KR20140068731A - Compositon for anti-aging of cell comprising miR-186, miR-216b, miR-337-3p and miR-760 - Google Patents

Abstract

The present invention relates to a composition to prevent or treat cell senescence comprising nucleic acid inhibitors including miR-186, miR-216b, miR-337-3p and miR-760 as active ingredients. The miR-186, miR-216b, miR-337-3p and miR-760 inhibitors according to the present invention increase expression of CKIIα gene in cells, thereby reducing ROS production and reducing the expression of p53 and p21 to induce an excellent effect of preventing or treating cell senescence. Therefore, the present invention can be suitably used as an anti-aging therapy product.

Description

The present invention relates to a composition for preventing or treating cellular senescence comprising miR-186, miR-216b, miR-337-3p and miR-760 inhibitor as an active ingredient. 337-3p and miR-760}

The present invention relates to a composition for preventing or treating cellular senescence comprising miR-186, miR-216b, miR-337-3p and miR-760 inhibitor as an active ingredient.

Aging refers to all the physiological changes of the body that occur over time. It is a life phenomenon that occurs in a wide variety of ways depending on the individual. It causes many diseases such as cancer, cardiovascular insufficiency, obesity, and non-alcoholic fatty liver Not only is it associated with degeneration of cells, tissues and organs, but also with the debilitating of most physiological performance limits. It is difficult to study aging at the individual level, since aging varies in appearance and speed from individual to individual and varies from organization to organization. On the other hand, when the aging phenomenon is specifically examined, functional changes of the constituent organs and tissues occur, which is caused by a change in the function of the constituent cells. That is, whether the cognitive function is lowered due to loss of brain nerve cells, the skin elasticity is reduced due to the disappearance of subcutaneous adipocytes, or the hair is whitened by the loss of the melanin pigment production ability of the hair follicle melanin cells, Eventually, it is due to the aging of the cells that make up the individual.

On the other hand, protein kinase CKII (hereinafter referred to as CKII) is a universal serine / threonine kinase that catalyzes the phosphorylation of numerous cell substrates and nuclear proteins. CKII consisted of two active subunits (alpha and / or alpha) and two regulatory subunits beta and beta. The regulatory subunits β and β 'induce catalytic activity of α and α` subunits by inducing tetramer formation and thus substrate recognition. Overexpression of the CKII [alpha] subunit causes tumors to form in the over-expressing mouse Myc gene. In addition, it has recently been shown that CKII plays an important role in anti-apoptotic activities as well as cell growth and proliferation. In normal early cells, the cell division cycle is stopped after a limited number of divisions. The cells become irreversible cellular senescence. Cell senescence can be caused by oxidative stress and tumorigenic activity. Aging can be defined by molecules and phenotypes such as large flat cell morphology and aging-associated [beta] -galactosidase activity (SA-beta-gal). Human pulmonary CKII activity is downregulated in old human lung fibroblasts (IMR-90) and aged rat tissues and decreases in human fibroblast (IMR-90) and human colorectal cancer cells (HCT116) It is found that early aging is induced. The p53-p21Cip1 / WAF1-RB pathway is essential in aging induced by inhibition of CKII. The uptake of p53 by acetylation of the SIRT1 (silent information regulator 2; analog of Sir2) and the production of superoxide anion by the activity of NADPH oxidase inhibited the stabilization of p53 in senescent cells by inhibition of CKII It functions as an upstream activator. DNA methylation is involved in the silencing of CKII alpha and CKII alpha genes during cell senescence. However, the precise mechanism described above is not yet known.

Thus, the present inventors confirmed that miR-186, miR-216b, miR-337-3p and miR-760 inhibit the expression of CKII alpha in vivo and induce cell senescence, by confirming that by inhibiting miR-337-3p, and miR-760, by increasing the CKII α activity, inhibit the production of ROS, thereby inhibiting cellular senescence by reducing the expression of p53 and p21, thereby completing the present invention .

Accordingly, an object of the present invention is to provide a composition for preventing or treating cell senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

The present invention provides a composition for preventing or treating cellular senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

The miR-186, miR-216b, miR-337-3p and miR-760 inhibitors of the present invention inhibit the production of ROS by increasing the expression of the CKII alpha gene in combination with each other in the cells and suppress the expression of p53 and p21 Thereby preventing or treating cell senescence and thus being useful as a therapeutic agent for diseases related to cell senescence.

Figure 1 shows the sequences of miRNAs inducing senescence induction and their target sequence CKII < RTI ID = 0.0 >3'UTR< / RTI >
Figure 2 is a graph depicting protein expression levels of CKII alpha when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760 of the present invention.
Figure 3 is a graph showing the activity levels of CKII protein when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 4 shows SA-beta-gal activity levels when co-transfected into HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 5 shows protein expression levels of p53 and p21 when co-transfected with HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
Figure 6 is a graph showing levels of production of reactive oxygen species (ROS) when co-transfected into HCT116 cells together with miR-186, miR-216b, miR-337-3p and miR-760.
FIG. 7 is a graph showing the protein expression level of CKII a when HCT116 cells are treated with antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760.
Figure 8 shows the effect of co-transfection of miR-186, miR-216b, miR-337-3p and miR-760 co-transfected into HCT116 cells or of miR-186, miR- Figure 5 shows the results of luciferase assay when antisense inhibitors are treated.
Figure 9 shows that SA-β-gal activity (A), p53 and miR-186 were measured when HCT116 cells were transfected with CKIIα siRNA and antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR- (B) and active oxygen (ROS) production level (C) of p21.

The present invention provides a pharmaceutical composition for preventing or treating cell senescence comprising an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient.

Hereinafter, the present invention will be described in detail.

Inhibitors of nucleic acid molecules composed of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention increase the expression of CKII alpha gene, inhibit the production of ROS and inhibit the expression of p53 and p21 . Accordingly, the inhibitor of the nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention can be usefully used for preventing or treating cell senescence and cell senescence-related diseases.

The cell senescence-related diseases include but are not limited to Behcet's disease, arthritis rheumatism, collagen disease, Crohn's disease, ulcerative colitis, hepatitis, nephritis, diabetes, cataract, atopic dermatitis, spots, freckles, wrinkles and osteoporosis.

Inhibitors of nucleic acid molecules comprised of miR-186, miR-216b, miR-337-3p and miR-760 that can be used in the present invention are antisense to miR-186, miR-216b, miR-337-3p and miR- Sequence. Preferably, miR-186 of SEQ ID NO: 1, miR-216b of SEQ ID NO: 2, miR-337-3p of SEQ ID NO: 3, and miR-760 antisense sequence of SEQ ID NO: The antisense sequence of the present invention may have a nucleotide length of 18 to 100 nt, preferably 19 to 25 nt, more preferably 21, 22 or 23 nt in length.

In addition, the antisense sequence may be in the form of RNA, DNA, peptide nucleic acids (PNA), or locked nucleic acid (LNA).

The miR-186, miR-216b, miR-337-3p, and miR-760 inhibitors used in the present invention may also be used as functional equivalents of the nucleic acid molecules constituting them, for example miR-186, miR- MiR-216b, miR-337-3p and miR-760 (SEQ ID NO: 2), although some base sequences of the 337-3p and miR-760 nucleic acid molecules were modified by deletion, substitution or insertion, Is a concept that includes variants that can function in the same way as an inhibitor of a nucleic acid molecule.

The nucleic acid molecule of the present invention can be isolated or prepared using standard molecular biology techniques, such as chemical synthesis methods or recombinant methods, or commercially available. In addition, the composition of the present invention may contain not only the nucleic acid molecule itself, but also other substances capable of increasing the expression rate of the present invention in a cell, for example, a compound, a natural product, a novel protein and the like.

Meanwhile, inhibitors of miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules in the composition of the present invention can be provided in a vector for intracellular expression.

