-3, IL-6, IL-1β) according to microRNA or microRNA antisense inhibitor treatment in human colon cancer cells (HCT116) and breast cancer cells (MCF-7)

도 1은 본 발명의 실험예 1에 따른 염증인자 발현 변화 결과를 나타낸 것으로, 이를 참조하면, miR-186, miR-216b, miR-760 및 miR-337-3p의 4 종류의 microRNA를 인간 대장암 세포 (HCT116)와 유방암 세포 (MCF-7)에 처리한 경우, 염증인자 MMP-3, IL-6, IL-1β의 발현이 증가하는 것으로 나타났고, miR-186, miR-216b, miR-760 및 miR-337-3p의 안티센스 억제제를 상기 세포에 처리한 경우, 상기 염증인자의 발현이 현저히 감소되는 것으로 나타났다.1 shows the result of inflammatory factor expression change according to Experimental Example 1 of the present invention. Referring to this, four types of microRNAs, miR-186, miR-216b, miR-760 and miR-337-3p, were administered to human colon cancer. When cells (HCT116) and breast cancer cells (MCF-7) were treated, the expression of inflammatory factors MMP-3, IL-6, and IL-1β was increased, and miR-186, miR-216b, miR-760 And when the cells were treated with an antisense inhibitor of miR-337-3p, the expression of the inflammatory factor was significantly reduced.

<실험예 2> 리포다당류(lipopolysaccharide, LPS) 처리에 의해 유발된 염증인자 발현의 억제 효과 확인<Experimental Example 2> Confirmation of the inhibitory effect of inflammatory factor expression induced by lipopolysaccharide (LPS) treatment

도 2는 본 발명의 실험예 2에 따른 염증인자 발현 변화 결과를 나타낸 것으로, 이를 참조하면, LPS 처리(6 μg/μl)에 의해 유발된 염증인자의 증가된 발현이 miR-186, miR-216b, miR-760 및 miR-337-3p의 안티센스 억제제를 처리한 경우 현저히 감소되는 것으로 나타났다.Figure 2 shows the result of inflammatory factor expression change according to Experimental Example 2 of the present invention. Referring to this, the increased expression of inflammatory factors induced by LPS treatment (6 μg/μl) is miR-186, miR-216b , was significantly reduced when treated with antisense inhibitors of miR-760 and miR-337-3p.

<실험예 3> microRNA 안티센스 억제제 단독 처리 또는 혼합 처리에 따른 염증 인자 발현 변화 확인<Experimental Example 3> Confirmation of inflammatory factor expression change according to microRNA antisense inhibitor alone or mixed treatment

도 3은 본 발명의 실험예 3에 따른 염증인자 발현 변화 결과를 나타낸 것으로, 이를 참조하면, LPS 처리(6 μg/μl)에 의해 유발된 염증인자의 증가된 발현이 miR-186, miR-216b, miR-760, miR-337-3p 각각의 안티센스 억제제를 단독 처리한 경우 및 상기 안티센스 억제제를 혼합 처리한 경우 모두 억제되는 것으로 나타났다. 특히, 상기 miR-186, miR-216b, miR-760, miR-337-3p의 안티센스 억제제를 혼합 처리한 경우, 상기 안티센스 억제제를 단독 처리한 경우보다 상기 염증인자의 발현이 더 강하게 억제됨을 확인할 수 있다.3 shows the result of the expression change of the inflammatory factor according to Experimental Example 3 of the present invention. Referring to this, the increased expression of the inflammatory factor induced by LPS treatment (6 μg/μl) is miR-186, miR-216b , miR-760 and miR-337-3p were both inhibited when treated with the antisense inhibitor alone and when the antisense inhibitor was mixed. In particular, it can be seen that when the antisense inhibitor of miR-186, miR-216b, miR-760, and miR-337-3p is mixed, the expression of the inflammatory factor is more strongly inhibited than when the antisense inhibitor is treated alone. have.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. Do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS <130> ADP-2019-0451 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-337-3p antisense <400> 1 gaaaggcatc atatagga 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-186 antisense <400> 2 ccaaaaggag aattcttt 18 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> miR-216b antisense <400> 3 ttgcctgcag agatt 15 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-760 antisense <400> 4 tccccacaga cccagagccg 20 <110> KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS <130> ADP-2019-0451 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-337-3p antisense <400> 1 gaaaggcatc atatagga 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-186 antisense <400> 2 ccaaaaggag aattcttt 18 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> miR-216b antisense <400> 3 ttgcctgcag agatt 15 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-760 antisense <400> 4 tccccacaga cccagagccg 20

