CN111166867B

CN111166867B - Function and use of PD-1 ubiquitination agonist

Info

Publication number: CN111166867B
Application number: CN201811332819.2A
Authority: CN
Inventors: 许琛琦; 孟祥波; 刘希伟
Original assignee: Center for Excellence in Molecular Cell Science of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2018-11-09
Filing date: 2018-11-09
Publication date: 2022-12-20
Anticipated expiration: 2038-11-09
Also published as: CN111166867A

Abstract

The invention belongs to the technical field of life science, and particularly relates to functions and applications of a PD-1 ubiquitination agonist. According to the invention, extensive and intensive research shows that PD-1 can generate ubiquitination phenomenon and is further degraded, so that the functions of activation, proliferation, cytokine secretion and the like of T cells are enhanced, the killing function and proliferation capacity of tumor-infiltrated T cells are improved, the tumor cells are killed by an immune system, FBXO38 is a target point capable of promoting ubiquitination of PD-1, and the degradation of PD-1 can be remarkably promoted by promoting the expression of FBXO 38. Inhibition of FBXO38 expression inhibits PD-1 degradation and may be used to treat autoimmune diseases. Therefore, the invention provides strong scientific evidence for clinical immunotherapy of tumors and treatment of autoimmune diseases from clinical patient sample level, cell function level and molecular level.

Description

Function and use of PD-1 ubiquitination agonist

Technical Field

The invention belongs to the technical field of life science, and particularly relates to functions and applications of a PD-1 ubiquitination agonist.

Background

Malignant tumor is one of the most lethal diseases at present, and the conventional treatment means such as surgical excision, radiotherapy, chemotherapy and the like are mostly applied to tumor treatment, but the conventional treatment means has limitations in tumor treatment and is difficult to completely cure tumor, especially some metastatic malignant tumors.

As the most important line of defense for human health, the immune system is responsible for discovering and eliminating various pathogenic microorganisms outside (resisting infection) and harmful substances possibly generated in the body (resisting tumor), and avoiding damaging the body or generating autoimmune diseases due to too violent immune reaction. The immune system has a complex regulatory network to ensure that immune responses are in equilibrium, such as central tolerance mechanisms to ensure that the immune system eliminates autoreactive T somatic cells, and immunosuppressive cell-tregs to suppress peripheral inflammatory responses (Lohmann et al, 1996 van Noort et al, 1993. In addition, immunosuppressive molecules expressed on the surface of immune cells are also important components for ensuring immune balance, such as molecules expressed on the surface of CD8+ T cells, such as PD-1, CTLA-4, LAG-3, and TIM 3. After activation of these immunosuppressive molecules, intracellular signal transduction pathways are initiated, inhibitory signals are transmitted to T cells, the threshold for T cell activation is increased, and functions such as T cell activation, proliferation, and cytokine secretion are suppressed. Activation of these immunosuppressive molecules can inhibit the development of autoimmune diseases. However, everything is twofold, and in the tumor microenvironment, these immunosuppressive molecular pathways are usually continuously activated, resulting in the inhibition of the killing and proliferation of tumor-infiltrating T cells, which in turn escape the immune system.

Recent studies have found that sustained activation of the PD-1 pathway in the tumor microenvironment is an important mechanism for tumor immune escape. PD-1 molecules are highly expressed on the surface of the tumor-infiltrated T cells, and the ligand PD-L1 molecules are highly expressed by the tumor cells, so that the PD-1 pathway is continuously activated in a tumor microenvironment, and the tumor-infiltrated T cells become incapacitated. Clinically, after blocking the PD-1 pathway by blocking antibodies to PD-1, disease is reduced in approximately 20% of tumor patients. The emergence of PD-1 antibodies is a landmark event in tumor therapy, allowing one to see the promise of treating tumors by activating the immune system, opening a completely new avenue for tumor therapy. However, a number of clinical data suggest that PD-1 antibodies are effective against most solid tumors by only about 20% to 40%, meaning that a significant proportion of patients do not benefit from immunotherapy.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims at the function and the application of the PD-1 ubiquitination agonist.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

the first aspect of the invention provides the application of the PD-1 ubiquitination stimulant in preparing a PD-1 degradation agent or preparing a tumor immunotherapy medicament.

In one embodiment, the tumor is selected from one or more of melanoma, non-small cell lung cancer, renal cancer, head and neck squamous carcinoma, hodgkin's lymphoma, gastric cancer, liver cancer, bladder cancer, endometrial cancer, and colon cancer.

Further, the PD-1 ubiquitination agonist is a molecule having a promoting effect on PD-1 ubiquitination.

Specifically, the promotion of PD-1 ubiquitination can adopt various chemical, physical and biological methods. Including but not limited to:

(1) Modulating a PD-1 metabolic pathway to increase PD-1 ubiquitination levels;

(2) Ubiquitin was directly attached to PD-1.

Ubiquitin is a polypeptide consisting of 76 amino acids in eukaryotic cells, and the PD-1 ubiquitination refers to the ubiquitination modification of the ubiquitin connected to the lysine of PD-1, which affects the signal path of PD-1 or degrades PD-1 through proteasome.

The PD-1 ubiquitination agonist can enhance the functions of T cell activation, proliferation, cytokine secretion and the like, improve the killing function and proliferation capacity of tumor-infiltrated T cells, and enable the tumor cells to be killed by an immune system.

