KR102304041B1 - Composition for preventing or treating inflammatory diseases comprising microrna inhibitors - Google Patents

Abstract

The present invention relates to a composition for preventing or treating inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient, and more particularly, a pharmaceutical composition for preventing or treating inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient, It provides a health functional food composition for preventing or improving inflammatory diseases.
The microRNA inhibitor can effectively prevent, improve or treat various inflammatory diseases such as rheumatoid arthritis and osteoarthritis by significantly inhibiting the expression of inflammation-related factors such as MMP-3, IL-6, and IL-1β.

Description

Composition for preventing or treating inflammatory diseases comprising a microRNA inhibitor as an active ingredient {COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS}

The present invention relates to a composition for preventing or treating inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

Inflammation is one of the defense responses of living tissues against various stimuli such as physicochemical factors such as trauma or burns, or biological factors such as bacteria or viruses. It is a complex lesion involving branches.

There are various factors involved in this inflammatory response. First, matrix metalloproteinase-3 (MMP-3), also called stromelysin-1, responds to a variety of stimuli, including growth factors, cytokines, tumor promoters, and oncogene products. . In particular, it has been reported that MMP-3 is an enzyme actively involved in rheumatoid arthritis and ankylosing spondylitis, and can be a major marker for diagnosing the diseases and predicting the treatment response using the enzyme. (Best Practice & Research Clinical Rheumatology, 32(4): 550-562, Aaron Lerner et al., BMC Musculoskelet Disord. 2014; 15: 93. Shu Sun et al).

Interleukin 6 (IL-6) is a glycoprotein isolated from B cell stimulatory factor 2 (BSF-2) that induces final differentiation of B cells into antibody-producing cells, and is identical to interferon β2 (IFN-β2). is a molecule IL-6 is a pro-inflammatory cytokine produced by multiple cells such as T lymphocytes, B lymphocytes, macrophages, and fibroblasts, and is involved in immune responses, proliferation and differentiation of hematopoietic and nervous system cells, and acute reactions. do. Current Opinion in Rheumatology. 18(3):277-281, Nishimoto N), systemic juvenile idiopathic arthritis (Lancet. 371(9617): 998-1006, Yokota S et al), systemic redness Lupus reflex (Lupus. 13(5): 339-43, Tackey E et al), Castleman's disease (Blood. 106(8): 2627-32, Nishimoto N et al), Behcet's disease (Internal Medicine. 51(24): 3359-65, Hirohata S et al), psoriasis (Protein Sci. 6, 929-55, Simpson et al), it has been reported that IL-6 is involved with many diseases and inflammatory responses, Research on anti-IL-6 agents is ongoing as a treatment for these diseases.

Interleukin 1 beta (IL-1β) is one of two genes (IL-1α, IL-1β) of interleukin-1 (IL-1), and various cellular activities including cell proliferation, differentiation, and apoptosis It is a cytokine that is involved in the inflammatory response and is an important mediator of the inflammatory response. IL-1β has also been reported to be associated with acute or chronic inflammatory diseases such as rheumatoid arthritis, osteoarthritis, aphthous stomatitis, pharyngitis, and adenitis syndrome (Blood. 117(14)). ): 3720-3732. Charles A. Dinarello).

By regulating the factors related to the inflammatory response, there is a need for the development of effective therapeutic strategies that can prevent or treat various inflammatory diseases.

Korean Patent Publication No. 10-2013-0026950 (published on March 14, 2013)

It is an object of the present invention to provide an excellent pharmaceutical composition for preventing or treating inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

In addition, it is an object of the present invention to provide a health functional food composition for preventing or improving inflammatory diseases comprising a microRNA (microRNA) inhibitor as an active ingredient.

The pharmaceutical composition for preventing or treating inflammatory diseases according to the present invention may include a miR-337-3p inhibitor as an active ingredient.

The health functional food composition for preventing or improving inflammatory diseases according to the present invention may include a miR-337-3p inhibitor as an active ingredient.

One or more microRNA inhibitors selected from the group consisting of miR-337-3p inhibitors, miR-186 inhibitors, miR-216b inhibitors, and miR-760 inhibitors according to the present invention include MMP-3, IL-6, IL-1β, etc. can inhibit the expression of inflammation-related factors. Accordingly, it can be used as a pharmaceutical composition or a health functional food composition for preventing, improving, or treating various inflammatory diseases such as rheumatoid arthritis and osteoarthritis by including the microRNA inhibitor as an active ingredient.

When the microRNA inhibitor according to the present invention is mixed and used, the expression of the inflammation-related factor can be more effectively suppressed, and thus it can be utilized as an excellent therapeutic agent for inflammatory diseases.

1 shows the results of changes in the expression of inflammatory factors according to Experimental Example 1 of the present invention.
Figure 2 shows the result of the expression change of the inflammatory factor according to Experimental Example 2 of the present invention.
3 shows the result of the expression change of the inflammatory factor according to Experimental Example 3 of the present invention.

Hereinafter, the present invention will be described in detail.

As used herein, "prevention" refers to any action that suppresses or delays the onset of an inflammatory disease, or at least one or more symptoms of the disease by administration of the pharmaceutical composition or health functional food composition according to the present invention . Also included is treatment of a subject in remission of the disease to prevent or prevent recurrence.

As used herein, "treatment" refers to any act of improving or beneficially changing an inflammatory disease or at least one symptom of the disease, such as alleviating, reducing, or disappearing, by administering the pharmaceutical composition according to the present invention. means

In the present specification, "improvement" refers to an inflammatory disease, or at least one or more symptoms of the disease by ingestion of the health functional food composition according to the present invention, such as alleviating, reducing, or eliminating the symptoms to improve or beneficially change the symptoms means all actions.

As used herein, the term "pharmaceutical composition" refers to a composition administered for a specific purpose, and for the purpose of the present invention, it means to be administered to prevent or treat an inflammatory disease, or at least one or more symptoms of the disease.

As used herein, the term "health functional food" includes food manufactured and processed using raw materials or ingredients useful for the human body according to Act No. 6727 of the Health Functional Food Act, and in addition to nutrition, the purpose of the present invention It refers to foods with high medical and medical effects processed to efficiently exhibit bioregulatory functions such as prevention of inflammatory diseases, body defense, immunity, and recovery.

The present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient.

The miR-337-3p inhibitor may include any inhibitor capable of inhibiting microRNA (miRNA), and preferably a nucleic acid capable of complementary binding to all or part of the miR-337-3p nucleotide sequence. As a molecule, it may be an antagomir, an antisense oligonucleotide, and may be an siRNA (small interfering RNA), shRNA (short hairpin RNA) or RNA aptamer specific for the miR-337-3p. It is not limited.

The antisense oligonucleotide includes a nucleic acid-based molecule capable of forming a duplex with a miRNA by having a complementary sequence to the target miRNA, particularly the leader sequence of the miRNA, for example, a ribonucleotide ( RNA), deoxyribonucleotides (DNA), 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, peptide nucleic acid (PNA) or locked nucleic acid (LNA).

More preferably, the miR-337-3p inhibitor may be an antisense inhibitor of the RRRQRRKKR-OO-GAAAGGCATCATATAGGA structure comprising SEQ ID NO: 1 (GAAAGGCATCATATAGGA) and linked to a cell penetrating peptide and an AEEA linker. The inhibitor may inhibit the action of miR-337-3p by complementary binding to the miR-337-3p nucleotide sequence.

The pharmaceutical composition for preventing or treating inflammatory diseases according to the present invention may further include one or more microRNA inhibitors selected from the group consisting of a miR-186 inhibitor, a miR-216b inhibitor, and a miR-760 inhibitor. Preferably, the miR-337-3p inhibitor and one or more microRNA inhibitors selected from the group consisting of the miR-186 inhibitor, miR-216b inhibitor, and miR-760 inhibitor may be mixed.