Claims (8)

miR-337-3p 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient. 제 1 항에 있어서,
상기 조성물은,
miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제를 더 포함하는 것을 특징으로 하는 염증성 질환 예방 또는 치료용 약학 조성물.
The method of claim 1,
The composition is
A pharmaceutical composition for preventing or treating inflammatory diseases, characterized in that it further comprises one or more microRNA inhibitors selected from the group consisting of miR-186 inhibitors, miR-216b inhibitors and miR-760 inhibitors.
제 1 항 또는 제 2 항에 있어서,
상기 억제제는,
MMP-3, IL-6 및 IL-1β로 이루어진 군에서 선택되는 하나 이상의 염증관련 인자의 발현을 억제시키는 것을 특징으로 하는 염증성 질환 예방 또는 치료용 약학 조성물.
3. The method according to claim 1 or 2,
The inhibitor is
A pharmaceutical composition for preventing or treating inflammatory diseases, characterized in that it suppresses the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β.
제 1 항 또는 제 2 항에 있어서,
상기 염증성 질환은,
류마티스 관절염, 골관절염, 소아 특발성 관절염, 전신성 홍반성 루프스, 강직성 척추염, 건선, 크론병, 캐슬만병(Castleman’s disease), 경부 림프절염, 인두염, 포도막염, 피부염 및 아프타구내염으로 이루어진 군에서 선택되는 것을 특징으로 하는 염증성 질환 예방 또는 치료용 약학 조성물.
3. The method according to claim 1 or 2,
The inflammatory disease is
rheumatoid arthritis, osteoarthritis, juvenile idiopathic arthritis, systemic lupus erythematosus, ankylosing spondylitis, psoriasis, Crohn's disease, Castleman's disease, cervical lymphadenitis, pharyngitis, uveitis, dermatitis and aphthous stomatitis A pharmaceutical composition for preventing or treating inflammatory diseases.
제 1 항에 있어서,
상기 억제제는,
상기 miR-337-3p의 염기서열에 상보적으로 결합하는 안티센스 핵산 분자, 상기 miR-337-3p에 특이적인 siRNA, shRNA 또는 RNA 앱타머인 것을 특징으로 하는 염증성 질환 예방 또는 치료용 약학 조성물.
The method of claim 1,
The inhibitor is
An antisense nucleic acid molecule complementary to the nucleotide sequence of the miR-337-3p, siRNA, shRNA or RNA aptamer specific for the miR-337-3p. A pharmaceutical composition for preventing or treating an inflammatory disease.
제 2 항에 있어서,
상기 억제제는,
상기 microRNA의 염기서열에 상보적으로 결합하는 안티센스 핵산 분자, 상기 microRNA에 특이적인 siRNA, shRNA 또는 RNA 앱타머인 것을 특징으로 하는 염증성 질환 예방 또는 치료용 약학 조성물.
3. The method of claim 2,
The inhibitor is
An antisense nucleic acid molecule complementary to the nucleotide sequence of the microRNA, siRNA, shRNA or RNA aptamer specific for the microRNA. A pharmaceutical composition for preventing or treating inflammatory diseases.
miR-337-3p 억제제를 유효성분으로 포함하는 염증성 질환 예방 또는 개선용 건강기능식품 조성물.A health functional food composition for preventing or improving inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient. 제 7 항에 있어서,
상기 조성물은,
miR-186 억제제, miR-216b 억제제 및 miR-760 억제제로 이루어진 군에서 선택되는 하나 이상의 microRNA 억제제를 더 포함하는 것을 특징으로 하는 염증성 질환 예방 또는 개선용 건강기능식품 조성물.
8. The method of claim 7,
The composition is
A health functional food composition for preventing or improving inflammatory diseases, characterized in that it further comprises one or more microRNA inhibitors selected from the group consisting of miR-186 inhibitors, miR-216b inhibitors and miR-760 inhibitors.
KR1020190174067A 2019-12-24 2019-12-24 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors KR102304041B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190174067A KR102304041B1 (en) 2019-12-24 2019-12-24 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190174067A KR102304041B1 (en) 2019-12-24 2019-12-24 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors

Publications (2)