The ubiquitin has a nucleotide sequence shown as SEQ ID NO.1, and specifically comprises the following components:

ATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCCGGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGTTGCGCCTCCGCGGTGGATAA。

the Genbank accession number of the PD-1 is as follows: AY238517.

Further, the PD-1 ubiquitination agonist can promote the degradation of PD-1.

In one embodiment, the PD-1 ubiquitinated agonist may be a lentivirus or retrovirus packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide, or protein.

In one embodiment, the PD-1 ubiquitination agonist is an FBXO38 agonist.

Further, the FBXO38 agonist refers to a molecule having a promoting effect on FBXO 38.

Promoting effects on FBXO38 include, but are not limited to: enhance FBXO38 activity or promote FBXO38 gene transcription or expression.

In one embodiment, the FBXO38 agonist is selected from a molecule capable of increasing the expression or activity of FBXO 38.

The molecule capable of increasing the expression or activity of FBXO38 may be a lentiviral or retroviral packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide or protein.

Alternatively, the FBXO38 agonist may be a vector that increases the expression level of FBXO 38. Specifically, the vector may contain the FBXO38 gene and express active FBXO 38. The vector may be a plasmid vector, a lentiviral vector, a retroviral vector. Such as pHAGE, pMXs, MSCV.

The embodiment of the invention specifically lists pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen and MSCV-3Myc-FBXO38-IRES-ZsGreen as vectors for increasing the expression level of FBXO 38. The pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen specifically comprises: the sequence of Fbxo38 with 3 consecutive Myc tags at the N-terminus is inserted in the pHAGE vector before IRES-ZsGreen. After transfection of cells, FBXO38 molecules with Myc tags can be expressed in cells, zsGreen indicates positive cells.

The MSCV-3Myc-FBXO38-IRES-ZsGreen specifically comprises the following components: the sequence of Fbxo38 with 3 consecutive Myc tags at the N-terminus is inserted on the MSCV vector before IRES-ZsGreen. After transfection of cells, FBXO38 molecules with Myc tags can be expressed in cells, zsGreen indicating positive cells.

The human FBXO38 has Genbank accession numbers: BC050424.

The Genbank accession number of the mouse FBXO38 is as follows: AK031347.

The tumor immunotherapy medicament has at least one of the following functions:

enhancing killing function and proliferation ability of tumor-infiltrated T cells, inhibiting proliferation of cancer cells, reducing cancer cell activity, promoting cancer cell apoptosis, and inhibiting tumor growth.

The tumor immunotherapy medicament necessarily comprises a PD-1 ubiquitination agonist, and takes the PD-1 ubiquitination agonist as an effective component of the function.

In the tumor immunotherapy medicament, the effective component playing the functions can be only a PD-1 ubiquitination agonist, and can also comprise other molecules playing similar functions.

The tumor immunotherapy medicine can be a single-component substance or a multi-component substance.

The tumor immunotherapy medicament is not particularly limited in form, and can be in the form of various substances such as solid, liquid, gel, semifluid, aerosol and the like.

Optionally, in the tumor immunotherapy medicament, the PD-1 ubiquitination agonist is an FBXO38 agonist.

The tumor immunotherapy medicament mainly aims at mammals such as rodentia animals, artiodactyla animals, perissodactyla animals, lagomorpha animals, primates and the like. Preferably, the primate is a monkey, ape or homo sapiens.

In a second aspect of the invention, a method of immunotherapy of a tumor is provided, comprising administering to a subject a PD-1 ubiquitination agonist.

The subject may be a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

The subject may be a patient suffering from a tumor or an individual for whom treatment of a tumor is desired.

The PD-1 ubiquitination agonist may be administered to a subject before, during, or after receiving tumor therapy.

In a third aspect of the invention, a tumor immunotherapy medicament is provided, which comprises an effective amount of PD-1 ubiquitination agonist.

Furthermore, the tumor immunotherapy drug comprises an effective amount of PD-1 ubiquitination stimulant and a medicinal carrier.

In the tumor immunotherapy medicament, the effective component exerting the functions can be only a PD-1 ubiquitination agonist, and can also comprise other molecules capable of playing similar functions.

That is, the PD-1 ubiquitination agonist is the only effective component or one of the effective components of the tumor immunotherapy medicament.

In one embodiment, the PD-1 ubiquitinated agonist is an FBXO38 agonist.

Having a promoting effect on the FBXO38 includes, but is not limited to: enhance FBXO38 activity or promote FBXO38 gene transcription or expression.

Alternatively, the FBXO38 agonist may be a vector that increases the expression level of FBXO 38. Specifically, the vector may contain an FBXO38 gene and express active FBXO 38. The vector may be a plasmid vector, a lentiviral vector, a retroviral vector. Such as pHAGE, pMXs, MSCV.

The embodiment of the invention specifically lists pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen and MSCV-3Myc-FBXO38-IRES-ZsGreen as vectors for increasing the expression level of FBXO 38. The pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen specifically comprises: the Fbxo38 sequence with 3 consecutive Myc tags at the N-terminus was inserted into the pHAGE vector before IRES-ZsGreen. After transfection of cells, FBXO38 molecules with Myc tags can be expressed in cells, zsGreen indicating positive cells.

Optionally, the pharmaceutical formulation further comprises a pharmaceutically acceptable carrier.

In a fourth aspect of the invention, a tumor combination therapy drug combination is provided, which comprises an effective amount of PD-1 ubiquitination agonist and at least one other tumor therapy drug.

The other tumor treatment medicines refer to tumor treatment medicines except the PD-1 ubiquitination agonist.

The combination therapeutic drug combination may be in any one of the following forms:

one) PD-1 ubiquitination excitant and other tumor treatment medicine are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can also be the same or different.

When the other tumor therapeutic agent is an antitumor antibody, a parenteral administration type is generally employed. When the other tumor treatment medicines are chemotherapy medicines, the administration forms can be rich, and the gastrointestinal administration or the parenteral administration can be carried out. Known routes of administration for each chemotherapeutic agent are generally recommended.

Secondly), PD-1 ubiquitination excitant and other tumor treatment drugs are prepared into a compound preparation. When the PD-1 ubiquitination agonist and other tumor treatment drugs are administered by the same route of administration and administered simultaneously, they may be formulated as a combination preparation.

In a fifth aspect of the invention, a method for treating a tumor is provided, wherein an effective amount of a PD-1 ubiquitination agonist is administered to a subject, and an effective amount of another tumor treatment drug is administered to the subject and/or another tumor treatment means is administered to the subject.

An effective amount of the PD-1 ubiquitinated agonist and an effective amount of at least one other tumor treatment drug may be administered simultaneously or sequentially.

Such other tumor treatment drugs include, but are not limited to: antitumor antibodies, chemotherapeutic drugs or targeted drugs, etc.

The PD-1 ubiquitination agonist may be administered parenterally or parenterally. The other oncological therapeutic agents may be administered parenterally or parenterally. For antitumor antibodies or chemotherapeutic drugs, parenteral administration is generally employed.

In a sixth aspect, the invention provides the use of FBXO38 as an action target for screening a medicament for immunotherapy of tumor or for screening a medicament for therapy of autoimmune diseases.

In the use of screening the tumor immunotherapy drugs, the tumor is selected from one or more of melanoma, non-small cell lung cancer, kidney cancer, head and neck squamous carcinoma, hodgkin lymphoma, gastric cancer, liver cancer, bladder cancer, endometrial cancer and colon cancer.

In the application of screening tumor immunotherapy drugs, the application specifically refers to: and screening the candidate substance by taking the FBXO38 as an action object, verifying whether the candidate substance can enhance PD-1 ubiquitination and/or has a promoting effect on the FBXO38, and if so, determining the candidate substance as the tumor immunotherapy candidate drug.

In the application of screening the tumor immunotherapy drugs, the candidate substances are selected from nucleic acid drugs, carbohydrate drugs, lipid drugs, small molecule drugs, polypeptide drugs or protein drugs.

In the application of screening the medicines for treating the autoimmune diseases, the autoimmune diseases are selected from one or more of autoimmune diseases such as chronic lymphatic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, chronic ulcerative colitis, pernicious anemia with chronic atrophic gastritis, goodpasture's syndrome, blain vulgaris, herpes zoster, primary biliary cirrhosis, multiple encephalomyelitis, acute idiopathic polyneuritis, systemic lupus erythematosus, rheumatoid arthritis, systemic sclerosis, polyarteritis nodosa, systemic vasculitis, scleroderma and the like.

In the application of screening the autoimmune disease treatment drugs, the application specifically refers to: and (3) screening the candidate substance by taking the FBXO38 as an action object, verifying whether the candidate substance can reduce PD-1 ubiquitination and/or can have an inhibition effect on the FBXO38, and if so, determining the candidate substance as a candidate drug for treating the autoimmune disease.

In the use for screening a therapeutic agent for autoimmune diseases, the candidate substance is selected from a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug or a protein drug.

Having an inhibitory effect on FBXO38 includes, but is not limited to: inhibit FBXO38 activity, or inhibit FBXO38 gene transcription or expression.

The seventh aspect of the present invention provides a method for screening a tumor immunotherapy drug, comprising: and (3) verifying whether the medicament to be screened can enhance PD-1 ubiquitination and/or has a promoting effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for tumor immunotherapy.

In one embodiment, the drug to be screened is applied to cells in vitro expressing PD-1 to determine whether enhancement of ubiquitination of PD-1 occurs in the cells.

For example, the screening method may be: culturing in vitro cells expressing PD-1 under the condition suitable for cell growth, setting two groups of comparison experiments, adding a medicament to be screened into a culture dish of the in vitro cells in one group, adding an equal amount of normal saline in the other group, and incubating under the same condition to test whether the in vitro cells PD-1 are subjected to ubiquitination enhancement.

The method for determining the enhancement of ubiquitination can specifically be as follows: and (3) detecting by a western blot technology or a mass spectrum technology.

In one embodiment, the drug to be screened is applied to cells in vitro expressing FBXO38 to determine whether the cells have an increased viability or an up-regulated expression of FBXO 38.

For example, the screening method may be: culturing in vitro cells expressing FBXO38 under the condition suitable for cell growth, setting two groups of comparison experiments, adding the drug to be screened into a culture dish of the in vitro cells, adding the same amount of physiological saline into the other group, incubating under the same conditions, and testing whether the FBXO38 in the cells has activity enhancement or expression up-regulation.

The method of determining whether FBXO38 has increased viability or upregulated expression in a cell may be: real-time quantitative PCR, real-time quantitative PCR and Western Blot detection, or mass spectrum detection.

In one embodiment, the tumor immunotherapy drug is a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug, or a protein drug.

The eighth aspect of the present invention provides a method for screening a therapeutic agent for autoimmune diseases, comprising: and (3) verifying whether the medicament to be screened weakens PD-1 ubiquitination and/or has a suppression effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for treating the autoimmune disease.

In one embodiment, the drug to be screened is applied to cells in vitro expressing PD-1 to determine whether the cells have reduced ubiquitination of PD-1.

For example, the screening method may be: culturing in vitro cells expressing PD-1 under the condition suitable for cell growth, setting two groups of comparison experiments, adding a medicament to be screened into a culture dish of the in vitro cells in one group, adding an equal amount of normal saline in the other group, and incubating under the same condition to test whether the in vitro cells PD-1 are subjected to ubiquitination attenuation.

The method for determining the reduction of ubiquitination can specifically be as follows: and (3) detecting by a western blot technique or a mass spectrometry technique.

In one embodiment, the drug to be screened is applied to an in vitro cell expressing FBXO38 to determine whether the cell has a reduced viability or expression of FBXO 38.

For example, the screening method may be: culturing in vitro cells expressing FBXO38 under the condition suitable for cell growth, setting two groups of comparison experiments, adding the drug to be screened into a culture dish of the in vitro cells, adding the same amount of physiological saline into the other group, and incubating under the same conditions to test whether the FBXO38 in the cells has weakened vitality or reduced expression.

The method for determining whether the FBXO38 has become less viable or has decreased expression in a cell may be: real-time quantitative PCR, real-time quantitative PCR and Western Blot detection, or mass spectrum detection.

In one embodiment, the autoimmune disease treatment drug is a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug, or a protein drug.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, extensive and intensive research shows that PD-1 can be ubiquitinated and then degraded, so that the functions of T cell activation, proliferation, cytokine secretion and the like are enhanced, the killing function and proliferation capacity of tumor-infiltrated T cells are improved, the tumor cells are killed by an immune system, FBXO38 is a target point capable of promoting PD-1 ubiquitination, and the degradation of PD-1 can be remarkably promoted by promoting the expression of FBXO 38. Inhibition of FBXO38 expression inhibits PD-1 degradation and may be used to treat autoimmune diseases. Therefore, the invention provides strong scientific evidence for clinical immunotherapy of tumors and treatment of autoimmune diseases from clinical patient sample level, cell function level and molecular level.

Drawings

FIG. 1 ubiquitination modification and degradation of PD-1 following T cell activation

a, detecting the ubiquitination modification condition of PD-1 in PBMC of human peripheral blood mononuclear cells by using a co-immunoprecipitation and western blot method.

b, detecting ubiquitination modification dynamics of PD-1 at different times in the Jurkat cell line by using the co-immunoprecipitation and western blot method.

And c, detecting the ubiquitination modification condition of the PD-1 in the Jurkat cell line by using the co-immunoprecipitation and western blot method.

d, detecting the action of the proteasome inhibitor MG132 on PD-1 by using a flow cytometry technology.

And e, detecting the action condition of the proteasome inhibitor MG132 on the ERK by using a western blot method.

And f, detecting the action of the lysosome inhibitor NH4Cl on PD-1 by using a flow cytometry technology.

And g, detecting the action condition of a lysosome inhibitor NH4Cl on p62 by using a western blot method.

h, detecting the effect of the lysosome inhibitor BFA on PD-1 by using a flow cytometry technology.

i, the effect of the lysosomal inhibitor BFA on p62 was examined by the western blot method.

FIG. 2FBXO 38-specific modulation of PD-1 levels

a, detecting the interaction condition of the transgressed HA-PD-1 and Myc-FBXO38 in 293FT cells by using a co-immunoprecipitation technology.

b, detecting the interaction condition of the transgressed Myc-FBXO38 and HA-PD-1 in 293FT cells by using a co-immunoprecipitation technology.

c, detecting the interaction condition of the transformed Myc-FBXO38 and HA-PD-1 in Jurkat cells by using a co-immunoprecipitation technology.

d, co-immunoprecipitation was used to detect the interaction of the transfected Myc-FBXO38 with endogenous PD-1 in Jurkat cells.

e, detecting the interaction condition of the transgressed Myc-FBXO47 and HA-PD-1 in 293FT cells by using a co-immunoprecipitation technology.

f, detecting the overexpression of Myc-FBXO38 and Myc-FBXO47 in Jurkat cells by using a western blot method.

g, surface levels of CD3 in Jurkat cells overexpressing Myc-FBXO38 and Myc-FBXO47 were measured by flow cytometry.

h-i, surface levels of PD-1 in Jurkat cells overexpressing Myc-FBXO38 and Myc-FBXO47 were measured by flow cytometry.

j, detecting the knock down efficiency of Fbxo38 using fluorescent quantitative PCR technique.

k, protein levels of Fbxo38 after Fbxo38knock down were determined by western blot method.

l, the surface level of CD3 was detected in Jurkat cells of Fbxo38knock down using flow cytometry.

m, detecting the surface level of PD-1 in Jurkat cells of Fbxo38knock down by flow cytometry.

And n, detecting the mRNA level of PD-1 in Jurkat cells of Fbxo38knock down by using a fluorescent quantitative PCR (polymerase chain reaction) technology.

o, protein level of PD-1 in Jurkat cells of Fbxo38knock down was detected by the western blot method.

FIG. 3FBXO38 catalyzes the polyubiquitination modification of K-48 type in PD-1 and promotes degradation

a, detecting the ubiquitination of PD-1 by FBXO38 and the influence of two lysines conserved in PD-1 intracellular region on PD-1 ubiquitination by using co-immunoprecipitation and western blot technology in 293FT cells.

b, detecting the influence of FBXO38 overexpression on PD-1 ubiquitination in Jurkat cells by using the co-immunoprecipitation and western blot method.

And c, detecting the influence of FBXO38knock down on PD-1 ubiquitination in Jurkat cells by using co-immunoprecipitation and western blot method.

d, detecting the influence of two lysine K210 and K233 conserved in the PD-1 intracellular region on PD-1 ubiquitination by using co-immunoprecipitation and western blot technology in 293FT cells.

And e, detecting the important function of the F-box sequence on the FBXO38 mediated PD-1 ubiquitination by using a co-immunoprecipitation and western blot technology in 293FT cells.

f, detecting the FBXO38 mediated PD-1 ubiquitination type in 293FT cells by using co-immunoprecipitation and western blot technology. g, the effect of FBXO38 in promoting PD-1 degradation was examined in 293FT cells using western blot techniques.

h, the effect of two conserved lysines in the intracellular domain of PD-1 on the degradation of PD-1 was examined in 293FT cells using western blot techniques.

i.e.the role of the F-box sequence of FBXO38 in mediating PD-1 degradation was examined in 293FT cells using the western blot technique.

FIG. 4 Effect of Fbxo38 knock-out on T cell development

a, WT and FBXO38-CKO mouse CD8 ⁺ Protein levels of FBXO38 in T cells.

b, detecting CD4 in thymocytes of WT and CKO mice by using flow cytometry ^- CD8 ^- (DN),CD4 ⁺ CD8 ⁺ (DP),CD4 ⁺ CD8 ^- (CD4SP)and CD4 ^- CD8 ⁺ (CD 8 SP) proportion of cells.

c, detecting WT and CKO mouse thymus CD4 by using flow cytometry ^- CD8 ^- CD44 in cells ⁺ CD25 ^- (DN1),

CD44 ⁺ CD25 ⁺ (DN2),CD44 ^- CD25 ⁺ (DN 3) and CD44 ^- CD25 ^- (DN 4) proportion of cells.

d, flow cytometry for CD4 detection in spleen of WT and CKO mice ⁺ And CD8 ⁺ Proportion of T cells.

e, flow cytometry is used for detecting CD4 in lymph nodes of WT and CKO mice ⁺ And CD8 ⁺ Proportion of T cells.

f, detecting CD4 in spleen of WT and CKO mice by using flow cytometry ⁺ In T cells

(CD44 ^lo CD62L ^hi ),central memory(CD44 ^hi CD62L ^hi (ii) a CM) and effector/effector memory (CD 44) ^hi CD62L ^lo factor/EM).

g, detecting CD4 in lymph nodes of WT and CKO mice by using flow cytometry ⁺ In T cells

(CD44 ^lo CD62L ^hi ),central memory(CD44 ^hi CD62L ^hi (ii) a CM) and effector/effector memory (CD 44) ^hi CD62L ^lo ,

effect/EM).

h, flow cytometry is used for detecting WT and CKO mouse spleen CD8 ⁺ In T cells

i.e. byFlow cytometry for detecting CD8 in lymph nodes of WT and CKO mice ⁺ In T cells

effect/EM).

FIG. 5 Effect of Fbxo38 knock-out on T cell activation

a, detection of unactivated WT and CKO CD8 by flow cytometry ⁺ TCR and CD28 surface levels of T cells.

b, detecting WT and CKO CD8 by using flow cytometry ⁺ Expression level of CD44 after T cell activation in vitro.

c, detecting WT and CKO CD8 by flow cytometry ⁺ Expression level of LAG-3 following T cell activation in vitro.

d, detection of WT and CKO CD8 by flow cytometry ⁺ Levels of IFN-. Gamma.granzyme B and TNF-. Alpha.after in vitro activation of T cells.

FIG. 6 Effect of Fbxo38 knock-out on T cell proliferation and apoptosis

a, detecting WT and CKO CD8 by Celltracker staining and flow cytometry ⁺ Proliferation of T cells following in vitro activation.

b, detection of WT and CKO CD8 Using Annexin V and Propidium Iodide (PI) staining and flow cytometry ⁺ Apoptotic behaviour of T cells.

FIG. 7Fbxo38 knock-out on CD8 ⁺ Effect of T cell transcriptome

a, RNA-seq analysis WT and CKO CD8 ⁺ T cells in

And the level of gene transcription in the activated state. The transcription levels of surface molecules, functional molecules and important transcription factors associated with T cell function are shown.

FIG. 8Fbxo38 regulates expression level of PD-1

a, using stream minutiaeCellular technology for detection of WT and CKO CD8 ⁺ Expression level of PD-1 after in vitro activation of T cells.

b, detecting WT and CKO CD4 by flow cytometry ⁺ Expression level of PD-1 after in vitro activation of T cells.

And c, detecting the expression level of nTreg cell PD-1 in WT and CKO spleen by using a flow cytometry technology.

FIG. 9Fbxo38 regulates the antitumor immunity of T cells

a, the effect of FBXO38 knock-out on mouse tumor growth was studied using the B16F10 subcutaneous tumor model.

B, the B16F10 subcutaneous tumor model was used to study the effect of FBXO38 knockout on tumor bearing survival in mice.

c, detecting tumor-infiltrated CD8 in a B16F10 subcutaneous tumor model by using a flow cytometry technology ⁺ Expression level of CD44 in T cells.

d, detection of tumor-infiltrated CD8 in B16F10 subcutaneous tumor model by flow cytometry ⁺ Expression level of PD-1 in T cells.

e, detecting tumor-infiltrated CD8 in a B16F10 subcutaneous tumor model using flow cytometry ⁺ Expression levels of cytokines in T cells.

F, detecting tumor-infiltrated CD8 in a B16F10 subcutaneous tumor model by using flow cytometry ⁺ Expression level of Ki-67 in T cells.

g, CD8 of tumor infiltration in B16F10 subcutaneous tumor model ⁺ T cell, CD4 ⁺ T cell number and ratio analysis.

h, analysis of the number of Treg cells infiltrated by the tumor in the B16F10 subcutaneous tumor model.

i, detection of tumor-infiltrated CD4 in B16F10 subcutaneous tumor model by flow cytometry ⁺ Expression level of PD-1 in T cells.

j, detecting the expression level of PD-1 in tumor-infiltrating Treg cells in a B16F10 subcutaneous tumor model using flow cytometry.

FIG. 10Fbxo38 knock-out affects anti-tumor immunity of T cells

a, the effect of FBXO38 knockdown on mouse tumor growth was studied using the MC38 subcutaneous tumor model.

b, detecting the tumor infiltrated CD8 in the MC38 subcutaneous tumor model by using the flow cytometry technology ⁺ Expression level of PD-1 in T cells.

c, detecting tumor-infiltrated CD4 in the MC38 subcutaneous tumor model by using flow cytometry ⁺ Expression level of PD-1 in T cells.

d, detecting the expression level of PD-1 in tumor-infiltrated Treg cells in the MC38 subcutaneous tumor model by using a flow cytometry technology.

e, CD8 tumor infiltration in MC38 subcutaneous tumor model ⁺ T cell, CD4 ⁺ T cell number and ratio analysis.

f, analysis of the number of tumor-infiltrated Treg cells in the MC38 subcutaneous tumor model.

FIG. 11Fbxo38 knockdown did not affect activation of T cells

a, detecting the knocking-down efficiency of Fbxo38 by using a real-time fluorescent quantitative PCR technology.

b, detecting knocking-down efficiency of Fbxo38 by using western blot technique.

c, detecting the expression level of CD3 and CD28 on the cell surface after the Fbxo38 is knocked down by using a flow cytometry technology

d, detection of Fbxo38 knockdown by western blot technique followed by in vitro activation of CD8 ⁺ Alterations in T cell TCR signaling pathways.

e, detection of Fbxo38 knockdown followed by in vitro activation of CD8 by flow cytometry ⁺ Expression level of CD69 on the cell surface of T cells.

f, detecting in vitro activation of Fbxo38 knockdown for 24 hours of CD8 by flow cytometry ⁺ Expression level of IFN-gamma in T cell.

g, detecting the CD8 activated in vitro for 48 hours after the Fbxo38 knock-down by using the flow cytometry technology ⁺ Expression level of IFN-gamma in T cell.

FIG. 12Fbxo38 knockdown upregulated the level of PD-1 and affected CD8 ⁺ Tumor killing ability of T cells

a, detecting Fbxo38 knockdown by flow cytometry to stimulate CD8 in vitro ⁺ PD-1 levels on the surface of T cells.

And b, detecting the expression of the PD-L1 in the EL-4 cells by using a flow cytometry technology.

c, ELISA detection of CD8 after knockdown of Fbxo38 ⁺ In vitro killing of EL-4 cells by T cells.

d, flow assay of overexpression efficiency of Fbxo38 in mouse CTL.

e, depicted as flow-detecting the level of PD-1 after overexpression of Fbxo38 in mouse CTL.

f, which is a statistical graph showing the PD-1 levels after flow-detecting overexpression of Fbxo38 in mouse CTLs.

FIG. 13FBXO38 regulates CD8 endogenously ⁺ Anti-tumor capacity of T cells

a, shown schematically is an experimental approach for adoptive cellular immunotherapy in a B16F10 subcutaneous tumor model.

b, flow assay of reinfused CD8 in day 18 tumor-infiltrating lymph nodes (dLN) ⁺ T cells (GFP) ⁺ ) The ratio of (a) to (b).

c, flow assay of reinfused CD8 in day 18 non-tumor infiltrating lymph nodes (non-dLN) ⁺ T cells (GFP) ⁺ ) In the presence of a suitable solvent.

d, flow assay for reinfused CD8 in tumor infiltrating lymph nodes (dLN) on day 18 ⁺ T cells (GFP) ⁺ ) The level of PD-1 of (a).

e, flow assay for reinfused CD8 in day 18 tumor infiltrating lymph nodes (dLN) ⁺ T cells (GFP) ⁺ ) The level of Ki-67 of (a).

f, growth curves of mouse tumors after adoptive immunotherapy followed by Fbxo38knock down.

g, survival curves of mice after adoptive immunotherapy following Fbxo38knock down.

h, growth curves of mouse tumors after Fbxo38knock down followed by adoptive immunotherapy combined with PD-1 antibody treatment.

i, survival curves of mice after Fbxo38knock down followed by adoptive immunotherapy combined with PD-1 antibody treatment. In all figures, error bars stands for mean +/-SEM.

ns represents no significant difference, P <0.05, P <0.01, P <0.001.

Detailed Description

To date, studies on regulation of PD-1 expression have focused on the transcriptional level, and no studies on the post-transcriptional level of PD-1 have been published. At present, the regulation of the PD-1 protein at the posttranslational level is still blank. In the research, the invention discovers that PD-1 can be degraded by the ubiquitination of PD-1, so that the functions of activation, proliferation, cytokine secretion and the like of T cells are enhanced, the killing function and the proliferation capacity of T cells infiltrated by tumors are improved, the tumor cells are killed by an immune system, FBXO38 is a target point capable of promoting the ubiquitination of PD-1, and the degradation of PD-1 can be remarkably promoted by promoting the expression of FBXO 38.

Ubiquitin is a highly conserved polypeptide consisting of 76 amino acids in eukaryotic cells, and can be covalently crosslinked to lysine of target protein through the action of three enzymes (E1: ub-activating enzyme; E2: ub conditioning enzyme; E3: ub protein ligand) to form ubiquitination modification on the target protein, thereby affecting the signal pathway of the target protein or degrading the target protein through proteasome. Ubiquitination regulates many important physiological processes within the cell, such as controlling the cycle, down-regulating membrane proteins, participating in signal transduction, and the like. The target protein lysine can be connected with one ubiquitin to form mono-ubiquitination modification, and can also be connected with a plurality of ubiquitinations to form polyubiquitination modification. In polyubiquitination, polyubiquitination mediated by lysine 48 on ubiquitin generally degrades the target protein through the proteasome pathway, and polyubiquitination mediated by lysine 63 on ubiquitin plays a role in many signal transduction pathways.

The PD-1 ubiquitination refers to that ubiquitin is connected to lysine of PD-1 to carry out ubiquitination modification, thereby affecting a signal path of PD-1 or degrading PD-1 through a proteasome.

PD-1 ubiquitination agonists

Refers to a molecule having a promoting effect on PD-1 ubiquitination.

Further, the PD-1 ubiquitination agonist can promote the degradation of PD-1.

Further, the PD-1 ubiquitination agonist is an FBXO38 agonist.

Further, the FBXO38 agonist is a molecule having a promoting effect on FBXO 38.

Enhancing FBXO38 activity refers to increasing FBXO38 activity. Preferably, FBXO38 activity is increased by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% as compared to the activity prior to enhancement.

Promoting FBXO38 gene transcription or expression means: accelerating the transcription of FBXO38 gene, or increasing the transcription activity of FBXO38 gene, or accelerating the expression of FBXO38 gene, or increasing the expression activity of FBXO38 gene.

The skilled person can use routine methods to modulate the gene transcription or expression of FBXO 38.

Preferably, FBXO38 gene transcription or expression is increased by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, most preferably by at least 90% compared to the wild type.

PD-1 ubiquitination agonist preparation medicine

PD-1 ubiquitination agonist is used as main active ingredient or one of the main active ingredients to prepare the medicine. Generally, the medicament may comprise one or more pharmaceutically acceptable carriers or excipients in addition to the active ingredient, according to the requirements of different dosage forms.

By "pharmaceutically acceptable" it is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with, i.e., capable of being blended with, the PD-1 ubiquitinated agonist without substantially reducing the effectiveness of the pharmaceutical composition under normal circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as glycerol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

Combination therapeutic drug combinations and methods of administration

The combination therapy drug combination may be in any one of the following forms:

one) PD-1 ubiquitination excitant and other antitumor drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can also be the same or different. When in use, several medicines can be used simultaneously or sequentially. When administered sequentially, the other drugs should be administered to the body during the period that the first drug is still effective in the body.

Secondly), PD-1 ubiquitination excitomotor and other anti-tumor drugs are prepared into compound preparations. When the PD-1 ubiquitination agonist and the other antitumor agent are administered by the same administration route and simultaneously administered, the two may be formulated into a compound preparation.

The antibody is usually administered by intravenous injection, intravenous drip or arterial infusion. The usage and the dosage can refer to the prior art.

The small molecule compounds are administered by conventional methods, either gastrointestinal or parenteral. The siRNA, shRNA and antibody are generally administered parenterally. Can be administered locally or systemically.