The inhibitor may include any inhibitor capable of inhibiting miRNA, preferably a nucleic acid molecule capable of complementary binding to all or part of the base sequence of miR-186, miR-216b, or miR-760. For example, it may be an antagomir, an antisense oligonucleotide, and a small interfering RNA (siRNA), short hairpin RNA (shRNA) or RNA specific for the miR-186, miR-216b, or miR-760. It may be an aptamer, but is not limited thereto.

More preferably, the miR-186 inhibitor comprises SEQ ID NO: 2 (CCAAAAGGAGAATTCTTT), the antisense inhibitor of the RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT structure linked to a cell penetrating peptide and an AEEA linker, the miR-216b inhibitor is SEQ ID NO: 3 (TTGCCTGCAGAGATT) ) an antisense inhibitor of the structure RRRQRRKKRR-OO-TTGCCTGCAGAGATT, the miR-760 inhibitor may be an antisense inhibitor of the structure RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG comprising SEQ ID NO: 4 (TCCCCACAGACCCAGAGCCG). The inhibitor may inhibit the action of miR-186, miR-216b, or miR-760 by complementary binding to the nucleotide sequence of miR-186, miR-216b, or miR-760.

antisense sequence Antisense inhibitor structure miR-337-3p inhibitor SEQ ID NO: 1 (GAAAGGCATCATATAGGA) RRRQRRKKR-OO-GAAAGGCATCATATAGGA miR-186 inhibitor SEQ ID NO:2 (CCAAAAGGAGAATTCTTT) RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT miR-216b inhibitor SEQ ID NO:3 (TTGCCTGCAGAGATT) RRRQRRKKRR-OO-TTGCCTGCAGAGATT miR-760 inhibitor SEQ ID NO:4 (TCCCCACAGACCCAGAGCCG) RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG

Table 1 shows the structure of the antisense inhibitor of microRNA according to the present invention.

The miRNA according to the present invention may be isolated or prepared using standard molecular biology techniques, for example, chemical synthesis or recombinant methods, or commercially available ones. In addition, the composition according to the present invention may further include other substances capable of increasing the anti-inflammatory activity of the present invention in a cell as well as the miRNA, for example, a compound, a natural product, a novel protein, and the like.

In the pharmaceutical composition according to the present invention, the inhibitor may inhibit the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β.

According to an experimental example of the present invention, when the miR-337-3p inhibitor was treated with human colorectal cancer cells (HCT116) and breast cancer cells (MCF-7), inflammation induced by LPS treatment (6 μg/μl) The increased expression of factors MMP-3, IL-6, and IL-1β was significantly reduced, and when the miR-337-3p inhibitor was mixed with a miR-186 inhibitor, a miR-216b inhibitor and a miR-760 inhibitor , it was confirmed that the expression of the inflammatory factor was more effectively reduced.

Using the above effects, the miR-337-3p inhibitor according to the present invention can be used as a pharmaceutical composition for preventing or treating inflammatory diseases.

As described above, matrix metalloproteinase-3 (MMP-3), interleukin 6 (IL-6) and interleukin 1 beta (IL-1β) are major mediators of the inflammatory response. has been associated with various inflammatory diseases.

The inflammatory diseases are a generic term for diseases whose main lesions are the pathological conditions of abscesses formed due to bacterial invasion, rheumatoid arthritis, osteoarthritis, juvenile idiopathic arthritis, systemic lupus erythematosus, ankylosing spondylitis, psoriasis, It may be selected from the group consisting of Crohn's disease, Castleman's disease, cervical lymphadenitis, pharyngitis, uveitis, dermatitis, and aphthous stomatitis, but is not limited thereto.

The pharmaceutical composition according to the present invention may include chemicals, nucleotides, antisense, siRNA oligonucleotides, and natural product extracts as active ingredients.

The pharmaceutical composition according to the present invention may be prepared according to a conventional method in the pharmaceutical field. The pharmaceutical composition may be combined with a suitable pharmaceutically acceptable carrier according to the formulation, and if necessary, an excipient, diluent, dispersant, emulsifier, buffer, stabilizer, binder, disintegrant, solvent, etc. to be prepared. can The "pharmaceutically acceptable" means that it is not toxic to cells or humans exposed to the pharmaceutical composition, and the appropriate carrier does not inhibit the activity and properties of the inhibitor according to the present invention, the dosage form and It may be selected differently depending on the formulation.

The pharmaceutical composition according to the present invention can be applied in any dosage form, and acceptable pharmaceutical carriers in the composition formulated as a liquid solution are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection. Solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension, emulsion, etc., pills, capsules, granules or tablets.

In the pharmaceutical composition according to the present invention, the pharmaceutical composition may be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and not cause side effects.

The effective dose level of the pharmaceutical composition is determined by the purpose of use, the age, sex, weight and health status of the patient, the type of disease, severity, drug activity, sensitivity to drug, administration method, administration time, administration route and excretion rate, treatment It may be determined differently depending on factors including the duration, formulation or concurrent use of drugs and other factors well known in the medical field. For example, although not constant, in adults, 0.1 ng/kg to 10 g/kg when the inhibitor according to the invention is a compound, 0.1 ng/kg to 10 g/kg for a polypeptide, protein or antibody, antisense nucleotide, siRNA , shRNAi or miRNA may be administered once or several times a day at a dose of 0.01 ng/kg to 10 g/kg. The above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition according to the present invention may be administered to any animal capable of developing an inflammatory disease, and the animal may include, for example, not only humans and primates, but also livestock such as cattle, pigs, horses, and dogs. .

The pharmaceutical composition according to the present invention may be administered by an appropriate administration route according to the form of the formulation, and may be administered through various routes, either oral or parenteral, as long as it can reach the target tissue. The administration method is not particularly limited, and for example, oral, rectal or intravenous, intramuscular, subcutaneous, endobronchial inhalation, intrauterine dural or intracerebroventricular injection, etc. can be administered in a conventional manner. .

The pharmaceutical composition according to the present invention may be used alone for preventing or treating inflammatory diseases, or may be used in combination with surgery or other drug treatment.

In addition, the present invention provides a health functional food composition for preventing or improving inflammatory diseases comprising a miR-337-3p inhibitor as an active ingredient. The composition may further include one or more microRNA inhibitors selected from the group consisting of a miR-186 inhibitor, a miR-216b inhibitor, and a miR-760 inhibitor. Corresponding features may be substituted for the above-mentioned parts.

In the health functional food composition according to the present invention, the inhibitor can inhibit the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β, and using this effect, The inhibitor may be used as a health functional food composition for the prevention or improvement of inflammatory diseases.

In the health functional food composition according to the present invention, the health functional food may be prepared in powder, granule, tablet, capsule, syrup or beverage, etc., and there is no limitation in the form that the health functional food can take, It can include any food with meaning. For example, beverages and various drinks, fruits and their processed foods (canned fruit, jam, etc.), fish, meat and their processed foods (ham, bacon, etc.), breads and noodles, cookies and snacks, dairy products (butter, cheese, etc.) ), etc. are possible, and may include all functional foods in a conventional sense. It may also include food used as feed for animals.

The health functional food composition according to the present invention may be prepared by further including pharmaceutically acceptable food additives (food additives) and other suitable auxiliary ingredients commonly used in the art. Unless otherwise specified, the suitability as a food additive can be judged according to the standards and standards for the relevant item in accordance with the general rules and general test methods of the Food Additives Code approved by the Food and Drug Administration.

The other auxiliary ingredients include, for example, flavoring agents, natural carbohydrates, sweeteners, vitamins, electrolytes, coloring agents, pectic acid, alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents, etc. may further contain. In particular, as the natural carbohydrate, monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol can be used. , as the sweetener, natural sweeteners such as taumatine and stevia extract or synthetic sweeteners such as saccharin and aspartame may be used.

The effective dose of the inhibitor contained in the health functional food according to the present invention may be appropriately adjusted according to the purpose of use, such as prevention or improvement of inflammatory diseases.

The composition has the advantage that there are no side effects that may occur during long-term administration of general drugs using food as a raw material, and has excellent portability, and can be taken as an adjuvant for preventing or improving inflammatory diseases.

Hereinafter, to help the understanding of the present invention, examples will be described in detail. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

<Experiment preparation and method> Western blotting

miR-186, miR-216b, miR-337-3p and miR-760 mimics and control miRNAs were purchased from Genolution Inc (Seoul, Korea) and used. Antisense inhibitors of the four miRNAs were purchased from Panagene Inc (Seoul, Korea).

Table 2 below shows microRNA and microRNA antisense inhibitors used in an experimental example of the present invention. RRRQRRKKRR is a cell penetrating peptide and OO is an AEEA linker.

mimics miR-337-3p Forward: 5'-CUCCUAUAUGAUGCCUUUCUUC-3'
Reverse: 5'-GAAGAAAGGCAUCAUCUAGGAG-3' miR-186 Forward: 5'-CAAAGAAUUCUCCUUUUGGGCU-3'
Reverse: 5'-AGCCCAAAAGGAGAAUUCUUG-3' miR-216b Forward: 5'-AAAUCUCUGCAGGCAAAUGUGA-3'
Reverse: 5'-UCACAUUUGCCUGCAGAGAUUU-3' miR-760 Forward: 5'-CGGCUCUGGGUCUGUGGGGA-3'
Reverse: 5'-UCCCACAGACCCAGAGCCG-3' negative control Forward: 5'-ACGUGACACGUUCGGGAGAAUU-3'
Reverse: 5'-UUCUCCGAACGUGUCACGUUU-3'

antisense inhibitors miR-337-3p RRRQRRKKR-OO-GAAAGGCATCATATAGGA miR-186 RRRQRRKKRR-OO-CCAAAAGGAGAATTCTTT miR-216b RRRQRRKKRR-OO-TTGCCTGCAGAGATT miR-760 RRRQRRKKRR-OO-TCCCCACAGACCCAGAGCCG negative control RRRQRRKKRR-OO-CTCCCTTCAATC

HCT116 human colorectal cancer cells and MCF-7 human breast cancer cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) at 5% CO ₂ , and 37° C. conditions. The miRNA and miRNA inhibitors were transfected into the cells using lipofectamine RNAi max (Invitrogen, Carlsbad, CA) at a final concentration of 40 nM. Transfected cells were prepared according to the previous paper FEBS Lett. 585 (2011) 3360-3366 (SY Jang, SY Kim, Bae, YS p53 deacetylation by SIRT1 decreases during protein kinase CKII downregulation-mediated cellular senescence). 48 hours after transfection, cells were harvested.

Quantitate each protein sample and quantify 30 μg of 3 as SDS sample loading buffer (60 mM Tris pH 6.8, 25% glycerol, 2% SDS, 14.4 mM β-mercaptoethanol, 0.1% bromophenol blue). After boiling for minutes, electrophoresis was performed on an 8-12% SDS-polyacrylamide gel. This was transferred to a nitrocellulose membrane and confirmed by staining with Ponceau S, and then the membrane was confirmed by 5% albumin in TBSt (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tween20), Bovine (BSA, Amresco, Ohio, USA). After blocking for 2 hours or more with a buffer containing In the case of anti-MMP-3, IL-6 and IL-1β antibodies, diluted 1:500-2000, reacted at 4°C for 15 hours, washed 3 times for 10 minutes with TBSt buffer, then diluted 1:2000 After incubation with anti-Mouse IgG antibody at room temperature for 1 hour, it was washed 3 times for 10 minutes each again with TBSt buffer. After the antibody reaction, ECL was treated and photosensitized for 1 hour before development.

<Experimental Example 1> Confirmation of expression changes of inflammatory factors (MMP-3, IL-6, IL-1β) according to microRNA or microRNA antisense inhibitor treatment in human colon cancer cells (HCT116) and breast cancer cells (MCF-7)

1 shows the result of inflammatory factor expression change according to Experimental Example 1 of the present invention. Referring to this, four types of microRNAs, miR-186, miR-216b, miR-760 and miR-337-3p, were administered to human colon cancer. When cells (HCT116) and breast cancer cells (MCF-7) were treated, the expression of inflammatory factors MMP-3, IL-6, and IL-1β was increased, and miR-186, miR-216b, miR-760 And when the cells were treated with an antisense inhibitor of miR-337-3p, the expression of the inflammatory factor was significantly reduced.

<Experimental Example 2> Confirmation of the inhibitory effect of inflammatory factor expression induced by lipopolysaccharide (LPS) treatment

Figure 2 shows the result of inflammatory factor expression change according to Experimental Example 2 of the present invention. Referring to this, the increased expression of inflammatory factors induced by LPS treatment (6 μg/μl) is miR-186, miR-216b , was significantly reduced when treated with antisense inhibitors of miR-760 and miR-337-3p.

<Experimental Example 3> Confirmation of inflammatory factor expression change according to microRNA antisense inhibitor alone or mixed treatment

3 shows the result of inflammatory factor expression change according to Experimental Example 3 of the present invention. Referring to this, the increased expression of the inflammatory factor induced by LPS treatment (6 μg/μl) is miR-186, miR-216b , miR-760 and miR-337-3p were both inhibited when treated with the antisense inhibitor alone and when the antisense inhibitor was mixed. In particular, when the antisense inhibitor of miR-186, miR-216b, miR-760, and miR-337-3p was mixed, it was confirmed that the expression of the inflammatory factor was more strongly inhibited than when the antisense inhibitor was treated alone. have.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES COMPRISING MICRORNA INHIBITORS <130> ADP-2019-0451 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-337-3p antisense <400> 1 gaaaggcatc atatagga 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> miR-186 antisense <400> 2 ccaaaaggag aattcttt 18 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> miR-216b antisense <400> 3 ttgcctgcag agatt 15 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-760 antisense <400> 4 tccccacaga cccagagccg 20

Claims (8)

A pharmaceutical composition for preventing or treating inflammation due to breast cancer, comprising as an active ingredient an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-337-3p. The method of claim 1,
The composition is
consisting of an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-186, an antisense nucleic acid molecule complementary to binding to the nucleotide sequence of miR-216b, and an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-760 A pharmaceutical composition, characterized in that it further comprises one or more selected from the group. 3. The method according to claim 1 or 2,
The composition is
A pharmaceutical composition, characterized in that it inhibits the expression of one or more inflammation-related factors selected from the group consisting of MMP-3, IL-6 and IL-1β. An antisense nucleic acid molecule that complementarily binds to the nucleotide sequence of miR-337-3p, an antisense nucleic acid molecule that complementarily binds to the nucleotide sequence of miR-186, an antisense nucleic acid molecule that complementarily binds to the nucleotide sequence of miR-216b; And a reagent composition for inhibiting the expression of IL-6 or IL-1β in breast cancer cells comprising at least one selected from the group consisting of antisense nucleic acid molecules that complementarily bind to the nucleotide sequence of miR-760 as an active ingredient. Antisense nucleic acid molecule complementary to miR-337-3p nucleotide sequence, antisense nucleic acid molecule complementary to miR-186 nucleotide sequence, miR-216b nucleotide sequence in breast cancer cells in vitro IL-6 or IL of breast cancer cells, comprising the step of treating at least one selected from the group consisting of antisense nucleic acid molecules that complementarily bind to, and antisense nucleic acid molecules that complementarily bind to the nucleotide sequence of miR-760 A method of inhibiting the expression of -1β. delete A health functional food composition for preventing or improving inflammation due to breast cancer, comprising as an active ingredient an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-337-3p. 8. The method of claim 7,
The composition is
consisting of an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-186, an antisense nucleic acid molecule complementary to binding to the nucleotide sequence of miR-216b, and an antisense nucleic acid molecule complementary to the nucleotide sequence of miR-760 Health functional food composition, characterized in that it further comprises one or more selected from the group.

Images