Publication Number Publication Date
KR20210082305A true KR20210082305A (en) 2021-07-05
KR102304041B1 KR102304041B1 (en) 2021-09-24

Family

ID=76899525

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190174067A KR102304041B1 (en) 2019-12-24 2019-12-24 Composition for preventing or treating inflammatory diseases comprising microrna inhibitors

Country Status (1)

Country Link
KR (1) KR102304041B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130026950A (en) 2011-09-06 2013-03-14 서울대학교산학협력단 Pharmaceutical composition comprising inhibitors of mir486 for the prevention and treatment of neuropathic disease
KR101527749B1 (en) * 2012-11-28 2015-06-12 경북대학교 산학협력단 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130026950A (en) 2011-09-06 2013-03-14 서울대학교산학협력단 Pharmaceutical composition comprising inhibitors of mir486 for the prevention and treatment of neuropathic disease
KR101527749B1 (en) * 2012-11-28 2015-06-12 경북대학교 산학협력단 Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Journal of Cerebran Blood Flow & Metabolism. 2018 38(7) 1125-1148* *
Wikepedia_Reactive oxygen species* *

Also Published As

Publication number Publication date
KR102304041B1 (en) 2021-09-24

Similar Documents

Publication Publication Date Title
Huang et al. Requirement for both JAK-mediated PI3K signaling and ACT1/TRAF6/TAK1-dependent NF-κB activation by IL-17A in enhancing cytokine expression in human airway epithelial cells
US20200330421A1 (en) Composition containing monoacetyldiacylglycerol compound as active ingredient for inhibiting blood cancer or metastasis
Chiricozzi Pathogenic role of IL-17 in psoriasis and psoriatic arthritis
CN110475551A (en) Disease and obstacle are treated and prevented using short chain fatty acids
Bian et al. Up-regulation of interleukin-23 induces persistent allodynia via CX3CL1 and interleukin-18 signaling in the rat spinal cord after tetanic sciatic stimulation
Moriyama et al. Decoy oligodeoxynucleotide targeting activator protein-1 (AP-1) attenuates intestinal inflammation in murine experimental colitis
Chen et al. Quercitrin extracted from Tartary buckwheat alleviates imiquimod-induced psoriasis-like dermatitis in mice by inhibiting the Th17 cell response
Bai et al. Leptin promotes glycolytic metabolism to induce dendritic cells activation via STAT3-HK2 pathway
Wang et al. Inhibition of miR-214-5p attenuates inflammatory chemotaxis and nerve regeneration obstruction after spinal cord injury in rats.
KR102304041B1 (en) Composition for preventing or treating inflammatory diseases comprising microrna inhibitors
JP2005263744A (en) Use of rare sugar for inhibiting t-lymphocyte proliferation
Jiang et al. Denatonium as a bitter taste receptor agonist damages jejunal epithelial cells of yellow-feathered chickens via inducing apoptosis
JP7193121B2 (en) Macrophage functional decline inhibitor
CN113559110A (en) Application of ouabain in preparation of Nrf2 inhibitor and medicine for treating diseases related to abnormal activation of Nrf2
KR20120056243A (en) Composition for preventing and treating inflammatory disease comprising piperine or pharmaceutically acceptable salt thereof as an active ingredient
CN114432302A (en) Application of small molecule SR9009 in resisting aging and relieving chronic inflammation caused by aging
KR101998478B1 (en) Composition of therapeutic agent containing microrna for treatment of atopy dermatitis
Kul et al. Trehalose consumption ameliorates pathogenesis in an inducible mouse model of the Fragile X-associated tremor/ataxia syndrome
KR20210012394A (en) A composition for enhancing immunity comprising broccoli leaves
KR102404677B1 (en) A Composition comprising branched DNA dendrimer as an active ingredient for enhancing immunity
KR102678583B1 (en) Composition for preventing or treating vascular diseases comprising hapln1
KR102153338B1 (en) Pharmaceutical composition for preventing or treating an inflammatory disease, comprising an extract of Canarium subulatum as an active ingredient
JP2019534325A (en) Composition for preventing or treating psoriasis containing a monoacetyldiacylglycerol compound
KR20220045852A (en) Composition for alleviating inflammation of trophoblastic cells comprising miR-146a, miR-548e or mixture thereof
KR102063779B1 (en) Pharmaceutical composition for preventing or treating inflammatory disease comprising dudleya brittonii extract

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant