KR20120056243A - Composition for preventing and treating inflammatory disease comprising piperine or pharmaceutically acceptable salt thereof as an active ingredient - Google Patents

Abstract

PURPOSE: A composition containing piperine is provided to effectively suppress inflammation caused by LPS and to prevent and treat inflammatory diseases. CONSTITUTION: A pharmaceutical composition for preventing and treating inflammatory diseases contains piperine of chemical formula I or pharmaceutically acceptable salt thereof as an active ingredient. Piperine is isolated from Piper longum, Piper nigrum, Piper cubeba, or Anethum graveolens using alcohol of 1-6 carbon atoms such as water, ethanol, methanol, propanol, isopropanol, and butanol, and organic solvent such as acetone, ether, chloroform, ethyl acetate, methylene chloride, hexane, cyclo hexane, petroleum ether, diethyl ether, and benzene.

Description

Composition for preventing and treating inflammatory diseases comprising piperine or a pharmaceutically acceptable salt thereof as an active ingredient

The present invention relates to a novel use of piperine, and more particularly, a pharmaceutical composition for preventing and treating inflammatory diseases comprising piperine or a pharmaceutically acceptable salt thereof as an active ingredient or food for preventing and improving inflammation It relates to the composition.

Inflammatory reactions are stimulated by damage or foreign substances such as bacteria, fungi, and viruses, and a series of complex physiological reactions such as activation of enzymes by various inflammatory mediators and immune cells, secretion of inflammatory mediators, infiltration of body fluids, cell migration, and tissue destruction. It refers to what happens, and this is accompanied by symptoms such as erythema, swelling, fever, and pain. The inflammatory reaction removes external infectious agents and regenerates damaged tissues to restore the function of living organisms, but if the inflammatory reaction is excessive or continuous, such as antigens are not removed or internal substances are the cause, rather mucosal damage and tissue destruction occur. It can also cause diseases such as cancer, inflammatory skin disease, inflammatory bowel disease, and arthritis.

Until now, antihistamines, vitamin ointments, and corticosteroids have been mainly used for the treatment of such inflammatory diseases. However, these drugs have a temporary effect in most cases and have severe side effects, so development of a new substance capable of treating inflammatory diseases has been required.

Piper Logum (black pepper, Piper longum ) And Piper Negroum (long pepper, Piper nigrum), piperine is a plant alkaloid with a long history for medical use, and its structural formula is C ₁₇ H ₁₉ NO ₃ . Rogum Piper (Piper longum ) and Piper nigrum are mainly It has been mainly used as an effective treatment for gonorrhea, menstrual pain, tuberculosis, sleep disorders, respiratory infections, and chronic digestive tract pain. In vitro and in the body ( in In vivo ) studies have functionally applied piperine as an antidepressant, hepatoprotective, antimetastatic, antithyroid, immunomodulatory and anticancer component.

Accordingly, the inventors of the present invention found out that piperine is effective in the prevention and treatment of inflammatory diseases by inhibiting the inflammatory reaction caused by LPS while studying the new physiological activity of piperine. The present invention was completed by developing a composition for prevention and treatment.

Accordingly, it is an object of the present invention to provide a novel use of piperine.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing and treating inflammatory diseases comprising piperine as an active ingredient.

In order to achieve another object of the present invention, the present invention provides a food composition for preventing and improving inflammation comprising piperine as an active ingredient.

Hereinafter, the content of the present invention will be described in more detail.

The composition of the present invention contains piperine represented by the following formula (1) or a pharmaceutically acceptable salt (or salt thereof) as an active ingredient, and prevents and treats (or improves) an inflammatory disease (or inflammation). It can be used for the purpose of.

Piperine can be separated and purified from nature, purchased and used commercially, or can be prepared by chemical synthesis methods known in the art. Separated and purified from nature is Long Pepper, Piper, a plant containing piperine. longum ), Black Pepper, Piper nigrum ), Cubeb, Piper cubeba ) or dill (Dill, Anethum graveolens ) can be separated and purified by a solvent extraction method known in the art and a separation method using chromatography. For example, the extraction of piperine from the plant is an alcohol having 1 to 6 carbon atoms such as water, ethanol, methanol, propanol, isopropanol, butanol, acetone, ether, chloroform, ethyl acetate , Methylene chloride, hexane, cyclohexane, petroleum ether (petrolem ether), diethyl ether, it can be extracted using any one selected from organic solvents such as benzene, or a mixed solvent thereof. In addition, a separation method using chromatography known in the art from the extract, for example, a silica gel column chromatography method, is used to obtain a fraction according to polarity, and the separated specific fraction is again subjected to reverse phase column chromatography and high performance liquid chromatography. It can be separated through the (HPLC) method.

In one embodiment of the present invention, in order to confirm the LPS-induced reaction of piperine, the reaction and inflammatory response-related delivery material in mice to which LPS was administered were identified. As a result, administration of piperine suppressed LPS-induced endotoxin shock and suppressed the production of TNF-α, but did not inhibit the production of interleukin-1b (IL-1β) and interleukin-6 (IL-6). In peritoneal macrophages, piperine inhibited the production of TNF-α, whereas it did not inhibit the production of interleukin-1b (IL-1β) and interleukin-6 (IL-6). Moreover, the production of poly (I:C) and CpG-ODN-induced TNF-α was also inhibited. The above inhibitory effect of piperine was regulated by inhibition of ERK1/2 and JNK1/2 activity, but not by p38 MAPK and NF-κB. To investigate the role of reduced TNF-α in the inhibition of endotoxin shock, as a result of using TNF-α knockout mice, piperine inhibited LPS-induced endotoxin shock in TNF-α knockout mice. In addition, in order to clarify the mechanism of inhibition of LPS-induced endotoxin shock, mRNA expression of type 1 interferon (type I IFN) was investigated. As a result, piperine suppressed the LPS-induced expression of type 1 interferon (type I IFN) by reducing the levels of interferon regulatory factors (IRF-1 and IRF-7). , Pretreatment with piperine inhibited the phosphorylation and translocation of IRF-3 in the nucleus Through the above results, piperine inhibited the LPS-induced production of TNF-α and type 1 interferon, which is presumably by LPS. It was found that it suppressed the induced inflammatory response.

Accordingly, the present invention provides a pharmaceutical composition for preventing and treating inflammatory diseases comprising piperine or a pharmaceutically acceptable salt thereof.

Piperine according to the present invention may be used as such or in the form of a pharmaceutically acceptable salt. In the above,'pharmaceutically acceptable' refers to physiologically acceptable and when administered to humans, usually does not cause an allergic reaction or a similar reaction, and as the salt, a pharmaceutically acceptable free acid Acid addition salts formed by Organic acids and inorganic acids may be used as the free acid. The organic acid is not limited thereto, but citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, Glutanic acid and aspartic acid. In addition, the inorganic acids include, but are not limited to, hydrochloric acid, bromic acid, sulfuric acid, and phosphoric acid.

* Inflammatory diseases to which the compounds according to the present invention can be applied are, but are not limited to, inflammatory skin diseases, inflammatory bowel diseases such as Crohn's desease and ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, Pancreatitis, traumatic shock, bronchial asthma, allergic rhinitis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathy, ankylosing spondylitis, Reiter syndrome, psoriatic arthrosis, Intestinal disease spondylitis, juvenile arthritis, juvenile ankylosing spondylitis, reactive arthritis, infectious arthritis, post-infectious arthritis, gonococcal arthritis, tuberculous arthritis, viral arthritis, fungal arthritis, syphilitic arthritis, Lyme disease,'angiitis syndrome 'Related arthritis, polyarteritis nodosa, irritable vasculitis, lugenic granulomatosis, rheumatoid polymyalgia, articular cell arteritis, calcium crystallization arthritis, pseudogout, non-articular rheumatism, bursitis, tendonitis, epicondylitis (tennis elbow) , Neuropathic joint disease (charco and joint), hemorrhagic arthrosis (hemarthrosic), Henoch-Schenlein purpura, hypertrophic osteoarthrosis, multicentric reticulocytosis, surcoilosis, hemoglobinosis, sickle cellosis and other hemoglobin Disease, hyperlipoproteinemia, hypogammaglobulinemia, familial Mediterranean fever, Behart's disease, systemic lupus erythematosus, recursive fever, psoriasis, multiple sclerosis, sepsis, septic shock, multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic Chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury and broncho-pulmonary dysplasia.

In addition, the inflammatory skin disease is not limited thereto, but skin inflammation, acute or chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic lichen planus, interstitial dermatitis, deprived dermatitis, papular urticaria, psoriasis, psoriatic arthritis , Sun dermatitis, sunburn and acne.

The pharmaceutical composition according to the present invention may contain piperine or a pharmaceutically acceptable salt thereof alone, or may further contain one or more pharmaceutically acceptable carriers, excipients or diluents.

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, the carrier for parenteral administration may include water, suitable oils, saline, aqueous glucose and glycol, and the like, and may further include stabilizers and preservatives. Suitable stabilizers are antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives are benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to as those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The pharmaceutical composition for preventing or treating skin diseases of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal administration Can be Preferably, the pharmaceutical composition of the present invention can be administered transdermally. In the above, "transdermal administration" refers to administering the pharmaceutical composition of the present invention to cells or skin so that the active ingredient contained in the pharmaceutical composition for preventing or treating inflammatory diseases is delivered into the skin. For example, the pharmaceutical composition of the present invention may be prepared in an injectable formulation and administered by a method of lightly pricking the skin with a 30 gauge thin injection needle, or by applying it directly to the skin.

The pharmaceutical composition of the present invention can be formulated into a formulation for oral administration or parenteral administration according to the route of administration as described above.

In the case of a formulation for oral administration, the composition of the present invention may be formulated using a method known in the art as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. I can. For example, in oral preparations, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, pulverizing it, adding a suitable auxiliary, and processing it into a granule mixture. Examples of suitable excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches, including corn starch, wheat starch, rice starch and potato starch, and the like, cellulose, Fillers such as celluloses including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, gelatin, polyvinylpyrrolidone, and the like may be included. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and a preservative.

In the case of a formulation for parenteral administration, it can be formulated in the form of injections, creams, lotions, ointments for external use, oils, moisturizers, gels, aerosols, and nasal inhalants by a method known in the art. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a formula generally known for all pharmaceutical chemistry.

The total effective amount of piperine of the present invention may be administered to a patient as a single dose, and may be administered by a fractionated treatment protocol that is administered in multiple doses for a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient according to the severity of the disease. Preferably, the preferred total dose of piperine of the present invention may be about 0.01 μg to 1,000 mg, most preferably 0.1 μg to 100 mg per 1 kg of the patient's body weight per day. However, the dose of piperine is determined by taking into account various factors such as the patient's age, weight, health status, sex, disease severity, diet and excretion rate, as well as the route of administration and the number of treatments of the pharmaceutical composition. Therefore, considering these points, those of ordinary skill in the art will be able to determine an appropriate effective dosage of piperine according to a specific use as a prophylactic or therapeutic agent for inflammatory diseases. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, and method of administration as long as it exhibits the effects of the present invention.

In addition, piperine according to the present invention may be provided in the form of a food composition for the purpose of preventing and improving inflammation. The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

For example, as a health food, piperine of the present invention itself can be prepared in the form of tea, juice, and drinks to be consumed, or can be ingested by granulating, encapsulating and powdering. In addition, it can be prepared in the form of a composition by mixing piperine of the present invention with a known substance or active ingredient known to have an effect of preventing and improving inflammation.

In addition, functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (eg, canned fruit, bottled, jam, marmalade, etc.), fish, meat and processed foods thereof (eg, ham, sausage corn beef). Etc.), bread and noodles (e.g. udon, soba, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein , Retort foods, frozen foods, various seasonings (eg, miso, soy sauce, sauce, etc.), etc., can be prepared by adding piperine of the present invention.

In addition, in order to use the piperine of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.

For reference, the following documents can be referenced for the nucleotide and protein work mentioned in the present invention (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Sambrook et al. al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA ( 1990)).

In addition, the drawings of the present invention may refer to the following description.

1 shows the effect of piperine on LPS-induced endotoxin shock. Endotoxin shock was induced in 6-8 week old C57BL/6 female mice as mentioned in the examples. (A) The effect of piperine on the survival rate of endotoxin shock mice (10 mice per group) was confirmed by observing the survival for 120 hours. In order to confirm the effect of piperine on LPS-induced TNF-α, interleukin-1β and interleukin-6 production in the body, piperine was injected intraperitoneally at 1 or 5 mg/kg into mice (6 mice per group). . Serum samples were collected from mice after 3 hours of administration of 37.5 mg/kg of LPS for detection of TNF-α, interleukin-1β, and interleukin-6. Peritoneal macrophages were pretreated with 1, 5, or 10 uM piperine for 30 minutes before stimulation with 500 ng/ml LPS for 24 hours. Culture supernatant was harvested for detection of TNF-α, interleukin-1β and interleukin-6. The amounts of NO, TNF-α and interleukin-6 were measured as described in the Examples. The kinetics of LPS-dependent TNF-α transcription was investigated through real-time reverse transcriptase enzymatic polymerization. To investigate the effect of piperine on the LPS-induced expression of TNF-α and interleukin-6 mRNA, cells were pretreated with 10 uM piperine for 30 minutes before stimulation with 500 ng/ml LPS at the time period indicated in the figure. (Fig. 1d and e). *,P<0.05 vs. DMSO treatment group; †, P<0.05 vs. LPS alone treatment group. Data are mean±SEM values of experiments performed in duplicate individually.

Fig. 2 shows the effect of piperine on the production of pro-inflammatory cytokines in peritoneal macrophages. Cells were pretreated with 1, 5, or 10 uM piperine for 30 minutes before stimulation with (A) poly(I:C) (50 ug/ml) or (C) CpG-ODN (10 ug/ml) for 24 hours. . Culture supernatant was harvested for detection of TNF-α, interleukin-1β and interleukin-6. The dynamics of CpG-ODN-dependent TNF-α transcription were investigated through real-time reverse transcriptase enzymatic polymerization. To investigate the effect of piperine on the LPS-induced expression of TNF-α and interleukin-6 mRNA, 10 μM of blood before stimulation of cells with poly(I:C) or CpG-ODN at the time points indicated in the figure. It was pretreated with ferrin for 30 minutes. *,P<0.05 vs. DMSO treatment group; †, P<0.05 vs. LPS alone treatment group. Data are the mean±SEM values of experiments repeated three times individually.

3 shows that piperine inhibits ERK and JNK phosphorylation, but does not inhibit p38 phosphorylation, and does not inhibit Iκ-Bα decline. To investigate the effect of piperine in inhibiting ERK, p38, JNK activation and Iκ-Bα decline (A and B), cells were stimulated with LPS, poly(I:C) and CpG-ODN at the time periods indicated in the figure. Previously, it was pretreated with 10 uM piperine for 30 minutes. In each cell lysate, 20 ug of protein was separated by 10% SDS-PAGE. To confirm the function of ERK and JNK in TNF-α production using inhibitors of ERK (PD98059) and JNK (SP60025), cells were stimulated with 500 ng/ml LPS for 24 hours before stimulation with 10 uM of PD98059 and/or SP60025. It was pretreated for 30 minutes. The culture supernatant was harvested for (C)TNF-α detection. *,P<0.05 vs. DMSO treatment group; †, P<0.05 vs. LPS alone treatment group. Data are mean±SEM values of experiments performed in duplicate individually.

Fig. 4 shows the effect of piperine on LPS-induced endotoxin shock in TNF-α knockout mice. Endotoxin shock was induced by intraperitoneal injection of bacterial endotoxin (37.5 mg/kg as LPS derived from E. coli serotype O55:B5) in 6-8 week old TNF-α knockout mice. DMSO (control) and piperine (1 or 5 mg/kg) were administered to mice in group 3 (10 mice per each group). After 3 hours, 37.5 mg of LPS was administered, and the survival rate for 120 hours was investigated.

5 shows the effect of piperine on LPS-induced type 1 IFN production in peritoneal macrophages. To confirm the effect of piperine on LPS-induced type 1 IFN (A) and IRF mRNA (B) expression, cells were stimulated with 500 ng/ml of LPS at the time period indicated in the figure. Pre-treat for minutes. The phosphorylation (C) of IRF-3 was also investigated. First, cells were pretreated with 10 uM of piperine for 30 minutes, and then stimulated with 500 ng/ml of LPS or LPS alone at the times indicated in the figure. In each cell lysate, 20 ug of protein was separated by 10% SDS-PAGE. Western blot was performed to investigate IRF-3 activation. Cells were pretreated with 10 uM piperine for 30 minutes and stimulated with 500 ng/ml LPS or LPS alone for 30 minutes. *,P<0.05 vs. DMSO treatment group; †, P<0.05 vs. LPS alone treatment group. Similar results were obtained in three separate experiments.

Fig. 6 shows the effect of piperine in inducing type 1 IFN in abdominal cavity macrophages. To investigate the effect of piperine on expression of (A) poly(I:C) or CpG-ODN-inducible (A) type 1 IFN (B) IRF-1 and IRF-7 mRNA, cells were treated with 10 μM of blood. It was pretreated for 30 minutes in the presence or absence of ferrin, and incubated with poly(I:C) or CpG-ODN. *,P<0.05 vs. DMSO treatment group; †, P<0.05 vs. LPS alone treatment group. Data are the mean±SEM values of experiments repeated three times individually.

Accordingly, the present invention provides a composition for preventing and treating inflammatory diseases comprising piperine or a pharmaceutically acceptable salt thereof as an active ingredient as a novel use of piperine. The composition containing piperine of the present invention effectively inhibits the inflammatory reaction caused by LPS, and thus can be effectively used for the prevention and treatment of inflammatory diseases.

1 shows the effect of piperine on LPS-induced endotoxin shock.
Fig. 2 shows the effect of piperine on the production of pro-inflammatory cytokines in peritoneal macrophages.
3 shows that piperine inhibits ERK and JNK phosphorylation, but does not inhibit p38 phosphorylation, and weakly inhibits the decline of Iκ-Bα.
Fig. 4 shows the effect of piperine on LPS-induced endotoxin shock in TNF-α knockout mice.
5 shows the effect of piperine on LPS-induced type 1 IFN production in peritoneal macrophages.
Fig. 6 shows the effect of piperine in inducing type 1 IFN in abdominal cavity macrophages.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

<Experiment method>

1. Reagent

RPMI-1640, bovine serum (Fetal Bovine Serum, FBS), penicillin and streptomycin were obtained from Gibco BRL (Grand Island, New York). An ELISA (Enzyme-linked immunosorbant assay, ELISA) kit for detecting interleukin-1β, interleukin-6 and TNF-α was purchased from R&D System (Minneapolis, Minnesota). E. coli 055:B5 LPS, piperine, poly (I:C), CpG-ODN (5'-TCCATGACGTTCCTGAATGCT-3'; SEQ ID NO: 1) and Griess reagent are Sigma-Aldrich (Saint Louis, Missouri) I bought it at. Thioglycollate (TG) was purchased from BD Pharmingen (San Diego, CA). Total antibodies and phosphate specific antibodies to MAPK, IRF-1 and IRF-3dp were purchased from Cell Signaling Technology (Beverly, Miami), and IRF-3 was purchased from Zymed (San Francisco, CA). IκB-α monoclonal antibody and peroxidase-conjugate secondary antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). The transstained SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) markers were purchased from Bio-Rad (Hercules, Calif.). Trizol reagent, MML-V (Moloney murine leukemia virus) reverse transcriptase and polymerase chain reaction (PCR) kit were purchased from Invitrogen coorporation (Carlsbet, Calif.). Inducible nitric oxide synthase (iNOS), interleukin-6, TNF-α, interleukin-1β and β-actin oligonucleotide primers were purchased from Genotech (Daejeon, Korea). TNF-α knockout (B6; 129S6-TnftmlGkl/ J) and control mice were purchased from Jackson Laboratory (Bar Harbor, Maine). C57BL/6 mice were purchased from Orient Bio (Seongnam, Gyeonggi-do, Korea).

2. Endotoxin Shock's animal model

Endotoxin shock was induced by intraperitoneal injection (ip) of bacterial endotoxin (E. coli 055:B5 LPS at 37.5 mg/kg) in 6-8 week old female C57BL/6 mice. DMSO (control) or piperine (1 mg/kg or 5 mg/kg) was intraperitoneally injected into 3 groups of mice (10 mice per group). After 1 hour of piperine administration, 37.5 mg/kg of LPS was intraperitoneally injected into the control or piperine-treated mice. Viability was observed for 120 hours. Animal use and experimental procedures were carried out in accordance with the KFDA guidelines for the maintenance and use of experimental animals, and the experiment was approved by the Animal Protection Committee of Wonkwang University.

