KR20140144964A - Pharmaceutical composition comprising Thioredoxin-binding protein as an active ingradient and using thereof - Google Patents

Abstract

The present invention relates to a composition containing thioredoxin-binding protein (TXNIP) as an active ingredient for boosting immunity, inhibiting cancer metastasis, and preventing and treating blood diseases. More specifically, it was confirmed that the frequency of hematopoietic stem cells decreased and the bone marrow proliferative capacity declined in TXNIP-deficient mice, and that the proliferative capacity of TXNIP-deficient mouse-derived bone marrow cells declined through bone-marrow transplantation. Additionally, it was confirmed that the reactive oxygen species level increased and apoptosis was induced in TXNIP knockout mice and TXNIP-deficient cell strains under oxidative stress conditions, and that the bone marrow capability of the cell strains derived from the TXNIP knockout mice decreased. In addition, it was confirmed that cancer metastasis increased and the p53 expression decreased in the TXNIP knockout mice under oxidative stress conditions. Furthermore, direct binding sites between TXNIP and p53 were identified, and it was confirmed that the binding increased under oxidative stress conditions, thereby enhancing p53-mediated transcriptional activities and p53-mediated antioxidant activities. Therefore, a gene carrier, cells, or TXNIP protein, which contains the TXNIP gene of the present invention, can be useful as a composition for boosting immunity, inhibiting cancer metastasis, and preventing and treating blood diseases.

Description

A pharmaceutical composition comprising a thioredoxin-binding protein as an active ingredient and its use (Pharmaceutical composition comprising an active ingradient and a use thereof)

The present invention relates to a composition for preventing and treating immune enhancement, cancer metastasis, and blood diseases, which comprises thioredoxin-binding protein (TXNIP) as an active ingredient.

Oxidative stress is caused by excessive accumulation of reactive oxygen species (ROS) in cells or by a deficiency of the antioxidant defense system. Oxidative stress induces diverse pathologic diseases such as diabetes, degenerative brain disease, and cancer (Hole et al., 2011; Sinha et al., 2013), and the regulation of reactive oxygen species . Hematopoietic cells are vulnerable to oxidative stress and malignant hematopoietic tissue has been observed under chronic oxidative stress conditions (Ghaffari, 2008). In hematopoietic tissues, homeostasis regulation of the redox state is important for a normal hematopoietic process.

Hematopoietic stem cells (HSCs) are a repository of hematopoietic cell lineages that the host produces over a lifetime. The hematopoietic stem cell pool maintains their quiescence control and self-renewal in bone marrow (BM) (Abbas et al., 2010; Rathinam et al., 2011 l Scheller et al. al., 2008). The hematopoietic stem cells maintain a low intracellular level of active oxygen, and appropriate regulation of oxidative stress in hematopoietic stem cells is required to maintain hematopoietic stem cells (Blank et al., 2008; Naka et al., 2008). In recent years, several studies have shown that the function of hematopoietic stem cells is dependent on the induction of reactive oxygen species (Iso et al., 2004; Ito et al., 2006; Miyamoto et al., 2007).

Thioredoxin-interacting protein (TXNIP) is a 50 kDa protein composed of 397 amino acids and is contained in the arrestin family. Txnip ^{- / -} mice exhibit a high incidence of hepatocellular carcinoma (Jeong et al., 2009; Kwon et al., 2011; Lee et al., 2005; Song et al., 2003) Overexpression of TXNIP inhibits tumor growth by inhibiting cell-cycle progression (Han et al., 2003). In the bone marrow cells of Txnip ^{- / -} mice, the number of natural killer cells (NK cells) decreases, the long-term restored hematopoietic stem cell population exhibits an exhausted phenotype and the frequency decreases (Jeong et al., 2009; Lee et al., 2005).

P53, a tumor suppressor protein, plays a role in restricting the expansion of abnormal cells through growth arrest or apoptosis in response to genotoxic stress (Olovnikov et al. 2009; Sablina et al., 2005). The p53 pathway is regulated by MD2 (mouse double minute 2), which functions as a p53 target protein, E3 ubiquitin ligase, for proteosomal degradation (Sasaki et al., 2011). p53 acts on a strong pro-survival pathway by inducing anti-apoptotic or anti-oxidative gene expression (Bensaad and Vousden, 2007; Janicke et al., 2008). Previous studies have shown anti-aging effects of TXNIP in the maintenance of hematopoietic cell pools (Jeong et al., 2009; Kim et al., 2007).

Accordingly, the present inventors have studied a pharmaceutical composition showing the effect of immunity enhancement in hematopoietic cells by inhibiting the antioxidant stress. In the TXNIP deficient mice, the frequency of hematopoietic stem cells decreases, the bone marrow proliferation capacity decreases, The proliferative capacity of deficient mouse-derived bone marrow cells was decreased. In addition, it was confirmed that levels of reactive oxygen species were increased in TXNIP knockout mice and TXNIP deficient cell lines under oxidative stress conditions, inducing apoptosis, and the bone marrow proliferative capacity of the TXNIP knockout mouse derived cell line was decreased. Also, it was confirmed that cancer metastasis was increased in TXNIP knockout mice under oxidative stress conditions, and p53 expression was decreased. Also, a direct binding site between TXNIP and p53 was identified, confirming that the binding increased under oxidative stress conditions, leading to an increase in the p53-mediated transcriptional activity and an increase in p53-mediated antioxidant activity Thus completing the present invention.

It is an object of the present invention to provide a composition for preventing and treating immune enhancement, inhibition of cancer metastasis, and blood diseases comprising thioredoxin-binding protein (TXNIP) as an active ingredient.

In order to achieve the above object, the present invention provides a pharmaceutical composition for immune enhancement comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP (Thioredixin-interacting protein) gene.

The present invention also provides a health food for immunity enhancement comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP gene.

The present invention also provides a pharmaceutical composition for inhibiting cancer metastasis comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP gene.

In addition, the present invention provides a health food for inhibiting cancer metastasis which comprises a gene carrier, cell or TXNIP protein comprising XNIP gene as an active ingredient.

The present invention also provides a pharmaceutical composition for the prevention and treatment of blood diseases comprising a gene carrier, cell or TXNIP protein comprising TXNIP gene as an active ingredient.

In addition, the present invention provides a health food for prevention and improvement of blood diseases comprising a gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.

The TXNIP of the present invention regulates the bone marrow proliferative capacity of hematopoietic stem cells (HSC) under oxidative stress conditions, exhibits antioxidative activity in vivo, binds to p53 in hematopoietic cells and regulates active oxygen Thereby being useful as a composition for improving immunity, suppressing cancer metastasis, and preventing or treating blood diseases.

1A is a graph showing a decrease in the frequency of hematopoietic stem cells (HSC) in an old TXNIP knock-out mouse.
Young: Young mouse, and
Old: Old mouse.
1B is a diagram illustrating an experimental method of competitive repopulation assay and serial bone marrow transplantation assay (serial BMT assay).
Figure 1C shows a decrease in myeloproliferative capacity in TXNIP knockout mice.
WT-Y: wild-type mouse,
WT-O: wild old mouse,
KO-Y: TXNIP knockout young mouse, and
KO-O: TXNIP An old knockout mouse.
FIG. 1D shows that the ability of the whole bone marrow cells regenerated from the TXNIP knockout mouse is decreased.
WT: wild type,
KO: TXNIP knockout,
Young: Young mouse, and
Old: Old mouse.
FIG. 1E is a graph showing that the proliferative capacity of donor-derived bone marrow cells is decreased in a recipient body derived from a TXNIP knockout mouse.
WT: wild type,
KO: TXNIP knockout,
1st: After the first bone marrow transplantation, and
2nd: After the second bone marrow transplant.
Figure 1F is a graph showing that the population of hematopoietic stem cells and progenitor after bone marrow transplantation is reduced in TXNIP knockout mice.
WT: wild type, and
KO: TXNIP knockout.
FIG. 2A shows a significant increase in the level of active oxygen in TXNIP knockout mouse-derived bone marrow cells.
WT-Y: wild-type mouse,
WT-O: wild old mouse,
KO-Y: TXNIP knockout young mouse, and
KO-O: TXNIP An old knockout mouse.
FIG. 2B is a graph showing a high level of reactive oxygen species in a mouse transplanted with TXNIP knockout mouse-derived bone marrow cells. FIG.
WT: wild type, and
KO: TXNIP knockout.
2C is a graph showing that the levels of reactive oxygen species in the bone marrow cells derived from TXNIP knockout mice are high under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
Figure 2D is an illustration of increased apoptosis of TXNIP knockout mouse derived bone marrow cells under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
FIG. 3A shows experimental methods of competitive myelogenous proliferation, colony forming unit-spleen (CFU-S) and radioprotection assay.
FIGS. 3B and 3C show that the bone marrow proliferation and hematopoietic stem cell frequency of TXNIP knockout mouse derived bone marrow cells are decreased under oxidative stress conditions. FIG.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
Figure 3D shows the decrease in colony forming unit-spleen count of bone marrow cells derived from TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: The group treated with paraquat.
Figure 3E is a graph showing the low survival rate of TXNIP knockout mouse-derived bone marrow cells under oxidative stress conditions.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
FIGS. 3F and 3G show that the LKS cell line derived from TXNIP knockout mice under oxidative stress conditions is reduced in bone marrow proliferation and hematopoietic stem cell count in recipient mice.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
Figure 4A is a graph showing that the survival rate of TXNIP knockout mice is decreased under oxidative stress conditions.
WT-PA: wild-type mouse treated with paraquat,
KO-PA: a group treated with paraquat in a TXNIP knockout mouse, and
KO-PA + NAC: TXNIP knockout mouse treated with paraquat and antioxidant.
FIG. 4B is a graph showing that the survival rate of mice transplanted with TXNIP knockout mice under oxidative stress conditions is decreased. FIG.
CD45.1 (WT): Wild type CD45.1 mouse that received wild type bone marrow, and
CD45.1 (KO): Wild type CD45.1 mice that received TXNIP knockout marrow.
4C is a graph showing the decrease in spleen size and cytoplasm of TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: The group treated with paraquat.
Figure 4D is an illustration of increased cell death in TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse,
PBS: PBS-treated group, and
PA: The group treated with paraquat.
4E is a graph showing that damage to the thymus occurs in TXNIP knockout mice under oxidative stress conditions.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
4F is an illustration of increased cancer metastasis in TXNIP knockout mice under oxidative stress conditions.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
FIG. 4G is a graph showing that lung metastasis is increased in mice that received whole bone marrow cells derived from TXNIP knockout mice.
WT-PBS: wild-type control mice,
WT-PA: wild-type mouse treated with paraquat,
KO-PBS: TXNIP knockout control mice, and
KO-PA: TXNIP knockout mice treated with paraquats.
Figures 5A and 5B are graphs showing that the levels of reactive oxygen and TXNIP in bone marrow cells are inverse correlation.
FIG. 5C is a graph showing the decrease in p53 expression in TXNIP knockout bone marrow cells.
WT: wild type, and
KO: TXNIP knockout.
FIG. 5D is a graph showing that the level of reactive oxygen increases in TXNIP knockout bone marrow cells. FIG.
WT: wild type, and
KO: TXNIP knockout.
5E is a graph showing a high level of reactive oxygen species in p53 ^{- / -} hematopoietic stem cells and progenitor cells.
WT: wild type,
Txnip ^{- / -} : TXNIP deficiency,
p53 ^{- / -} : p53 deficiency.
FIGS. 5F and 5G are graphs showing the increase in levels of reactive oxygen species in TXNIP ^{- / -} hematopoietic stem cells and progenitor cells when p53 is inhibited.
Control: Control,
Txnip shRNA: wild-type or TXNIP knockout LKS cells treated with shRNA for Txnip,
p53 shRNA: wild-type or TXNIP knockout LKS cells treated with shRNA for p53,
WT: wild type mouse,
WT / PFT-α: group treated with p53 inhibitor in wild type,
KO: TXNIP knockout mouse, and
KO / PFT-α: TXNIP knockout mice treated with p53 inhibitor.
5H is an elevation of active oxygen levels of hematopoietic stem cells and immune cells of p53 ^{- / -} mice under oxidative stress conditions.
WT: wild type, and
p53 ^{- / -} : p53 deficiency.
Figure 5I is a graph showing that the survival rate of p53 ^{- / -} mice decreases under oxidative stress conditions.
WT: wild type, and
p53 ^{- / -} : p53 deficiency.
Figure 5J is a graph showing that the survival rate of mice is reduced when p53 inhibitor is treated with TXNIP knockout mice under oxidative stress conditions.
WT: wild type,
KO: TXNIP knockout mouse, and
KO / PFT-α: TXNIP knockout mice treated with p53 inhibitor.
6A is a view showing the position of TXNIP binding to p53.
FIG. 6B shows the domain of p53 binding to TXNIP.
Figure 6C is an illustration showing increased binding between TXNIP and p53 under oxidative stress conditions.
Figure 6D shows that the C247S and C267S mutations of TXNIP do not bind to p53 and therefore are not in the same position.
Figure 6E is a graph showing that the binding between p53 and MDM2 is reduced by TXNIP.
Vector: Control,
TXNIP (WT): wild type TXNIP, and
TXNIP (DW): Double mutation of TXNIP.
Figure 6F is an illustration of increased intracellular p53-mediated transcription activity by binding between TXNIP and p53.
7A and 7B are diagrams showing the expression of p53 and its target protein in hematopoietic cells.
FIG. 7C is a graph showing the decrease in the expression of p53 target protein in the TXNIP deficient cell line.
WT: wild type, and
KO: TXNIP knockout.
FIG. 7D is a graph showing an increase in the expression of the oxidation promoting gene mRNA in the TXNIP deficient cell line. FIG.
WT: wild type, and
KO: TXNIP knockout.
7E is a graph showing the activity of p53 in a TXNIP deficient cell line under oxidative stress conditions.
WT: wild type, and
KO: TXNIP knockout.
FIG. 7F shows that the frequency of hematopoietic stem cells is restored in a mouse transplanted with wild-type TXNIP or p53 transfected bone marrow cells.
WT (Fresh): wild-type bone marrow cells,
WT (Vector): group transfected with wild-type bone marrow cells alone,
KO (Fresh): TXNIP deficient bone marrow cells,
KO (Vector): a vector transfected with TXNIP deficient bone marrow cells,
KO (p53): p53 transfected into TXNIP deficient bone marrow cells,
KO (TXNIP): TXNIP deficient bone marrow cells were transfected with wild type TXNIP, and
KO (DM): TXNIP deficient bone marrow cells were transfected with double mutant TXNIP.
FIG. 7G is a graph showing an increase in the survival rate of wild-type TXNIP or p53 transfected bone marrow transplanted mice.
WT / Vector: wild-type bone marrow cells were transfected with vector only,
KO / Vector: TXNIP deficient bone marrow cells were transfected with vector only,
KO / Txnip (WT): wild-type TXNIP transfected into TXNIP deficient myeloid cells,
KO / Txnip (DM): TXNIP deficient bone marrow cells were transfected with double mutant TXNIP, and
KO / p53: p53 transfected into TXNIP deficient bone marrow cells.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for immune enhancement comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP (Thioredixin-interacting protein) gene.

The TXNIP gene preferably has a nucleotide sequence consisting of SEQ ID NOS: 29 and 30, but is not limited thereto.

The gene carrier is preferably a vector or a recombinant virus, but is not limited thereto. Preferably, the vector is a linear DNA, a plasmid DNA or a recombinant viral vector. The recombinant virus may be a retrovirus, an adenovirus, And simplex virus. However, the present invention is not limited thereto.

The cells are most preferably hematopoietic stem cells (HSC), but are not limited thereto.

The immune enhancement is preferably due to the homeostasis of the immune system, but is not limited thereto, and is preferably, but not always, due to the homeostasis of hematopoietic stem cells. In addition, the immune enhancement is preferably, but not limited to, antioxidant activity by the interaction between TXNIP and p53.

In a specific embodiment of the present invention, the present inventors have found that the frequency of hematopoietic stem cells decreases in TXNIP knockout mice (see FIG. IA), and the overall bone marrow cell myeloproliferative capacity decreases (see FIG. 1C) The number of whole bone marrow cells and hematopoietic stem cells also decreased in mice that received bone marrow transplantation from the mice (see FIG. 1D). The results also showed the same results after two bone marrow transplantations (see FIGS. 1E and 1F). In addition, it was confirmed that the level of reactive oxygen increases in TXNIP knockout mouse-derived bone marrow cells (see FIGS. 2A to 2C), which induces apoptosis (see FIG. 2D). In addition, under oxidative stress conditions, the bone marrow proliferative capacity of TXNIP knockout mice decreases (see Figures 3B and 3C) and the number of colony forming unit-spleen (CFU-S) (See Figure 3D), confirming that these mice exhibited low survival rates (see Figure 3E). In addition, the myeloproliferative capacity of hematopoietic stem cells isolated from TXNIP knockout mice decreases (see Figures 3F and 3G) and the survival rate of the TXNIP knockout mice decreases under oxidative stress conditions (see Figure 4A), under oxidative stress conditions The survival rate of recipients transplanted with TXNIP knockout mouse-derived bone marrow cells was also decreased (see FIG. 4B). Under oxidative stress conditions, the spleen size and cytoplasm of the TXNIP knockout mouse decreased (see FIG. 4C) and the thymus was damaged (see FIG. 4E), and cell death was increased in the mice (FIG. 4D) (See Figures 4F and 4G). In addition, it was confirmed that there is an inverse correlation between levels of active oxygen and TXNIP expression in bone marrow cells and levels of p53 expression and active oxygen in TXNIP knockout bone marrow cells (see FIGS. 5A to 5D). In addition, when the level of reactive oxygen species is high in p53 ^{- / -} hematopoietic stem cells (see FIG. 5E) and inhibits p53, the level of reactive oxygen species increases in TXNIP ^{- / -} hematopoietic stem cells (see FIGS. 5F and 5G) It was confirmed that the level of reactive oxygen increases in p53 ^{- / -} hematopoietic stem cells under stress conditions (see FIG. 5H). Also, it was found that the survival rate of mice treated with p53 ^{- / -} and p53 inhibitors decreased under oxidative stress conditions (see Figures 5I and 5J). 6A and 6B), and the interaction of TXNIP and p53 is increased under oxidative stress conditions (see FIG. 6C), and in the TXNIP site interacting with p53 It was confirmed that the double mutant TXNIP that caused the mutation was not located at the same position as p53 in the cells (see FIG. 6D). In addition, it was confirmed that the interaction between p53 and MDM2 (mouse double minute 2) was reduced by TXNIP (see FIG. 6E), and the p53-mediated transcription activity was increased by the interaction of TXNIP and p53 ). In addition, the expression of p53 and its target protein in hematopoietic cells was confirmed (see FIGS. 7A and 7B), and when TXNIP was deficient, the expression of p53 target protein decreased (see FIG. 7C), and the TXNIP- The expression of the gene was increased (see Fig. 7D). In addition, when the expression of TXNIP is changed, the activity of p53 is changed (see FIG. 7E). When the wild type p53 or TXNIP is transfected into TXNIP deficient bone marrow cells or mice, the frequency of hematopoietic stem cells is restored, (See Figs. 7F and 7G).

Therefore, the present inventors confirmed that TXNIP exhibits antioxidative activity through interaction with p53 in vivo.

The gene carrier, cell or TXNIP protein-containing composition containing the TXNIP gene of the present invention may further contain one or more active ingredients showing the same or similar functions in addition to the above components.

The composition of the present invention may further comprise a pharmaceutically acceptable additive, wherein pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose Starch glycolate, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, calcium stearate, , White sugar, dextrose, sorbitol and talc. The pharmaceutically acceptable additives according to the present invention are preferably included in the composition in an amount of 0.1 to 90 parts by weight, but are not limited thereto.

That is, the composition of the present invention can be administered in various formulations of oral and parenteral administration at the time of actual clinical administration. In the case of formulation, a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, . ≪ / RTI > Solid formulations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations may be, for at least one or more excipients, for example, the gene delivery system, cells or TXNIP protein comprising TXNIP gene, starch, calcium Calcium carbonate, sucrose, lactose, gelatin, or the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions and syrups, and various excipients such as wetting agents, sweetening agents, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used . Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The composition of the present invention may be administered orally or parenterally in accordance with the intended method, and may be administered orally, parenterally or intraperitoneally, rectally, subcutaneously, intravenously, intramuscularly, . The dosage varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease.

The dosage unit may contain, for example, 1, 2, 3 or 4 times the individual dose or may contain 1/2, 1/3 or 1/4 times the dose. The individual dosages specifically include amounts in which the active drug is administered in a single dose, which usually corresponds to the full, half, one-third, or one-fourth of the daily dose. The effective dose of the composition of the present invention may be 0.0001 to 10 g / kg, specifically 0.001 to 1 g / kg, and may be administered 1 to 6 times a day. However, the dosage may not be limited in any way because it may be increased or decreased depending on route of administration, severity of disease, sex, weight, age, and the like.

The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

The present invention provides an immunomodulating health food containing as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP gene.

The health food of the present invention can be used as it is with the gene carrier, cell or TXNIP protein containing the TXNIP gene as it is or with other food or food ingredients, and can be suitably used according to conventional methods.

There is no particular limitation on the kind of the health food. Examples of the food to which the TXNIP gene-containing gene carrier, cell or TXNIP protein can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, Products, various soups, drinks, tea, drinks, alcoholic beverages, and vitamin complexes, and includes health foods in a conventional sense.

The health beverage composition of the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. Such natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 of the composition of the present invention.

In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acids and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, , A carbonating agent used in carbonated drinks, and the like. It may also contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not critical, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising, as an active ingredient, a gene carrier, cell or TXNIP protein comprising a TXNIP gene.

The present invention provides a health food for inhibiting cancer metastasis comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising an XNIP gene.

The cancer may be selected from the group consisting of breast cancer, liver cancer, stomach cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectum cancer, esophageal cancer, small bowel cancer, anorectal cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, The cancer is preferably selected from the group consisting of carcinoma, vulvar carcinoma, Hodgkin's disease, prostate cancer, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma and central nervous system tumor. According to a preferred embodiment of the present invention, , But is not limited thereto.

The present invention provides a pharmaceutical composition for preventing and treating blood diseases, which comprises a gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.

The present invention provides a health food for prevention and improvement of blood diseases containing a gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.

Preferably, the blood disease is any one selected from the group consisting of anemia, plethora, leukemia, myelodysplasia, myelofibrosis and thrombocytopenia.

In addition, the expression level of TXNIP mRNA or protein of the present invention can be used to diagnose immune enhancement, cancer metastasis inhibition, and blood disease, and also can be used for immunologic enhancement, cancer metastasis for screening candidate drugs that regulate these expression levels Inhibition, and screening of candidate drugs for blood diseases.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples and production examples.

< Example  1> TXNIP  Deficiency is hematopoietic stem cell ( hematopoietic stem cell ; HSC ),

<1-1> Preparation of experimental animals

TXNIP knockout (KO) mice were prepared according to known methods (Lee et al., 2005) and were used in congenic CD45.1 ⁺ C57BL / 6 mice and p53 ^{- / -} mice (B6.129S2-Trp53 ^tm1Tyj / J) was purchased from the Jackson Laboratory (Jackson Laboratory, USA). All mice were housed at a sterile animal facility where light-dark was repeated at 12-hour intervals, and 8 to 12 weeks of young mice and 22 to 23 months of old mice were used in the experiment. 50 or 80 mg / kg of paraquat and N-acetyl-cysteine (NAC) in p53 ^{- / -} , Txnip ^{- / -} (KO) and wild type Sigma-Aldrich, USA) or 5 mg / kg of PFT-alpha (Sigma, USA). All experiments were carried out in accordance with the guidelines for the management and use of laboratory animals by the Institute for Laboratory Animal Research.

<1-2> TXNIP  Frequency of Hematopoietic Stem Cells Due to Deficiency frequency ) Reduction effect confirmation

To investigate the effect of TXNIP deficiency on hematopoietic activity, we used hematopoietic stem cells from Txnip ^{+ / +} (WT) and Txnip ^{- / -} (KO) mice at 12 months of age (22 to 23 months) Frequency was analyzed.

Specifically, in order to analyze the hematopoietic stem cells, the femur, tibia and sciatica were separated from the femur, and bone marrow cells were separated from the bone using a mortar bowl, suspended in RPMI1640 medium, centrifuged to remove the medium, Cells were suspended in PBS buffer containing FBS and centrifuged to remove the supernatant. After resuspension with PBS buffer containing 2% FBS, the number of cells was determined and 10 ⁷ cells were added. Lineage ⁺ (Lineage ⁺⁾ with biotin (biotin) attached to stain the cells Mac-1, Gr-1, Ter119, NK1.1, into the CD2 and B220, c-Kit (PE- Cy7), Sca-1 (PE), CD150 (PE-Cy5), CD48 (APC-Cy7), CD34 (FITC) and CD135 (APC) were added thereto and reacted at 4 ° C for 25 minutes. Cells were washed and stained with BD Horizon V450 with streptavidin for 25 min at 4 ° C to stain Lineage ⁺ cells. The stained cells were analyzed using FACSanto II (BD Biosciences).

As a result, it was confirmed that the HSC frequency was significantly higher in old wild-type mice as shown in FIG. 1A, while the HSC frequency was relatively decreased in young knockout mice (FIG. 1A).

< Example  2> TXNIP  Competitive myeloproliferative capacity due to deficiency ( competitive repopulation  capacity reduction effect

<2-1> Bone marrow ( bone marrow ; BM ) Preparation of cells

Whole bone marrow cells were obtained by grinding tissue of femurs, tibias, hipbones and shoulder bones of mice cultured in RPMI-1640 medium (WelGENE, Korea) containing 2% FBS , And red blood cells (RBC) were dissolved or not dissolved using ACK buffer [0.15 M NH ₄ Cl, 1.0 mM KHCO ₃ , 0.1 mM EDTA (pH 7.0)]. Further, the cells were filtered using a filter. The bone marrow cells were stained by a method well known to those skilled in the art (Jeong et al., 2009), analyzed using FACSCanto II, and Lineage ^- c-Kit ⁺ Sca ⁺ (LKS) cells were stained with FACSAria cell sorter Respectively. Lineage ^- c - kit ⁺ (LK) cells were prepared by MACS purification method.

<2-2> TXNIP  Decreased competitive bone marrow proliferative capacity by deficiency

Bone marrow transplantation (BMT) was performed to confirm the bone marrow proliferation using the cell line prepared by the method of Example <2-1>.

Specifically, whole bone marrow (WBM) 2.0 x 10 &lt; ⁶ &gt; obtained from a young or old wild-type or TXNIP knockout mouse (CD45.2 ⁺ ) or its analogous genotype (CD45.1 ⁺ ) or LSK cells 5.0 x 10 ³ were mixed to prepare a mixture and the mixture was injected intravenously into a radioactively irradiated (9 Gy) wild-type, quasi-genotype (CD45.1 ⁺ ) recipient. Donor-derived cell marrow proliferation was observed via PB staining of tail vein and bone marrow cells using antibodies against surface markers. Non-competitive for the transplantation, it was injected intravenously in wild-type or whole bone marrow cells of a mouse knockout TXNIP a 2.5 x 10 ⁶ irradiated radiation (9 Gy) of the wild-type genotype similar (CD45.1 ⁺⁾ granted (recipient) mice, 8 Analysis was performed after a week. PB staining was performed by collecting blood from the tail vein and treating the ACK solution (0.15 M NH ₄ Cl, 1.0 mM KHCO ₃ , 0.1 mM MEDTA, pH 7.4) to remove the red blood cells and incubated with CD45.1 (FITC) and CD45.2 (APC) antibody, the cells were suspended in PBS buffer containing 2% FBS, stained at 4 ° C for 20 minutes, washed with PBS buffer solution containing 2% FBS, suspended again, analyzed with a flow cytometer Respectively.

As a result, as shown in FIG. 1C, the bone marrow proliferative capacity of LKS and whole bone marrow cells of old wild-type mice was slightly changed, whereas the bone marrow proliferative capacity of LKS and whole bone marrow cells of old TXNIP knockout mice was significantly decreased (Fig. 1C). In addition, as shown in Fig. 1D, it was confirmed that the whole bone marrow cells of the recipient body obtained from young or old TXNIP knockout mice were significantly reduced in the frequency of hematopoietic stem cells and the progenitor from wild-type mice (Fig. 1D ).

<2-3> TXNIP  Decreased donor-derived bone marrow cells by deficiency

The BMT assay (serial BMT assay) was performed to confirm the proliferative capacity of the donor-derived bone marrow cells by repeating the bone marrow transplantation performed in Example <2-2> twice.

Specifically, to give mixture of bone marrow cells (1.0 x 10 ⁶⁾ separated from the bone marrow cells (2.0 x 10 ⁶⁾ and can booty (CD45.1) isolated from the donor (CD45.2) well irradiated with the radiation (9 Gy) After 16 weeks, the bone marrow cells (2.0 x 10 ⁶ ) containing the donor and recipient cells were isolated and then irradiated (9 Gy) to the tail vein of the recipient (CD45.1) After administration to the tail vein of the female body (CD45.1), PB and bone marrow cells were analyzed in the recipient after 16 weeks.

As a result, as shown in Figs. 1E and 1F, the proliferative capacity of the donor-derived bone marrow cells was markedly decreased in the recipient body derived from the TXNIP knockout mice (Fig. 1E), and the hematopoietic stem cells or progenitor cells present in the bone marrow , And significantly decreased in the recipient body derived from TXNIP knockout mouse (Fig. 1F).

< Example  3> Oxidative  Under stress conditions TXNIP of Hematopoietic  Check the effect of active oxygen control

<3-1> TXNIP  Identification of increased levels of free radicals in bone marrow cells derived from knockout mice

After bone marrow transplantation, the levels of active oxygen in the cells were measured to determine if depletion of early hematopoietic stem cells was due to accumulation of free radicals.

Specifically, flow cytometry was used to measure the amount of intracellular reactive oxygen species in cells from young or old wild-type or TXNIP mice, where ROS-specific fluorescent probes ) DCF (C6827) and DHE (D11347) (Invitrogen, USA) were used. As soon as the cells to be used for the experiment were separated, a solution prepared so as to have a final concentration of 5 μM DFC or 2.5 μM DHE in PBS containing 2% FBS was added and reacted in a 37 ° C. incubator for 15 minutes. In order to analyze the hematopoietic stem cells before the reactive oxygen-specific fluorescence probe reaction, the femur, tibia and sciatica of the rats were separated, the bone marrow cells were separated from the bone using a mortar bowl, suspended in RPMI1640 medium, The medium was removed, and the cells were suspended in PBS buffer containing 2% FBS. After centrifugation, the supernatant was removed. Once again, the cells were suspended in PBS buffer containing 2% FBS, and the number of cells was determined, and 10 ⁷ cells were dispensed. Hematopoietic stem cells were stained with the above method, and a solution prepared so as to have a final concentration of 5 [mu] M DFC or 2.5 [mu] M DHE in PBS containing 2% FBS was added and incubated at 37 [deg.] C for 15 minutes. Lt; / RTI &gt; and the cell was analyzed using a flow cytometer.

As a result, as shown in Fig. 2A, it was confirmed that the bone marrow cells derived from old TXNIP knockout mouse significantly increased the levels of active oxygen compared with the wild type control (Fig. 2A).

<3-2> TXNIP  Increased levels of active oxygen in knockout mouse-derived bone marrow transplant mice

TXNIP knockout mice after total bone marrow cells (CD45.2 ⁺⁾ similar to the genotype of wild irradiating radiation to the implant (CD45.1 ^+), and can booty 9 months to determine the effect of the increase of free radicals in maintaining the bone marrow-derived cells , And the level of active oxygen in the cells was measured using the method of Example <2-1> above.

As a result, as shown in FIG. 2B, it was confirmed that the levels of active oxygen in the TXNIP knockout-derived bone marrow cells were remarkably high (FIG. 2B). This is because the TXNIP of the present invention functions as a pro-oxidant which inhibits thioredoxin (Lee et al., 2005; Patwari et al., 2006; Schulze et al., 2002) Which protects hematopoietic cells from free radicals by other mechanisms.

< Example  4> In hematopoietic cells TXNIP Antioxidant activity

<4-1> Oxidative  Under stress conditions TXNIP Of Inhibiting the Increase of Active Oxygen

To determine the antioxidant function of TXNIP in hematopoietic cells under oxidative stress, levels of reactive oxygen species in young mice were measured.

Specifically, paraquat, which is a strong oxidative stress inducer, was injected into the abdominal cavity of a young mouse, and the level of active oxygen in the cell was measured by the method of Example <2-1> above.

As a result, it was confirmed that levels of reactive oxygen species were significantly higher in bone marrow cells derived from TXNIP knockout mouse as shown in FIG. 2C (FIG. 2C).

<4-2> Oxidative  Under stress conditions TXNIP Cell death due to deficiency of apoptosis ) Confirmation of induction effect

TXNIP deficiency was found to increase reactive oxygen species by oxidative stress and induce apoptotic cell death.

Specifically, bone marrow cells were isolated from mice after injecting paraquat (40 mg / kg), which is a strong oxidative stress inducer, into the abdominal cavity of young mice, staining hematopoietic stem cells, After 5 μl of Annexin V (BD Bioscience) was added to the cells suspended in the solution, the reaction was allowed to proceed at room temperature (25 ° C) for 15 minutes, and the cells were analyzed using a flow cytometer.

As a result, as shown in FIG. 2D, cell death was significantly increased in bone marrow cells derived from TXNIP knockout mouse (FIG. 2D), indicating that TXNIP knockout hematopoietic stem cells were more sensitive to active oxygen.

< Example  5> TXNIP end Oxidative  Controlling myeloproliferative capacity of hematopoietic stem cells under stress conditions

<5-1> Oxidative  Under stress conditions TXNIP  Decreased myeloproliferative capacity of knockout mouse

To confirm the effect of oxidative stress on the myeloproliferative capacity of hematopoietic stem cells, a competitive repopulation assay was performed by the method of Example <2-2> above.

As a result, as shown in FIGS. 3B and 3C, TXNIP knockout mouse-derived bone marrow cells showed decreased myeloproliferative capacity and hematopoietic stem cell frequency under oxidative stress conditions (FIGS. 3B and 3C)

<5-2> Oxidative  Under stress conditions TXNIP  Knockout Mouse in the Spleen Colony type Confirm declining unit

Under oxidative stress conditions, TXNIP knockout mouse derived bone marrow cells underwent colony forming unit-spleen (CFU-S) to identify colony formation in the spleen.

Specifically, 1 x 10 ⁵ bone marrow cells treated with paraquat to induce oxidative stress in wild-type or TXNIP knockout mice to irradiated (9 Gy) wild-type pseudotypic (CD45.1 ⁺ ) recipients were injected intravenously Respectively. At this time, control mice were treated with PBS. The spleen was separated from the mice and fixed in a Carnoy's solution (60% ethanol, 30% chloroform, 10% acetic acid (V / V)) and the number of microscopic colonies was counted after 7 days.

As a result, it was confirmed that the colony forming unit-spleen number of bone marrow cells derived from TXNIP knockout mouse was significantly reduced under oxidative stress conditions (FIG. 3D), as shown in FIG. 3D.

<5-3> Oxidative  Under stress conditions TXNIP  Reduced survival rate of knockout mice

A radioprotection assay was performed to determine the survival rate of TXNIP knockout mice under oxidative stress conditions.

Specifically, the bone marrow transplantation was performed by the method of Example < 2-2 &gt;, and the number of the bone marrow cells was controlled so that the survival rate of the wild type bone marrow cells was more than 60%. Red blood cells (RBCs) were isolated from the whole bone marrow cells of the donors and were treated with PBS in the wild type, wild type paraquat treated mice, PBS treated with TXNIP knockout, and TXNIP knockout treated with paraquat 1.5 x 10 ⁵ bone marrow cells isolated from mice were injected into irradiated (9 Gy) pseudotyped (CD45.1 ⁺ ) recipients. The results of this experiment indicate that mice that received a sufficient amount of hematopoietic stem cells from donor bone marrow cells due to normal blood production may be able to survive after bone marrow transplantation. In addition, graft survival was recorded daily and expressed as the Kaplan-Meier survival curve.

As a result, TXNIP knockout mouse-derived bone marrow cells showed low survival rate under oxidative stress conditions as compared to the wild type as shown in FIG. 3E (FIG. 3E).

<5-4> TXNIP  Decreased myeloproliferative capacity of hematopoietic stem cells isolated from knockout mouse

LKS cells (CD45.2 +) were isolated from mice to confirm the myeloproliferative ability of the hematopoietic stem cells directly, and a competitive bone marrow proliferation assay was performed by the method of Example <2-2> above.

As a result, as shown in FIGS. 3F and 3G, it was confirmed that the LKS cell line derived from the TXNIP knockout mice under the oxidative stress condition significantly decreased the myeloproliferative capacity and hematopoietic stem cell frequency in the recipient (FIGS. 3F and 3G).

Thus, the above results indicate that TXNIP maintains the ability of the hematopoietic stem cell to proliferate by regulating the level of reactive oxygen species under oxidative stress conditions.

< Example  6> In vivo TXNIP Antioxidative effect of

<6-1> Oxidative  Under stress conditions TXNIP  Reduced survival rate of knockout mice

Based on the role of TXNIP in hematopoietic stem retention, the present inventors have examined the effect of TXNIP deficiency on the hematopoietic system in terms of protection against oxidative stress in vivo.

Specifically, in order to induce an oxidative stress environment, 40 ㎎ / kg of paraquat was injected into mice, and the experiment was carried out by the method of Example <5-3>.

As a result, all of the TXNIP knockout mice died within 160 hours, as shown in Figure 4A, but the wild type mice did not die within that time and survived more than 2 months. In addition, in the group treated with N-acetylcysteine (NAC), which was an antioxidant, the recovery rate was about 70% despite the TXNIP knockout mouse (FIG. 4A)

<6-2> Oxidative  Under stress conditions TXNIP  Decreased survival rate of knockout mouse-derived bone marrow transplant recipients

Bone marrow transplantation was performed by the method of Example <2-2> to exclude the possibility of toxic effects in other tissues and to determine the intrinsic response of the hematopoietic cells to oxidative stress. After 8 weeks , And 40 ㎎ / ㎏ of paraquat was injected into mice to induce an oxidative stress environment.

As a result, as shown in FIG. 4B, mice receiving whole bone marrow cells derived from TXNIP knockout mice died within 150 hours, whereas mice receiving whole wild-type mouse-derived bone marrow cells survived 70% (FIG. 4B).

<6-3> Oxidative  Stress condition TXNIP  Spleen and Thymus of Knockout Mice thymus ),

Spleens were isolated from mice used in the experiment of Example < 6-3 > and spleen of TXNIP knockout mice and wild type mice were observed under oxidative stress conditions.

Specifically, paraquat was administered to abdominal cavity at 40 mg / kg in 8-week-old wild-type mouse and TXNIP knockout mouse, and spleen and thymus were taken out from mouse after 96 hours and immediately photographed.

As a result, it was confirmed that the spleen size and cytoplasm of TXNIP knockout mice exposed to oxidative stress were significantly decreased as shown in FIG. 4C (FIG. 4C). In addition, the thymus of the mouse was observed. As shown in FIG. 4E, it was confirmed that significant damage to the thymus occurred in TXNIP knockout mice exposed to oxidative stress (FIG. 4E).

<6-4> Oxidative  Under stress conditions TXNIP  Increased cell death in knockout mice

TUNEL analysis and annexin V staining were performed to confirm the occurrence of apoptosis in the spleen of TXNIP knockout mice under oxidative stress.

Specifically, 8 weeks old wild-type mouse and TXNIP knockout mouse were administered paraquat at a dose of 40 mg / kg per abdominal cavity. After 96 hours, the spleen and thymus were removed from the mouse to measure the cell number of the spleen. Tinel staining was performed by methods well known to those skilled in the art in order to confirm H & E staining and cell death of the spleen by staining with Annexin V and confirming with flow cytometry and fixing in a 10% formalin solution.

As a result, it was confirmed that cell death was significantly increased in TXNIP knockout mice exposed to oxidative stress as shown in FIG. 4D (FIG. 4D).

< Example  7> Oxidative  Confirmation of increased lung metastasis under stress conditions

In the host immune system, metastasis of lung cancer was measured to determine the effect of oxidative stress.

B16-F10 melanoma cells were suspended in PBS solution in 8-12 week old wild-type mice and TXNIP knockout mice, and 5 x 10 ⁵ cells per mouse were injected into the tail vein. Was administered intraperitoneally at a dose of 20 mg / kg. After 8 days, the lungs of the rats were separated and metastatic melanoma was photographed.

As a result, it was confirmed that cancer metastasis was significantly increased in TXNIP mice exposed to oxidative stress as shown in FIG. 4F (FIG. 4F).

< Example  8> TXNIP Of cancer metastasis

Lung cancer cells were used to confirm the anti-metastasis response of immune cells through bone marrow transplantation.

Specifically, 2.5 x 10 ⁶ bone marrow cells (CD45.2) were isolated from wild-type and TXNIP knockout donor mice, and the cells were injected into the tail vein of the recipient mouse (CD45.1) irradiated with 9 Gy of radiation. After 8 weeks, Experiments were carried out according to the method of Example 7, and the lungs were separated after 13 days and photographed.

As a result, as shown in FIG. 4G, lung metastasis was significantly increased in mice that received whole bone marrow cells derived from TXNIP knockout mice (FIG. 4G).

Thus, toxic effects of paraquat in TXNIP knockout mice were confirmed, and TXNIP knockout mice were found to be unable to maintain a functional immune system under oxidative stress conditions. In addition, the above results indicate that TXNIP acts as an antioxidant protein to regulate reactive oxygen species in whole hematopoietic cells including immune cells and hematopoietic stem cells.

< Example  9> in bone marrow cells TXNIP  Protein, active oxygen and p53  Level correlation

&Lt; 9-1 > In the bone marrow cells, TXNIP  Identify the relevance of expression levels

To ascertain the relationship between the levels of active oxygen and TXNIP expression in bone marrow cells, intracellular reactive oxygen and TXNIP levels were determined using the method of Example <3-1> above.

As a result, it was confirmed that there is an inverse correlation between the levels of active oxygen and TXNIP in bone marrow cells as shown in FIGS. 5A and 5B (FIGS. 5A and 5B).

&Lt; 9-2 > In the bone marrow cells, TXNIP Of the expression level

Recently, it has been confirmed that p53, a tumor suppressor protein, is antioxidant and overexpressed in hematopoietic stem cells. Therefore, in order to confirm the relationship between TXNIP and p53 in bone marrow cells, p53 was stained and its level was confirmed. The level of active oxygen was measured using the method of Example <3-1>.

Bone marrow cells were isolated from 8-12 week old wild-type and TXNIP knockout mice by the method of Example <2-1>, and a marker of hematopoietic stem cells (Lin-c-KitSca-1) was attached thereto. BD Cytofix / Cytoperm Solution for 30 minutes on ice. Then, cells were washed with BD Perm / Wash solution, suspended in Cytoperm Plus solution, left on ice for 10 minutes, washed once with BD Perm / Wash solution, and washed with BD Cytofix / Cytoperm solution on ice The cells were washed with BD Perm / Wash solution. The cells were suspended in a PBS solution containing 2% FBS and reacted with a p53 antibody with FITC attached thereto at room temperature for 30 minutes. The cells were then washed with PBS containing 2% FBS, Cell analysis was performed.