Inhibitors of the miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules of the present invention can be used in a variety of forms such as complexes of DNA and DEAE-dextran, complexes of DNA and nuclear proteins, complexes of DNA and lipids The miR-186, miR-216b, miR-337-3p, and miR-760 nucleic acid molecules may be introduced into cells using transformation techniques, . The carrier is preferably a vector, and both viral vectors and non-viral vectors are usable. As the viral vector, for example, lentivirus, retrovirus, adenovirus, herpes virus and avipox virus vector can be used, Preferably a lentiviral vector, but is not limited thereto. Lentiviruses are a type of retrovirus that is not only a mitotic cell but also a mitotic cell due to the nucleophilicity of a nucleopore or a pre-integrated complex (a virus "shell") that allows active incorporation into a complete nuclear membrane There is a feature that can be made.

It is also preferred that the vector comprising the inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules further comprises a selectable marker. The term "selection marker" in the present invention is intended to facilitate selection of transformed cells with the introduction of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules. The selection marker which can be used in the vector of the present invention is not particularly limited as long as it is a gene capable of easily detecting or measuring the introduction of a vector, but it is typically a gene having resistance to drug resistance, nutritional requirement, cytotoxic agent, Such as GFP (green fluorescent protein), puromycin, neomycin (Neo), hygromycin (Hyg), histidinol Histidinol dehydrogenase gene hisD) and guanine phosphosribosyltransferase (Gpt). Preferably, GFP (green fluorescent protein) and puromycin marker can be used.

Meanwhile, inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules in the composition of the present invention can be provided in a form introduced into a cell.

The term "introduction" in the present invention means introduction of foreign DNA into a cell by transfection or transduction. The transfection can be carried out in the presence or absence of a sugar such as calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposomal fusion, lipofectamine and protoplast fusion Can be carried out by various methods known in the art. Transfection also refers to the transfer of genes into cells using virus or viral vector particles as a means of infection.

Cells into which miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecule inhibitors were introduced by this method were identified as miR-186, miR-216b, miR-337-3p and miR- The inhibitor can be expressed at a high level, and transplantation into such aged cells can inhibit cell senescence. Therefore, the composition of the present invention comprising cells into which an inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules are introduced can be used as a cell therapy agent for a cell senescence-related disease.

Meanwhile, a composition comprising an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 of the present invention may further comprise a pharmaceutically acceptable carrier, Can be formulated. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not irritate the organism and does not interfere with the biological activity and properties of the administered compound. Examples of the pharmaceutical carrier which is acceptable for the composition to be formulated into a liquid solution include sterilized and sterile water, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

The composition of the present invention can be applied to any formulation containing an inhibitor of a nucleic acid molecule composed of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient, and can be manufactured into an oral or parenteral formulation can do. The pharmaceutical formulations of the present invention may be administered orally, rectally, nasal, topical (including under the ball and tongue), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous And intravenous), or forms suitable for administration by inhalation or insufflation.

Formulations for oral administration of the present invention may be formulated, for example, as tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. A binder such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin, an excipient such as dicalcium phosphate, a disintegrating agent such as corn starch or sweet potato starch, Calcium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax. In the case of a capsule formulation, in addition to the above-mentioned materials, a liquid carrier such as a fatty oil may be further contained.

The formulation for parenteral administration of the present invention may be formulated for use such as subcutaneous injection, intravenous injection or intramuscular injection, suppository injection system, or aerosol formulation for allowing inhalation through a respiratory apparatus. For formulation into injectable formulations, the compositions of the present invention may be formulated as solutions or suspensions in water with stabilizers or buffers in water, and formulated for unitary administration of ampoules or vials. For injection into suppositories, it may be formulated into rectal compositions such as suppositories or enema preservatives, including conventional suppository bases such as cocoa butter or other glycerides. When formulated for spraying, such as an aerosol formulation, a propellant or the like may be formulated with the additive such that the dispersed concentrate or wet powder is dispersed.

The invention also provides a method of preventing or treating cellular senescence comprising the step of administering to a mammal an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760.

As used herein, the term "administering" means introducing an inhibitor of the miRNA nucleic acid molecule of the invention into mammals in any suitable manner, and the expression of miR-186, miR-216b, miR-337-3p and miR- Inhibitors include delivery by viral or non-viral techniques or transplantation of cells expressing inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 nucleic acid molecules.

The method of treatment of the present invention comprises administering a therapeutically effective amount of the composition for preventing or treating cellular senescence of the present invention. It will be apparent to those skilled in the art that the appropriate total daily dose may be determined by the practitioner within the scope of sound medical judgment. The specific therapeutically effective amount for a particular patient will depend upon a variety of factors, including the type and extent of the response to be achieved, the specific composition, including whether or not other agents are used, the age, weight, general health status, sex and diet, The route of administration and the fraction of the composition, the duration of the treatment, the drugs used or co-used with the specific composition, and the like, well known in the medical arts. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned factors. In addition, the anticancer effect can be enhanced by administering a combination of the composition of the present invention and a known prophylactic or therapeutic agent for cell senesis.

The method of treating cancer of the present invention is applicable to any mammal afflicted with a cell senescence-related disease, and the mammal includes not only humans and primates but also livestock such as cows, pigs, sheep, horses, dogs and cats.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

[ Example  One] miR -186, miR -216b, miR -337-3p and miR -760 CKII Confirmation of α.

1. Materials and Preparation.

HCT116 human colon cancer cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% FBS (fetal bovine serum) at 5% CO ₂ at 37 ° C. miR-186, miR-216b, miR-337-3p and miR-760 mimic and control miRNA were purchased from Genolution Inc (Seoul, Korea) and used. Antisense inhibitors of the four miRNAs were purchased from Panagene Inc (Seoul, Korea). The structures of the antisense inhibitors used in the following experiments are shown in Table 1, and their antisense sequences are shown in SEQ ID NOS: 1 to 4.

Antisense  Structure of inhibitor miR -186 Antisense  Inhibitor RRRQRRKKRR - OO - CCAAAAGGAGAATTCTTT miR -216b Antisense  Inhibitor RRRQRRKKRR - OO - TTGCCTGCAGAGATT miR -337-3p Antisense  Inhibitor RRRQRRKKR - OO - GAAAGGCATCATATAGGA miR -760 Antisense  Inhibitor RRRQRRKKRR - OO - TCCCCACAGACCCAGAGCCG

(In Table 1, RRRQRRKKRR is a cell penetrating peptide and OO is an AEEA linker)

The miRNAs were transfected into HCT116 cells at a final concentration of 40 nM using lipofectamine RNAi max (Invitrogen, Carlsbad, Calif.). The transfected cells were analyzed by the conventional method FEBS Lett. P53 deacetylation by SIRT1 during protein kinase CKII downregulation-mediated cellular senescence). Forty-eight hours after transfection, cells were harvested.

2. HCT116  In human colon cancer cells Western Brotting  Used miR -186, miR -216b, miR -337-3p and miR By -760 CKII α suppression

At the protein level Western blotting was performed to confirm that the expression of CKII alpha was inhibited by miR-186, miR-216b, miR-337-3p and miR-760.

More specifically, the cells transfected in the dish were washed with cold PBS, scraped with a rubber policeman to collect the cells and washed with 100 μl of cold radioimmunoprecipitation assay (RIPA) buffer [50 mM Tris- Cells were cultured in HCl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.5 mM PMSF, 1 μg / ml aprotinin, 1 μg / ml leupeptin, 1 μg / ml pepstatin . The protein concentration of the supernatant was determined using a Bradford protein dye reagent (Bio-Rad, Hercules, Calif.). The supernatant was adjusted to an equivalent protein concentration and immunoblotting was performed by known methods. At this time, antibodies specific for CKIIα, CKIIβ, p53, p21Cip1 / WAF1 and β-actin purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.) Were used and anti-HA antibodies purchased from Roche (Basel, Switzerland) . The sequences of miRNAs inducing senescence induction and its target sequence, CKII? 3'UTR sequence are shown in FIG. 1 and miR-186, miR-216b, miR-337-3p and miR-760 mimics are all co- The level of protein expression of CKII a in one cell is shown in Fig.

As shown in Fig. 2, the expression levels of CKII [alpha] in cells co-transfected with miR-186, miR-216b, miR-337-3p and miR-760 mimics were reduced to 50% , And the expression level of the protein was substantially reduced compared with cells transfected with siRNA against CKII a positive control group.

The above result confirming that miR-186, miR-216b, miR-337-3p and miR-760 suppress the expression of CKII alpha, miR-186, miR-216b, miR-337-3p and miR-760 can induce cell senescence.

3. miR -186, miR -216b, miR -337-3p and miR -760 Imitative CKII  Measurement of protein inhibitory activity

To confirm the role of miR-186, miR-216b, miR-337-3p and miR-760 in cell senescence, [γ-32P] ATP and 1 mM of synthetic CKII peptide substrate (peptide sequence: RRREEETEEE) The phosphotransferase activity of the CKII protein was measured. The results are shown in Fig.

As shown in Fig. 3, the activity of CKII protein in the extracts of cells transfected with four miRNAs was found to be lowered to 40% as compared with that of the control without miRNA.

[ Example  2] HCT116  In human colon cancer cells miR -186, miR -216b, miR -337-3p and miR -760 Imitative  Aging Inducibility  Confirm

One. miR -186, miR -216b, miR -337-3p and miR -760 Imitative SA -β- gal  Verify Active

In order to confirm that miR-186, miR-216b, miR-337-3p and miR-760 mimic induce senescence in colon cancer cells, miR-186, miR-216b, miR-337-3p and miR- After 2 days of transfection, transfection, SA-β-gal activity was measured. The measurement method is described in FEBS Lett. 584 (2010) 3137-3142 (SM Jeon, SJ Lee, TK Kwon, et al., NADPH oxidase is involved in protein kinase CKII downregulation-mediated senescence through elevation of the levels of reactive oxygen species in human colon cancer cells) . The result of measurement of SA-beta-gal activity is shown in FIG.

As shown in Fig. 4, in the HCT116 cells co-transfected with the miR-186, miR-216b, miR-337-3p and miR-760 mimetics, SA-β-gal inhibited the miRNAs with non- transfected HCT116 The cells were stained significantly better than the cells. The above results indicate that the high activity of SA-β-gal can be used as an indicator of cell senescence, so that miR-186, miR-216b, miR-337-3p and miR-760 mimetics can inhibit cell senescence in colorectal cancer cells .

2. miR -186, miR -216b, miR -337-3p and miR -760 Imitative p53  And p21 ^{Cip1 / WAF1} Confirmation of expression enhancement effect

Western blotting was carried out in the same manner as in Example 2 to confirm that miR-186, miR-216b, miR-337-3p and miR-760 mimetics cause senescence in colon cancer cells. At this time, p53 and p21 ^{Cip1 / WAF1} , And Western blot results are shown in Fig.

As shown in Figure 5, p53 and p21 ^{Cip1 / WAF1} protein expression in co-transfected HCT116 cells with miR-186, miR-216b, miR-337-3p and miR-760 mimetics, Compared to the control group. The results show that miR-186, miR-216b, miR-337-3p and miR-760 mimetics cooperate to form CKII It is possible to inhibit the expression of the gene and increase the expression of p53 and p21 to cause cell senescence.

3 . miR- 186 , miR- 216b, miR- 337-3p, and miR- 760 mimetics Determination of ROS (active oxygen) production

 In cells with suppressed CKII and aged cells, ROS production is known to be an up-regulator of p53 stabilization. Thus, in order to determine whether miR-186, miR-216b, miR-337-3p and miR-760 mimics induce ROS production, HCT116 cells were cultured in CM-H2DCFDA or DHE to produce dichlorofluorescein diacetate (DCF) ROS production was confirmed by ETH fluorescent image. The results are shown in Fig.

As shown in FIG. 6, in HCT116 cells co-transfected with the miR-186, miR-216b, miR-337-3p and miR-760 mimetics or both miRNAs were treated with hydrogen peroxide and excess oxidation anion the level of superoxide anion was significantly increased compared to the control group in which the miRNA was not co-transformed or the miRNA-treated control group Respectively.

These results show that miR-186, miR-216b, miR-337-3p, and miR-760 mimics induce the production of ROS by inhibiting CKII.

[ Example  3] HCT116  In human colon cancer cells miR -186, miR -216b, miR -337-3p and miR -760 inhibitor to prevent cell senescence or to confirm the therapeutic effect.

One. HCT116  In human colon cancer cells Western Brotting  Used miR -186, miR -216b, miR-337-3p and miR - 760's Antisense  By inhibitor CKII alpha Expression level  Confirm increase

To confirm whether the miRNA inhibitor could inhibit cell senescence, the cells were treated with an antisense inhibitor of the miRNA of Table 1 to determine the protein expression level of CKII a . The results are shown in Figure 7

As shown in Fig. 7, when the antisense inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 was treated, the level of protein expression of CKII a was enhanced compared to the control cells.

2. Luciferase Assay  Used miR -186, miR -216b, miR -337-3p and miR - 760's Antisense  Inhibitors CKII α increased expression

The 3'UTR of human CKII alpha mRNA was inserted into the restriction enzyme cleavage site XhoI / NotI of the siCHECK-2 vector (Promega) to generate a CKII [alpha] 3'UTR reporter. The restriction enzyme cleavage site was Renilla [ It is located downstream of the luciferase gene. More specifically, PCR was performed using the primers shown in Table 2 below to amplify 3 ' UTR of CKII a, which was then transfected into siCHECK-2 vector (Promega). CKII α 3`UTR reporter transfected cells to 1 x 10 ⁵ miR-186, miR-216b, miR-337-3p , and miR-760 a co-transfected with, in the manufacturer's protocol And then placed on a 24-well plate using Lipofectamine 2000 (Invitrogen). In addition, antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 were treated and then half-lit and renilla luciferase activity were measured using luciferase assay (promega). The results are shown in Fig.

primer order SEQ ID NO: CKII α 3` UTR  Forward primer 5`-AATCTCGAGCGGCCCTATCTGTCTCCTGAT-3` SEQ ID NO: 5 CKII α 3` UTR  Reverse primer 5`-TCGCGGCCGCCACCAAAGAATTCCAACACTGGATC-3` SEQ ID NO: 6

As shown in Fig. 8, in HCT116 cells co-transfected with miR-186, miR-216b, miR-337-3p and miR-760, luciferase activity was 55 % And that the antisense inhibitor of miR-186, miR-216b, miR-337-3p and miR-760 was treated with a 220% increase in luciferase activity compared to the untreated group .

By by the result, miR-186, miR-216b , miR-337-3p , and miR-760 are targeted to the site of the CKII 3`UTR α specifically to decrease the stability of the CKII α mRNA, suppress its expression And the inhibitor of the miRNA increased the expression of CKII alpha, confirming that it has the effect of preventing or treating cell senescence.

3 . CK Ⅱ- in mediating aging induced model miR -186, miR -216b, miR -337-3p of -760 and miR mimics Antisense Confirmation of aging induction inhibition of RNA

miR-186, miR-216b, miR-337-3p and miR-760 inhibitors increase expression of CK II to prevent or treat aging , The siRNA of CKIIa was transfected into HCT116 cells and the method of Example 2 was performed by treating antisense inhibitors of miR-186, miR-216b, miR-337-3p and miR-760 mimics . The results are shown in Fig.

As shown in Fig. 9A, in the case of cells transfected with siRNA of CKII?, It was confirmed that the SA-ß-gal activity was significantly increased as compared with the siRNA cleaved control, and miR-186 , the miR-216b, miR-337-3p, and miR-760 mimetics, the SA-ß-gal activity was restored to its original level.

As shown in Fig. 9B, it was confirmed that expression of p53 and p21 ^{Cip1 / WAF1} was increased in cells transfected with siRNA of CKII? Compared with the siRNA cleaved control, and then miR-186 , miR-216b, miR-337-3p and miR-760 mimetics, the expression of p53 and p21 ^{Cip1 / WAF1} recovered to their original levels.

As shown in Fig. 9C, it was confirmed that the cells transfected with siRNA of CKII? Increased the production of ROS compared to the siRNA cleaved control, and then miR-186, miR-216b, When antisense inhibitors of miR-337-3p and miR-760 were treated, the production of ROS was restored to its original level.

These results indicate that the antisense excipients of miR-186, miR-216b, miR-337-3p and miR-760 mimetics can inhibit senescence-induced senescence by CK II.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Compositon for anti-aging of cells comprising miR-186, miR-216b,          miR-337-3p and miR-760 <130> P-1335 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-186 antisense sequence <400> 1 ccaaaaggag aattcttt 18 <210> 2 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> it is miR-216b antisense sequence <400> 2 ttgcctgcag agatt 15 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> it is miR-337-3p antisense sequence <400> 3 gaaaggcatc atatagga 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> it is miR-760 antisense sequence <400> 4 tccccacaga cccagagccg 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3 'UTR forward primer sequence <400> 5 aatctcgagc ggccctatct gtctcctgat 30 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> it is CK2 alpha 3 'UTR reverse primer sequence <400> 6 tcgcggccgc caccaaagaa ttccaacact ggatc 35

Claims (15)

A pharmaceutical composition for preventing or treating cellular senescence comprising an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 as an active ingredient. The pharmaceutical composition for preventing or treating cell senescence according to claim 1, wherein the miR-186 inhibitor is composed of the nucleotide sequence of SEQ ID NO: 1. The pharmaceutical composition for preventing or treating cell senescence according to claim 1, wherein the miR-216b inhibitor comprises the nucleotide sequence of SEQ ID NO: 2. The pharmaceutical composition for preventing or treating cell senescence according to claim 1, wherein the miR-337-3p inhibitor is composed of the nucleotide sequence of SEQ ID NO: 3. The pharmaceutical composition for preventing or treating cell senescence according to claim 1, wherein the miR-760 inhibitor is composed of the nucleotide sequence of SEQ ID NO: 4. 2. The method of claim 1, wherein the inhibitor of nucleic acid molecules consisting of miR-186, miR-216b, miR-337-3p and miR-760 increases expression of the protein kinase CKII alpha. A pharmaceutical composition for therapeutic use. The method of claim 1, wherein the inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 reduces the production of active oxygen. Composition. The method according to claim 1, wherein the inhibitor of the nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 reduces p53 and p21 expression. A pharmaceutical composition. A method of preventing or treating cellular senescence comprising administering a therapeutically effective amount of an inhibitor of a nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 to a mammal other than a human. 10. The method according to claim 9, wherein the inhibitor of miR-186 comprises the nucleotide sequence of SEQ ID NO: 1. 10. The method according to claim 9, wherein the inhibitor of miR-216b comprises the nucleotide sequence of SEQ ID NO: 2. 10. The method according to claim 9, wherein the inhibitor of miR-337-3p comprises the nucleotide sequence of SEQ ID NO: 3. 10. The method according to claim 9, wherein the inhibitor of miR-760 comprises the nucleotide sequence of SEQ ID NO: 4. 10. The method of claim 9, wherein the inhibitor of the nucleic acid molecule consisting of miR-186, miR-216b, miR-337-3p and miR-760 increases the expression of CKII alpha and reduces the production of active oxygen, Lt; RTI ID = 0.0 &gt; expression, &lt; / RTI &gt; 10. The method for preventing or treating cellular senescence according to claim 9, wherein the mammal is at least one selected from the group consisting of cattle, pigs, sheep, horses, dogs, and cats.

Images