3. Blood sample collection in the body

Piperine (1 or 5 mg/kg body weight) was intraperitoneally administered to mice (6 mice per group), and 37.5 mg/kg of LPS was administered after 3 hours, and then serum samples were collected and stored at -70°C until use. .

4. Intraperitoneal Macrophage culture

TG-induced macrophages were collected after 4 days after intraperitoneal injection of 2.5 ml of TG. Intraperitoneal washing was performed using 8 ml of a rinse-balanced salt solution to which 10 U/ml of heparin was added. Cells were dispensed in RPMI medium containing 10% unassisted bovine serum and transferred to a ^{12-well tissue culture plate (1×10 6 cells per well).} After incubation for 3 hours, non-adherent cells were removed and adhered cells were treated with LPS, poly (I:C) or CpG-ODN in the presence or absence of piperine.

5. Nitrite concentration

Peritoneal macrophages (1×10 ⁶ cells per well) were treated with various concentrations of piperine for 30 minutes, and then stimulated with 500 ng/ml LPS for 24 hours. After the cultivation, 100 μl was removed from the conditioned media, and an equal amount of grease reagent (1% sulfanilamidey/0.1% N-(1-naphthyl)-ethylenediamine dihydrochloride/2.5% H ₃ PO ₄ ) was added and at room temperature for 10 minutes. After incubation, absorbance was measured at 540 nm. Nitrite was measured based on chlorinated nitrite. The value was measured in each experiment and calculated as a value obtained from the medium of peritoneal macrophage.

6. Western Blot

Peritoneal macrophages (1×10 ⁶ cells per well) were stimulated with 500 ng/ml of LPS. Nuclear extracts were extracted using a cytoplasmic and nuclear extract kit (promega, Madison, Wyoming). Total cell lysates were obtained by boiling peritoneal macrophages in a sample buffer (62.5 mM TrisHCl, pH 6.8, 2% sodium dodecyl sulfate (SDS), 20% glycerol and 10% 2-mercaptoethanol). Protein in the cell lysate was separated by 10% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was then incubated in 5% skim milk powder to which PBS-Tween-20 (PBST) was added at room temperature for 1 hour to stop the reaction, and then phosphorylated ERK1/2 and phosphorylated p38. It was incubated with antibodies against phosphorylated JNK, IRF-3 and Iκ-Bα. After washing three times with PBST, each blot was incubated with the secondary antibody for 1 hour, and the antibody-specific protein was prepared by using an accelerated chemiluminescent labeling system (Amercham, Piscataway, New Jersey) according to the manufacturer's instructions Visualized.

7. ELISA

Mouse peritoneal macrophages were stimulated with 500 ng/ml of LPS, 50 ug/ml poly(I:C) or CpG-ODN, and/or in the presence of various concentrations of piperine for 24 hours. The culture supernatant was collected and stored at -70°C until use. The cytokine level of the supernatant was investigated using a commercial system (R&D System, Minneapolis, Minnesota) according to the manufacturer's instructions. ELISA was designed in a 96-well plate coated with a monoclonal antibody specific for TNF-α and interleukin-6. The coated plate was washed with a phosphate buffer solution containing 0.05% Tween-20. All reagents used in this experiment were used after incubation at 37°C for 2 hours. Recombinant TNF-α, interleukin-1β, and interleukin-6 were diluted and used as standard solutions. The stepwise dilution started from 10 ng/ml and a standard curve was created. The test plates were sequentially biotinylated mouse TNF-α, interleukin-1β and interleukin-6 avidin peroxidase and ABTS (2,2'-azino-bis-[3-ethylbenzthiazoline-) containing 30% hydrogen peroxide water. 6-sulfonic acid) substrate solution.

8. RNA dose

For quantitative real-time RT-PCR, total RNA was obtained using the SV Total RNA Isolation System (Promega). The RNA isolation process included DNase I treatment. The present inventors quantified RNA and prepared cDNA using (dT)128 primer and SuperScript First-Strand Synthesis System (Invitrogen, Carlsvet, Calif.) for reverse transcriptase polymerization and 2 μg of total RNA per 20 μl reverse transcription reaction. I did. Reverse transcriptase polymerization was carried out in 25 μl of a solution, the solution containing 67.7 mM TrisHCl (pH 8.8); 16.6 mM (NH ₄ ) ₂ SO ₄ 0.01% Tween-20; dATP, dCTP, dGTP 200 nM and 400 nM dUTP, respectively; 4.5 mM MgCl ₂ ; 300 nM of each primer; 200 nM probe; It contains 2 U Taq DNA polymerase and proceeds in 1/10 volume of cDNA synthesis reaction. The reaction cycle consisted of a cycle of 4 minutes at 95°C, followed by 15 seconds at 95°C and 1 minute at 60°C, repeating 40 times. Fluorescence due to hydration of the probe caused by the 5'-exonuclease activity of DNA polymerase was measured using the ABI PRISM 770 Sequence Detection System (Applied Biosystems, Foster City, Calif.). Critical cycle values were calculated using sequence detection SDS 1.7 software (Applied Biosystems), and reporter signals were normalized. Each sample was amplified 2 times (Ct <32) or 3 times (Ct> 32) with a standard distribution of Ct that does not exceed 0.5 (Ct <33). The Ct value was converted to a quantitative value by a standard curve. Therefore, cDNA standard values were prepared under the same conditions in the experimental samples. This stepwise diluted the range of Ct values, including the amount of target mRNA expected in the experimental sample, and analyzed the gene of interest and intrinsic regulation. The Ct result was used to generate a linear function (y=mx+b) for the logarithm of the initial RNA amount. The experimental amount of RNA was calculated from the standard curve (correlation coefficient R2>0.990). The amount of mRNA was changed by n-fold in the transcription of the gene of interest, and was investigated by standardization of the amount of RNA corrected for wild-type expression before the intrinsic control and LPS stimulation. At the same time, the amplitude (dynamic range) of mRNA transcription was corrected for the basal mRNA expression of each genotype. In the case of IFN-α4, basal expression was not observed in the unstimulated sample. Therefore, the first time period for the transcriptional reaction in wild-type cells was applied to an arbitrary point of the corrector.

9. primer And Probe

Forward (f) and reverse (r) primers (invitrogen), TaqMan probe (MWG-Biotech AG, Ebersberg, Germany) and TaqMan minor groove binder (MGB) probe (Applied Biosystems) are available with Primer Express 1.5 software (Applied Biosystems). Real-time PCR was performed using the following primers: TTGCTCGAGATGTCATGAAGGA (mHPRT-f, SEQ ID NO: 2); TGAGAGATCATCTCCACCAATAACT (mHPRT-r, SEQ ID NO: 3); CCGAAGACCTTATGAAGCTCTTTG (mIRF-1-f, SEQ ID NO: 4); GCAAGTATCCCTTGCCATCG (mIRF-1-r, SEQ ID NO: 5); CTGGAGCCATGGGTATGCA (mIRF-7-f, SEQ ID NO: 6); AAGCACAAGCCGAGACTGCT (mIRF-7-r, SEQ ID NO: 7); CCTGTGTGATGCAGGAACC (mIFN-α4-f, SEQ ID NO: 8); TCACCTCCCAGGCACTGA (mIFN-α4-r, SEQ ID NO: 9); ATGAGTGGTGGTTGCAGGC (mIFN-β-f, SEQ ID NO: 10); TGACCTTTCAAATGCAGTAGATTCA (mIFN-β-r, SEQ ID NO: 11); TCTCTTCAAGGGACAAGGCTG (mTNF-α-f, SEQ ID NO: 12); And ATAGCAAATCGGCTGACGGT (mTNF-α-r, SEQ ID NO: 13). TaqMan probes consist of oligonucleotides labeled with the reporter dye 6-carboxyfluorescein (FAM) at the 5'end and the quencher dye 6-carboxytetramethylrhodamine (TAMRA) at the 3'end. In the TaqMan MGB probe format, a nonfluorescent quencher (NFQ) was introduced to enhance the spectral effect. The probe sequence was FAM-TGGGAGGCCATCACATTGTGGC-TA MRA (mHPRT, SEQ ID NO: 14); FAM-CAGTCTGAGTGGCAGCGGACACACA-TAMRA (mIRF-1, SEQ ID NO: 15); FAM-CTGGAGGGCGTGCAGCGTGA-TAMRA (mIRF-7, SEQ ID NO: 16); FAM-AGACTCCCTGCTGGCTGTGAGGACA-MGB-NFQ (mIFN-α4, SEQ ID NO: 17); FAM-AAGCATCAGAGGCGGACTCTGGGA-TAMRA (mIFN-β, SEQ ID NO: 18); And FAM-CCCGACTACGTGCTCCTCACCCA-TAMRA (mTNF-α, SEQ ID NO: 19).

10. Immunostaining

Peritoneal macrophage cells were dispensed into a chamber slite and incubated at 37° C. for 6 hours with 500 ng/ml LPS. The cells were fixed with 4% paraformaldehyde at 48° C. for 30 minutes, and then washed three times with a phosphate buffer solution. The cells were treated with 0.1% TritonX-100 for 15 minutes at room temperature. After washing, the cells were reacted with quiescent serum for 1 hour, and incubated overnight with IRF3 primary antibody diluted 1:100 (Zymed, 51-3200, invitrogen, Carlsbad, Calif. 92008, USA). The cells were washed and incubated for 4 hours in the dark with Alexafluor568 goat anti-rabbit IgG (invitrogen, USA) diluted 1:50. For nuclear staining, cells were incubated with DAPI diluted 1:1000 for 30 minutes. IRF antibody staining has red fluorescence, which can be observed with a fluorescence microscope.

11. Statistical Analysis

The above experiments are a summary of the results from at least three experiments and are expressed as mean ± SEM. Statistical deviation of the results was performed by Student's t-test, and the effective value was based on a p value of 0.05.

<Experimental Results>

One. LPS -Induction Endotoxin Effect of piperine on shock and inflammatory reactions

To investigate the effect of piperine on LPS-induced endotoxin shock, the present inventors compared their sensitivity to the DMSO control group and the piperine-treated group. LPS injection of 37.5 mg/kg was fatal to mice, and death generally appeared within 2 days (Fig. 1A). Piperine pretreatment (1 or 5 mg/kg body weight) before the introduction of LPS showed an improvement in survival rates of 60% and 80%, respectively (FIG. 1A). Pro-inflammatory cytokines such as TNF-α, interleukin-1β and interleukin-6 mediate the development of various inflammatory responses (Dinarello, CA. 2000. Proinflammatory cytokines. Chest . 118:503-8). LPS induces several species of cytokines including TNF-α, interleukin-1β and interleukin-6 (Dinarello, CA. 2000. Proinflammatory cytokines. Chest . 118:503-8). In order to verify the effect of piperine in the LPS-induced production of TNF-α, interleukin-1β and interleukin-6, the present inventors examined the effect of piperine in the production of the cytokines. Piperine (1 or 5 mg/kg body weight) was intraperitoneally injected into mice (6 mice per group), and serum samples were collected 3 hours after the injection of 37.5 mg/kg LPS. Consistent with the lethal curve, injection of LPS induced high levels of TNF-α, interleukin-1β, and interleukin-6 in serum. However, piperine pretreatment inhibited LPS-induced TNF-α production, but not for interleukin-1β and interleukin-6 (FIG. 1B). Dysregulation of macrophage activity during LPS reaction caused endotoxin shock in mice (Kinjyo, I., Hanada, T., Inagaki-Ohara, K., Mori, H., Aki, D., Ohishi, M., Yoshida , H., Kubo, M., and Yoshimura, A. 2002. SOCS1/JAB is a negative regulator of LPS-induced macrophage activation.Immunity . 17(5):583-591). For peritoneal macrophages, the present inventors investigated immune relays including TNF-α, interleukin-1β and interleukin-6. Cells were pretreated with 1, 5, or 10 μM piperine for 30 minutes and then stimulated with 500 ng/ml LPS for 24 hours. According to the results of in vivo experiments, piperine dose-dependently inhibited the production of TNF-α, but not for interleukin-1β and interleukin-6 (FIG. 1C). In terms of the kinetics of LPS-dependent TNF-α transcription, the present inventors performed real-time reverse transcriptase polymerization, and piperine expressed the LPS-inducible expression of TNF-α mRNA significantly for the indicated time period with the cytokine level. It was observed to be suppressed (Fig. 1D). LPS activates MyD88-dependent or MyD88-independent signaling mechanisms. Therefore, the present inventors investigated this inhibitory effect of piperine on TNF-α production using poly(I:C) (for MyD88-dependent response) and CpG-ODN (for MyD88-independent response). . Piperine also inhibited both poly(I:C) and CpG-ODN-induced TNF-α production, but not for interleukin-1β and interleukin-6 (FIGS. 2A and 2C ). Significantly with these levels, the level of TNF-α mRNA was also suppressed for the indicated time period (FIGS. 2B and 2D ).

2. In the abdominal cavity macrophages Effect of piperine on the LPS -inducible activity of ERK1 /2 and JNK1 /2

p38 MAPK, ERK1/2, JNK1/2 and transcription factor NF-κB signaling mechanisms are involved in pro-inflammatory cytokine production when macrophages are activated by LPS (Schorey, JS., and Cooper, AM. 2003. Macrophage signalling upon mycobacterial infection:. the MAP kinases lead the way Cell Microbiol . 5(3):133-142). Accordingly, the present inventors have since investigated the inhibitory effect of piperine on the production of TNF-α, which can be generated through inhibition of the signaling mechanism. When stimulated by LPS, poly(I:C), or CpG-ODN, p38 MAPK, ERK1/2 and JNK1/2 were strongly activated in peritoneal macrophages, and Iκ-Bα showed a decline (Figs. 3A and B. ). Piperine pretreatment of 10 μM inhibited phosphorylation of ERK1/2 and JNK1/2, but this was not the case in the case of p38 MAPK (Fig. 3A). However, piperine slightly inhibited the LPS-induced decline of Iκ-Bα (Fig. 3B). Moreover, blockade of ERK1/2 and JNK1/2 by pharmaceutical inhibitors prevented LPS-induced TNF-α production.

3. TNF -α Knockout Mouse LPS -Induction Endotoxin The effect of piperine on shock

TNF has a decisive effect on the toxicity of LPS in the body (Ito, H., Koide, N., Hassan, F., Islam, S., Tumurkhuu, G., Mori, I., Yoshida, T., Kakumu, S. ., Moriwaki, H., and Yokochi , T. 2006. Lethal endotoxic shock using alpha-galactosylceramide sensitization as a new experimental model of septic shock Lab Invest 86 (3):.. 254-61). 1 and 2, piperine partially inhibited LPS-induced endotoxin shock and TNF-α production in serum and peritoneal macrophages. To determine whether the inhibitory effect of piperine in the LPS-induced endotoxin shock is dependent on TNF-α, TNF-α knockout mice were used. The survival rate was increased when piperine (1 or 5 mg/kg body weight) was administered (FIG. 4).

4. Type 1 IFN peritoneal macrophages from LPS - effects of piperine in the inductive production

IFN type 1 is the primary effector of LPS-induced lethality (Karaghiosoff, M., Steinborn, R., Kovarik, P., Kriegsh, G., Baccarini, M., Donabauer, B., Reichart, U. , Kolbe, T., Bogdan, C., Leanderson, T., Levy, D., Decker, T., and M, M. 2003. Central role for type I interferons and Tyk2 in lipopolysaccharide-induced endotoxin shock. Nat Immunol . 4(5):471-477). Therefore, the present inventors investigated the effect of piperine on the mRNA expression of type 1 IFN and IRF through a real-time reverse electron polymerase reaction. Consistent with known results (Karaghiosoff, M., Steinborn, R., Kovarik, P., Kriegsh, G., Baccarini, M., Donabauer, B., Reichart, U., Kolbe, T., Bogdan, and C., Leanderson, T., Levy, D., Decker, T., and M, M. 2003. Central role for type I interferons and Tyk2 in lipopolysaccharide-induced endotoxin shock. Nat Immunol. 4(5):471- 477), IFN-α4 and IFN-β expression were reduced in LPS-stimulated macrophages. Piperine inhibited LPS-induced expression of IFN-α4 and IFN-β (Fig. 5A). Moreover, we also quantified the induction of mRNA expression of IRF upon piperine pretreatment. Piperine inhibited LPS-induced expression of IRF-1 and IRF-7 mRNA, and also inhibited phosphorylation of LRF-3 and nuclear translocation of IRF-3 (Figs. 5B, 5C and 5D). . In addition, the present inventors investigated the effect of piperine on poly(I:C) and CpG-ODN-induced production of type 1 IFN. The production of IFN type 1 and the production of IRF-1 and IRF-7 were inhibited by piperine (Figs. 6A and B).

As described above, the present invention provides a composition for preventing and treating inflammatory diseases, including piperine or a pharmaceutically acceptable salt thereof as an active ingredient, as a novel use of piperine. The composition containing piperine of the present invention effectively inhibits the inflammatory reaction caused by LPS, and thus can be effectively used for the prevention and treatment of inflammatory diseases.

<110> Korea Bio Medical Science Institute Co.,Ltd <120> Composition for preventing and treating inflammatory disease comprising piperine or pharmaceutically acceptable salt thereof as an active ingredient <130> NP08-0141 <160> 19 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CpG-ODN <400> 1 tccatgacgt tcctgaatgc t 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mHPRT-f <400> 2 ttgctcgaga tgtcatgaag ga 22 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mHPRT-r <400> 3 tgagagatca tctccaccaa taact 25 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> mIRF-1-f <400> 4 ccgaagacct tatgaagctc tttg 24 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mIRF-1-r <400> 5 gcaagtatcc cttgccatcg 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mIRF-7-f <400> 6 ctggagccat gggtatgca 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mIRF-7-r <400> 7 aagcacaagc cgagactgct 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mIFN-alpha4-f <400> 8 cctgtgtgat gcaggaacc 19 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> mIFN-alpha4-r <400> 9 tcacctccca ggcactga 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mIFN-beta-f <400> 10 atgagtggtg gttgcaggc 19 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mIFN-beta-r <400> 11 tgacctttca aatgcagtag attca 25 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mTNF-alpha-f <400> 12 tctcttcaag ggacaaggct g 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mTNF-alpha-r <400> 13 atagcaaatc ggctgacggt 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mHPRT <400> 14 tgggaggcca tcacattgtg gc 22 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mIRF-1 <400> 15 cagtctgagt ggcagcggac acaca 25 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mIRF-7 <400> 16 ctggagggcg tgcagcgtga 20 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mIFN-alpha4 <400> 17 agactccctg ctggctgtga ggaca 25 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> mIFN-beta <400> 18 aagcatcaga ggcggactct ggga 24 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mTNF-alpha <400> 19 cccgactacg tgctcctcac cca 23

Claims (3)

A pharmaceutical composition for preventing and treating inflammatory diseases comprising piperine represented by the following formula (I) or a pharmaceutically acceptable salt thereof as an active ingredient.

<Formula 1>

The method of claim 1, wherein the inflammatory disease is an inflammatory skin disease, Crohn's desease, inflammatory bowel disease such as ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, traumatic shock, bronchial asthma Sexual rhinitis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathies, ankylosing spondylitis, lighter syndrome, psoriatic arthrosis, enteropathic spondylitis, juvenile arthrosis, juvenile Ankylosing spondylitis, reactive arthritis, infectious arthritis, post-infectious arthritis, gonococcal arthritis, tuberculosis arthritis, viral arthritis, fungal arthritis, syphilis arthritis, Lyme disease, arthritis associated with 'angioarthritis syndrome', nodular polyarthritis, hypersensitivity Vasculitis, Leukemic Granulomatosis, Rheumatoid Multiple Muscle Pain, Joint Cell Arteritis, Calcium Crystalline Arthrosis , Pseudogout, non-articular rheumatoid, bursitis, hay salt, epicondylitis (tennis elbow), neuropathic joint (charco and joint), hemarthrosic, henoch-Scholine purpura, hypertrophic osteoarthritis, multiple psychotic Reticulocyte histiocytoma, surcoilosis, hemochromatosis, sickle cell disease and other hemoglobinopathies, hyperlipoproteinemia, hypomagglobulinemia, familial Mediterranean fever, Behart's disease, systemic lupus erythematosus, recursive fever, psoriasis, multiple sclerosis , Sepsis, septic shock, multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury and bronchial lung dysplasia (broncho-pulmonary dysplasia) composition, characterized in that selected from the group consisting of.
The method of claim 2, wherein the inflammatory skin disease is skin inflammation, acute chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simple thyroid, interrogation, deprived dermatitis, papular urticaria, psoriasis, psoriatic arthritis, daylight The composition, characterized in that selected from the group consisting of dermatitis, sunburn and acne.

Images