As a result, the expression of p53 was significantly decreased (Fig. 5C) and the level of active oxygen was significantly increased in TXNIP knockout bone marrow cells as shown in Figs. 5C and 5D (Fig. 5D).

Thus, the above results show that TXNIP, p53 expression, and regulation of reactive oxygen species are involved, and that the level of p53 in TXNIP knockout bone marrow cells is lower than that of wild-type bone marrow cells, Respectively. This indicates that the active oxygen in the TNXIP knockout bone marrow cells was not regulated only by p53, and that the level of p53 was more sensitive in the absence of TXNIP.

< Example  10> Hematopoietic  In the regulation of active oxygen p53 Confirm the function of

<10-1> p53 ^{- / -}  Hematopoietic stem cells and progenitor cells ( progenitor ) To confirm the increase in free oxygen level

In order to confirm the function of p53 in the regulation of active oxygen of hematopoietic cells, the levels of active oxygen of p53 ^{- / -} hematopoietic stem cells and progenitor cells were measured using the method of Example <3-1> above.

As a result, as shown in FIG. 5E, it was confirmed that p53 ^{- / -} hematopoietic stem cells and progenitor cells had higher levels of active oxygen than wild type hematopoietic stem cells and progenitor cells (FIG. 5E).

<10-2> TXNIP  And p53 Double knockdown ( double knock - down ) To confirm the increase effect of active oxygen

The level of active oxygen was measured by inhibiting the expression of p53 in double-knock-down cells by inhibiting the expression of TXNIP.

Specifically, a Platinum-E retroviral packaging cell line (CellBiolabs, USA) was used to produce retroviruses capable of expressing shRNA, and HuSH-29 shRNA (OriGene, USA) was used as shRNA. The virus obtained from the cell line was inoculated into LKS cells isolated from wild-type and TXNIP knockout mice at 8 to 12 weeks of age for 3 days for 3 times, and expression of the gene was confirmed by real-time PCR and the level of active oxygen Respectively. The sequence of the shRNA used in the experiment is as follows:

mTXNIP (SEQ ID NO: 1): 5'-GATTCTAAGGTGATGTTCTTAGCACTTTA-3 ', and

mp53 (SEQ ID NO: 2): 5'-TGGCCATCTACAAGAAGTCACAGCACATG-3 '.

In addition, PFT-alpha (Sigma, USA), which is a p53 inhibitor, was intraperitoneally injected into mouse at 5 mg / kg, and after 48 hours, the level of active oxygen was measured using the method of Example <3-1>.

As a result, when the p53 shRNA was treated or the p53-specific inhibitor PFT-a was treated as shown in FIGS. 5F and 5G, the levels of reactive oxygen species were further increased in TXNIP ^{- / -} hematopoietic stem cells and progenitor cells 5F and 5G).

<10-3> Oxidative  Under stress conditions p53 Antioxidative effect of

In order to confirm the antioxidative effect of p53 under oxidative stress conditions, p53 ^{- / -} mice were treated with paraquat and the level of active oxygen was measured using the method of Example <3-1> above.

As a result, it was confirmed that the active oxygen levels of p53 ^{- / -} hematopoietic stem cells and immune cells were increased under oxidative stress conditions as shown in FIG. 5H (FIG. 5H).

<10-4> Oxidative  Under stress conditions p53 ^{- / -}  Confirm reduction of survival rate of mouse

The p53 ^{- / -} mice were injected with paraquat 50 mg / kg to produce an oxidative stress environment, and the survival rate of the mice was confirmed by the method of Example <5-3>.

As a result, it was confirmed that the survival rate of p53 ^{- / -} mice was significantly reduced under an oxidative stress environment as compared with wild type mice as shown in FIG. 5I (FIG. 5I).

<10-5> Oxidative  Under stress conditions TXNIP  Knockout Mouse p53  Identification of reduction of mouse survival rate by inhibitor treatment

In order to induce an oxidative stress environment, paraquat 40 mg / kg was injected into Txnip ^{- / -} mice treated with wild type mice, Txnip ^{- / -} mice and PFT- > Method.

As a result, as shown in FIG. 5J, Txnip ^{- / -} mice treated with PFT-α were found to be most sensitive to oxidative stress (FIG. 5J).

Thus, the above results indicate that TXNIP binds to p53 in order to regulate levels of reactive oxygen species in both hematopoietic stem cells and immune cells.

< Example  11> TXNIP  And p53 Direct interaction of interaction ) Confirm

<11-1> TXNIP Sequential mutants of

Sequential mutagenesis of TXNIP was performed to identify the binding site of TXNIP protein binding to p53.

Specifically, the human GST-TXNIP and FLAG-TXNIP constructs were used as templates for site-directed mutagenesis of TXNIP mutants, and for the production of the mutants The QuickChange II site-directed mutagenesis kit (Stratagene, USA) was used as described in the manufacturer's instructions. The primers used for the construction of the mutant construct are shown in Table 1 below.

Name of the primer The sequence (5 '- &gt; 3') SEQ ID NO: human TXNIP (C247S) _F CTCAGGGACATCCGCATCATGGCGTGGC 3 human TXNIP (C247S) _R GCCACGCCATGATGCGGATGTCCCTGAG 4 human TXNIP (C267S) _F CTTCTATCCTGGGCTCCAACATCCTTCGAG 5 human TXNIP (C267S) _R CTCGAAGGATGTTGGAGCCCAGGATAGAAG 6 human TXNIP (C333S) _F GAAGCTCCTCCCTCCTATATGGATGTC 7 human TXNIP (C333S) _R GACATCCATATAGGAGGGAGGAGCTTC 8 human TXNIP (C384S) _F GAGGTGGATCCCTCCATCCTCAACAAC 9 human TXNIP (C384S) _R GTTGTTGAGGATGGAGGGATCCACCTC 10

<11-2> p53 Coupled with TXNIP Confirmation of binding site

GST pulldown was performed to confirm the binding site with p53 using the construct constructed by the method of Example <11-1>.

Specifically, 48 hours after the construct was injected into the cells, cell lysate was obtained. 500 μg of lysate was dispensed into each well and GST-4B beads were added. The beads were allowed to settle at 4 ° C for 4 hours, washed three times with a lysis solution, and then subjected to SDS loading loading solution and subjected to SDS-PAGE. Thereafter, the membrane was transferred to a PVDF membrane and Western blotting was performed by a method well known to those skilled in the art.

As a result, as shown in FIG. 6A, it was confirmed that cysteine residues at positions 247 and 267 of TXNIP play an important role in binding to p53 (FIG. 6A).

<11-3> p53 Of the deletion mutant ( deletion mutant ) Production and TXNIP Confirm binding site with

This time, two deletion mutants were constructed to identify the sites of p53 that bind to TXNIP.

Specifically, the p53 fragment was amplified using a pfu polymerase mix (Bioneer, Korea) in order to prepare deletion mutants of C-terminal or N-terminal p53 DNA-binding domain (DBD) Was cloned into the corresponding restriction enzyme site. Here, the primers used are shown below. GST pulldown was performed by the method of Example <11-2> to confirm the binding site with TXNIP.

DBD ( EcoRI / XhoI ) forward (SEQ ID NO: 11): 5'-GCGAATTCTTCTTGCATTCTGGGACA-3 '

DBD ( EcoRI / XhoI ) reverse (SEQ ID NO: 12): 5'-GCCTCGAGGCGGAGATTCTCTTCCTC-3 '

DBD-N ( EcoRI / XhoI ) forward (SEQ ID NO: 13): 5'-GCGAATTCTTCTTGCATTCTGGGACA-3 '

DBD-N ( EcoRI / XhoI ) reverse (SEQ ID NO: 14): 5'-GCCTCGAGCAAATTTCCTTCCACTCG-3 '

DBD-C ( EcoRI / XhoI ) forward (SEQ ID NO: 15): 5'-GCGAATTCCGTGTGGAGTATTTGGAT-3 '

DBD-C ( EcoRI / XhoI ) reverse (SEQ ID NO: 16): 5'-GCCTCGAGGCGGAGATTCTCTTCCTC-3 '.

As a result, it was confirmed that TXNIP interacted with the C-terminal DNA-binding domain region of p53 containing five cysteine residues as shown in Fig. 6B (Fig. 6B).

<11-4> Oxidative  Under stress conditions TXNIP  And p53 Confirmation of increase of coupling

Immunoprecipitation was performed to determine how the binding of TXNIP and p53 changes under oxidative stress conditions.

Specifically, after the cells were treated with H ₂ O ₂ , a cell lysate was obtained. The protein of the above-mentioned lysate was quantified and each fraction was divided to 500 μg. Rabbit-TXNIP (rabbit-TXNIP) antibody was added and reacted at 4 ° C. for 1 hour. The protein G- Agarose bead (Roche, USA) was added and further reacted for 4 hours. After all the reactions were completed, the beads were washed three times with lysis solution, and SDS-PAGE and Western blotting were performed by methods well known in the art.

As a result, when H ₂ O ₂ was treated to produce an oxidative stress environment as shown in FIG. 6C, the bond between TXNIP and thioredoxin (TRX) dissociated, and the bond between TXNIP and p53 (Fig. 6C).

<11-5> TXNIP  Double mutation and p53 Of cells

Immunostaining was performed to confirm the binding between C247S and C267S mutations of TXNIP and p53 under oxidative stress conditions.

Specifically, a wild-type TXNIP or a wild type TXNIP was added to a Baf3 cell line, which was a murine bone marrow-derived pro-B cell cultured in RPMI-1640 medium containing 10% FBS and mouse IL-3 ng / Double mutation (DM) TXNIP was overexpressed and used for immunostaining. The cell line was fixed and permeabilized using a Cytofix / Perm solution (BD Biosciences, USA), and then p53 primary antibody (Santa Cruz, USA) was added in PBS containing 2% FBS After 1 hour of reaction, the cells were washed 3 times with PBS and reacted with Alexa Fluor 488 or 546 (Invitrogen, USA) secondary antibody. The staining results were observed with an LSM510 confocal microscope (Carl Zeiss, Germany) .

As a result, as shown in FIG. 6D, it was confirmed that the C247S and C267S mutations of TXNIP did not bind p53 and did not increase the expression of p53 in the cells (FIG. 6D).

<11-6> TXNIP On by p53  And MDM2  Confirm reduction of binding between

The stability of p53 is known to be modulated by MDM2 through ubiquitination-dependent proteosomal degradation (Sasaki et al., 2011). Immunoprecipitation was performed according to the method of Example 11-4 to determine the effect of TXNIP on the binding of p53 and MDM2. Here, anti-MDM2 (Santa Cruz, USA), anti-p53 Santa Cruz, USA) and anti-TXNIP (Invitrogen, USA) primary antibodies were used.

As a result, it was confirmed that the binding of p53 and MDM2 was significantly reduced by TXNIP as shown in Fig. 6E (Fig. 6E).

<11-7> TXNIP  And p53  Confirmation of increased binding-mediated transcriptional activity

Reporter assays were performed to determine the effect of p53 and TXNIP on the function of p53.

Specifically, TXNIP or TXNIP (double mutants) were transfected into Baf3 cell line, a murine bone marrow-derived pro-B cell line cultured in RPMI-1640 medium containing 10% FBS and mouse IL-3 ng / The pRL-CMV plasmid vector and lipofectamine-plus were transfected according to the manufacturer's instructions. Luciferase activity was observed using a p53-Luc reporter and the efficiency of transfection by transfecting together a renilla luciferase-expression vector (Promega, USA) Respectively. The firefly and renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, USA).

As a result, p53-mediated transcription activity was significantly increased in the cells by the binding between TXNIP and p53 as shown in Fig. 6F (Fig. 6F).

Thus, these results indicate that TXNIP inhibits binding between p53 and MDM2 to increase p53 stability and induce transcriptional activity of p53.

< Example  12> In vivo TXNIP end p53 Antioxidant effect

<12-1> In hematopoietic cells p53  And confirming expression of the target protein thereof

In order to confirm the possibility that TXNIP can regulate the antioxidant activity of p53 through the expression of p53-dependent antioxidant gene, the expression of p53 and its target genes SESN1, SESN2, GPX-1 and p21 in wild-type LKS and LK cell lines Immunostaining and western blotting were performed for confirmation.

Specifically, immunostaining was carried out according to the method of Example < 11-5 >. In order to perform Western blotting, the cell line was washed with PBS and incubated with 0.1% Nonidet P-40, 10 mg / ml aprotinin, 10 mg / ml leupeptin, 10 mM sodium fluoride, 1-antitrypsin, 2 mM sodium pyrophosphate, 25 mM sodium beta-glycerophosphate, 1 mM sodium orthovanadate, 1 mM sodium pyrophosphate, (20 mM Hepes (pH 7.9), 10 mM EDTA, 0.1 M KCl, 0.3 M NaCl] 1 x RIPA buffer supplemented with 1 mM sodium orthovanadate and 1 mM PMSF (phenylmethylsulfonyl fluoride). The proteins extracted from the lysed cells were centrifuged to obtain supernatant, and the protein concentration of the supernatant was quantified using the BCA method. Then, the same amount of protein was separated by PAGE electrophoresis using an SDS running buffer and transferred to a PVDF membrane to which 0.1% tween 20 and 5% skim milk were added Gt; PBS &lt; / RTI &gt; Then, primary antibodies against p53, GPX-1, p21 and β-actin were reacted overnight at 4 ° C., washed with PBS, treated with secondary antibody, and reacted at room temperature for 1 hour. Membranes were developed using ECL (Pierce, USA) solution.

As a result, the expression of p53 and its target genes, SESN1, SESN2, GPX-1 and p21 proteins, as shown in Figs. 7A and 7B, was confirmed (Figs. 7A and 7B).

<12-2> TXNIP  In a deficient cell line p53  Identification of expression of target gene

Quantitative real-time PCR and RT-PCR were performed to confirm the level of mRNA expression of the p53 target gene in wild-type and TXNIP-deficient LKS cell lines.

Total RNA was isolated from LKS cells using TRIzol and RNeasy Micro kit (Qiagen, USA). Quantitative PCR was performed using SYBR Premix ExTaq (Takara Bio, Japan) and Thermal Cycler Dice Real-Time System TP800 (Takara Bio, Japan). RT-PCR was performed using Maxime PCR premix kit (Intron biotechnology, Korea) according to the manufacturer's instructions, and the primers used were as shown in Table 2 below.

Name of the primer The sequence (5 '- &gt; 3') SEQ ID NO: BAX_F ATGCGTCCACCAAGAAGCTG 17 BAX_R CCCCAGTTGAAGTTGCCATC 18 PUMA_F CTGTATCCTGCAGCCTTTGC 19 PUMA_R ACGGGCGACTCTAAGTGCT 20 CDKN1A_F GGAACATCTCAGGGCCGAA 21 CDKN1A_R TGGGCACTTCAGGGTTTTCT 22 GPX-1_F CCAAGTACATCATTTGGTCT 23 GPX-1_R CATTAGGTGGAAAGGCATCG 24 SESN1_F CCAGGACGAGGAACTTGG 25 SESN1_R CCAGGTAGGAACACTGATGC 26 SESN2_F CTCACAGCTGGTCTGTGTG 27 SESN2_R CCTCCGTGTGGCAATACC 28

As a result, as shown in FIG. 7C, the expression of p53 target protein showing antioxidative effect was decreased in the TXNIP-deficient cell line as compared with the wild type LKS cell line (FIG. 7C).

<12-3> TXNIP  In a deficient cell line, an oxidation promoting gene ( pro - oxidant gene ) Increased expression of

The expression level of mRNA was confirmed by the method of Example 12-3 in order to confirm the expression change of an oxidation promoting gene inducing apoptosis in a TXNIP deficient cell line. Respectively.

As a result, as shown in FIG. 7D, mRNA expression levels of CDKN1A, BAX, and PUMA as the oxidation promoting genes in the TXNIP deficient cell line were significantly increased (FIG. 7D). Thus, the above results indicate that a significant increase in the level of active oxygen in TXNIP knockout mice is associated with p53 activity.

<12-4> Oxidative  Under stress conditions TXNIP  Depending on the expression change p53  Check for changes in activity

The expression of TXNIP and the change of p53 activity by the exposure time to the oxidative stress environment were performed by Western blotting according to the method of Example <12-1>, wherein phospho-p53 (S15) ), p53 (Santa Cruz, USA), TXNIP (Invitrogen, USA) and GAPDH (Santa Cruz, USA) were used.

As a result, as shown in FIG. Lineage 7E ^- (lineage ^-) in cell lines, increased expression of TXNIP in oxidative stress environment, view represents a different kinetics (kinetics) of active p53 (Fig. 7E).

<12-5> In vivo TXNIP  And p53 Identification of antioxidant activity by interaction of

In order to directly confirm the antioxidative activity by the interaction of TXNIP and p53, wild-type TXNIP, double mutant TXNIP or p53 gene was transfected into bone marrow cells derived from TXNIP knockout mouse, (CD45.1 ⁺ ) recipients by bone marrow transplantation. After 8 weeks of bone marrow transplantation, paraquat 40 mg / kg was administered to the recipient, and the frequency of hematopoietic stem cells was measured according to the method of Example <1-2> Survival rate was measured by the method.

As a result, as shown in FIG. 7F, the frequency of hematopoietic stem cells was restored in mice transplanted with wild type TXNIP or p53 transfected cells (FIG. 7F), and as shown in FIG. 7G, (Fig. 7G).

Thus, the above results indicate that TXNIP has an antioxidative effect through interaction with p53 in vivo (Fig. 7H).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Pharmaceutical composition comprising Thioredoxin-binding protein          as an active ingradient and using them <130> 13P-04-47 <160> 30 <170> Kopatentin 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mTXNIP <400> 1 gattctaagg tgatgttctt agcacttta 29 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> Mp53 <400> 2 tggccatcta caagaagtca cagcacatg 29 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C247S) _F <400> 3 ctcagggaca tccgcatcat ggcgtggc 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C247S) _R <400> 4 gccacgccat gatgcggatg tccctgag 28 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C267S) _F <400> 5 cttctatcct gggctccaac atccttcgag 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C267S) _R <400> 6 ctcgaaggat gttggagccc aggatagaag 30 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C333S) _F <400> 7 gaagctcctc cctcctatat ggatgtc 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C333S) _R <400> 8 gacatccata taggagggag gagcttc 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C384S) _F <400> 9 gaggtggatc cctccatcct caacaac 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > human TXNIP (C384S) _R <400> 10 gttgttgagg atggagggat ccacctc 27 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD (EcoRI / XhoI) forward <400> 11 gcgaattctt cttgcattct gggaca 26 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD (EcoRI / XhoI) reverse <400> 12 gcctcgaggc ggagattctc ttcctc 26 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-N (EcoRI / XhoI) forward <400> 13 gcgaattctt cttgcattct gggaca 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> DBD-N (EcoRI / XhoI) reverse <400> 14 gcctcgagca aatttccttc cactcg 26 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DBD-C (EcoRI / XhoI) forward <400> 15 gcgaattccg tgtggagtat ttggat 26 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> DBD-C (EcoRI / XhoI) reverse <400> 16 gcctcgaggc ggagattctc ttcctc 26 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BAX_F <400> 17 atgcgtccac caagaagctg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BAX_R <400> 18 ccccagttga agttgccatc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PUMA_F <400> 19 ctgtatcctg cagcctttgc 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PUMA_R <400> 20 acgggcgact ctaagtgct 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CDKN1A_F <400> 21 ggaacatctc agggccgaa 19 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDKN1A_R <400> 22 tgggcacttc agggttttct 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPX-1_F <400> 23 ccaagtacat catttggtct 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPX-1_R <400> 24 cattaggtgg aaaggcatcg 20 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SESN1_F <400> 25 ccaggacgag gaacttgg 18 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SESN1_R <400> 26 ccaggtagga acactgatgc 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SESN2_F <400> 27 ctcacagctg gtctgtgtg 19 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SESN2_R <400> 28 cctccgtgtg gcaatacc 18 <210> 29 <211> 1176 <212> DNA <213> Homo sapiens <400> 29 atggtgatgt tcaagaagat caagtctttt gaggtggtct ttaacgaccc tgaaaaggtg 60 tacggcagtg gcgagagggt ggctggccgg gtgatagtgg aggtgtgtga agttactcgt 120 gtcaaagccg ttaggatcct ggcttgcgga gtggctaaag tgctttggat gcagggatcc 180 cagcagtgca aacagacttc ggagtacctg cgctatgaag acacgcttct tctggaagac 240 cagccaacag gtgagaatga gatggtgatc atgagacctg gaaacaaata tgagtacaag 300 ttcggctttg agcttcctca ggggcctctg ggaacatcct tcaaaggaaa atatgggtgt 360 gtagactact gggtgaaggc ttttcttgac cgcccgagcc agccaactca agagacaaag 420 aaaaactttg aagtagtgga tctggtggat gtcaataccc ctgatttaat ggcacctgtg 480 tctgctaaaa aagaaaagaa agtttcctgc atgttcattc ctgatgggcg ggtgtctgtc 540 tctgctcgaa ttgacagaaa aggattctgt gaaggtgatg agatttccat ccatgctgac 600 tttgagaata catgttcccg aattgtggtc cccaaagctg ccattgtggc ccgccacact 660 taccttgcca atggccagac caaggtgctg actcagaagt tgtcatcagt cagaggcaat 720 catattatct cagggacatg cgcatcatgg cgtggcaaga gccttcgggt tcagaagatc 780 aggccttcta tcctgggctg caacatcctt cgagttgaat attccttact gatctatgtt 840 agcgttcctg gatccaagaa ggtcatcctt gacctgcccc tggtaattgg cagcagatca 900 ggtctaagca gcagaacatc cagcatggcc agccgaacca gctctgagat gagttgggta 960 gatctgaaca tccctgatac cccagaagct cctccctgct atatggatgt cattcctgaa 1020 gatcaccgat tggagagccc aacaactcct ctgctagatg acatggatgg ctctcaagac 1080 agccctatct ttatgtatgc ccctgagttc aagttcatgc caccaccgac ttatactgag 1140 gtggatccct gcatcctcaa caacaatgtg cagtga 1176 <210> 30 <211> 1194 <212> DNA <213> Mus musculus <400> 30 atggtgatgt tcaagaagat caagtctttt gaggtggtct tcaacgaccc cgagaaggtg 60 tacggcagcg gggagaaggt ggccggacgg gtaatagtgg aagtgtgtga agttacccga 120 gtcaaagccg tcaggatcct ggcttgcggc gtggccaagg tcctgtggat gcaagggtct 180 cagcagtgca aacagacttt ggactacttg cgctatgaag acacacttct cctagaagag 240 cagcctacag caggtgagaa cgagatggtg atcatgaggc ctggaaacaa atatgagtac 300 aagttcggct tcgagcttcc tcaagggccc ctgggaacat cctttaaagg aaaatatggt 360 tgcgtagact actgggtgaa ggcttttctc gatcgcccca gccagccaac tcaagaggca 420 aagaaaaact tcgaagtgat ggatctagtg gatgtcaata cccctgacct aatggcacca 480 gtgtctgcca aaaaggagaa gaaagtttcc tgcatgttca ttcctgatgg acgtgtgtca 540 gtctctgctc gaattgacag aaaaggattc tgtgaaggtg atgacatctc catccatgct 600 gactttgaga acacgtgttc ccgaatcgtg gtccccaaag cggctattgt ggcccgacac 660 acttaccttg ccaatggcca gaccaaagtg ttcactcaga agctgtcctc agtcagaggc 720 aatcacatta tctcagggac ttgcgcatcg tggcgtggca agagcctcag agtgcagaag 780 atcagaccat ccatcctggg ctgcaacatc ctcaaagtcg aatactcctt gctgatctac 840 gtcagtgtcc ctggctccaa gaaagtcatc cttgatctgc ccctagtgat tggcagcagg 900 tctggtctga gcagccggac atccagcatg gccagccgga cgagctctga gatgagctgg 960 atagacctaa acatcccaga taccccagaa gctcctcctt gctatatgga catcattcct 1020 gaagatcaca gactagagag ccccaccacc cctctgctgg acgatgtgga cgactctcaa 1080 gacagcccta tctttatgta cgcccctgag ttccagttca tgcccccacc cacttacact 1140 gaggtggatc cgtgcgtcct taacaacaac aacaacaaca acaacgtgca gtga 1194

Claims (16)

A pharmaceutical composition for immune enhancement comprising as an active ingredient a gene carrier, cell or TXNIP protein comprising a TXNIP (Thioredixin-interacting protein) gene.
The method of claim 1, wherein the TXNIP Wherein the gene is a nucleotide sequence consisting of SEQ ID NOS: 29 and 30.
The pharmaceutical composition according to claim 1, wherein the gene carrier is a vector or a recombinant virus.
The pharmaceutical composition according to claim 3, wherein the vector is linear DNA, plasmid DNA or recombinant viral vector.
The pharmaceutical composition according to claim 1, wherein the recombinant virus is any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, and herpes simplex virus.
The pharmaceutical composition for immunostaining according to claim 1, wherein the cell is a hematopoietic cell or a dendritic cell.
The pharmaceutical composition according to claim 1, wherein the immune enhancement is due to homeostasis of the immune system.
The pharmaceutical composition according to claim 1, wherein the immune enhancement is caused by homeostasis of a hematopoietic stem cell.
The pharmaceutical composition according to claim 1, wherein the immune enhancement exhibits an antioxidative activity by an interaction between TXNIP and p53.
A gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.
A pharmaceutical composition for inhibiting cancer metastasis comprising a gene carrier, cell or TXNIP protein comprising TXNIP gene as an active ingredient.
12. The pharmaceutical composition for suppressing cancer metastasis according to claim 11, wherein the cancer is lung cancer.
A gene transfer carrier comprising TXNIP gene, a cell, or a TXNIP protein as an active ingredient.
A pharmaceutical composition for the prevention and treatment of blood diseases comprising a gene carrier, cell or TXNIP protein containing TXNIP gene as an active ingredient.
15. The pharmaceutical composition according to claim 14, wherein the blood disease is any one selected from the group consisting of anemia, platelet aggregation, leukemia, myelodysplasia, myelofibrosis, and thrombocytopenia.
A health food for the prevention and improvement of blood diseases containing a TXNIP gene-containing gene carrier, a cell or a TXNIP protein as an active ingredient.

Images