An effective amount of the PD-1 ubiquitinated agonist and an effective amount of the other tumor treatment drug may be administered simultaneously or sequentially. When in use, the effective dose of the PD-1 ubiquitination stimulant and the effective dose of other tumor treatment medicines can be used simultaneously, and the effective dose of the PD-1 ubiquitination stimulant and the effective dose of the other tumor treatment medicines can be used successively. When administered sequentially, the other drug should be administered to the organism during the period that the first-administered drug is still effective for the organism.

Chemotherapeutic agents include alkylating agents (e.g., nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, and glyphosate), antimetabolites (e.g., nucleotide analogs such as deoxyfluoroguanosine, doxycycline, fluorouracil, mercaptopurine, and methotrexate), antitumor antibiotics (e.g., antibiotics such as actinomycin D, doxorubicin, and daunorubicin), antitumor animal and plant components (e.g., vinorelbine, paclitaxel, cephalotaxine, irinotecan, taxotere, and vinblastine), antitumor hormonal agents (e.g., atamestane, anastrozole, aminoglutethimide, letrozole, formestane, and tamoxifen), and conventional chemotherapeutic agents such as cisplatin, dacarbazine, oxaliplatin, lespedine, carboplatin oxcarbazone, mitoxantrone, and procarbazine.

Targeted drugs include EGFR blockers such as Gefitinib (Gefitinib, iressa and Iressa) and Erlotinib (Erlotinib, tarceva), monoclonal antibodies to specific cell markers such as Cetuximab (Cetuximab, erbitux) and anti-HER-2 mabs (Herceptin, trastuzumab, herceptin), tyrosine kinase receptor inhibitors such as Crizotinib (Crizotinib, xalkori), anti-tumor angiogenesis drugs such as Bevacizumab, endostatin and Bevacizumab, etc., bcr-Abl tyrosine kinase inhibitors such as Imatinib and Dasatinib, anti-CD 20 mabs such as Rituximab, IGFR-1 kinase inhibitors such as NVP-AEW541, mTOR kinase inhibitors such as CCI-779, ubiquitin-proteasome inhibitors such as Bortezomib, etc.

Other tumor treatment modalities may be selected from one or more of surgical resection, radio frequency ablation, argon helium superconducting surgical treatment, laser ablation therapy, high intensity focused ultrasound, and radiation therapy including X-ray, R-ray, 3D-CRT, and IMRT.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any number between the two endpoints are optional unless otherwise specified in the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ conventional techniques in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, gene mutation techniques, and related fields.

Example 1

1.1 Experimental materials

1.1.1 buffer formulation

Lysine Buffer for Co-IP (used in Co-immunoprecipitation assays in 293FT cells and Jurkat cells): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na ₃ VO4,20mM NaF,10mM Iodoacetamide,0.5％NP40,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Lysine Buffer for inactivation (activated CD8 for mouse and human use) ⁺ T cell lysis, detection of ubiquitination modification of PD-1): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na ₃ VO4,20mM NaF,10mM Iodoacetamide,1％NP40,0.1％SDS,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Lysine Buffer for ubiquitin 1 (for Ubiquitination assay in 293FT cells, comprising 1% SDS): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na ₃ VO4,20mM NaF,10mM Iodoacetamide,1％NP40,1％SDS,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Lysine Buffer for ubiquitin 2 (for Ubiquitination assay in 293FT cells, without SDS): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na ₃ VO4,20mM NaF,10mM Iodoacetamide,1％NP40,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Tris buffer: 50mM Tris,200mM NaCl, pH8.0;

PBS buffer: 8g NaCl,0.2g KCl,3.58g NaH ₂ PO ₄ ·12H ₂ O,0.27g K ₂ HPO ₄ Fixing the volume to 1L, adjusting the pH value to 7.4, and sterilizing at high temperature and pressure;

protein electrophoresis buffer (Tris-glycine): 25mM Tris,250mM glycine, 0.1% SDS;

protein Transfer Buffer (Transfer Buffer): 39mM glycine, 48mM Tris,0.037% SDS;

striping Buffer:1.5% glycine, 0.1% SDS,1% Tween 20, adjusting pH to 2.2;

TBST buffer: 150mM NaCl,50mM Tris,0.1% Tween 20, adjusted to pH 7.4, was used to formulate primary, secondary and blocking solutions for immunoblotting.

Immunoblot blocking solution BSA in TBST Buffer 10%;

magnetic bead sorting buffer (mouse/human CD 8) ⁺ T cell): 2% of FBS,2mM EDTAAdjusting pH to 7.2 in PBS, filtering with 0.2 μ M filter membrane for sterilization;

surface staining buffer: 0.1% BSA in PBS Buffer;

intracellular staining buffer: 0.5% BSA in PBS buffer,0.1% Triton X-100;

1.1.2 chemical reagents

1.1.3 kits, cytokines, genetic tools and enzymes

1.1.4 cell lines

Jurkat cell line: peripheral blood from a 14 year old boy with one T cell leukemia in the 70's of the 20 th century was isolated as suspension cells, a common cell line for studying T cell signaling, and could be activated by either CD3 antibody or PMA + Ionomycin. In the paper, the Fbxo38 gene is mainly overexpressed or knocked down in the Jurkat cell line, so that the expression level and ubiquitination modification of PD-1 are detected.

HEK-293FT cell line: 293F cells are cell strains derived from human embryonic kidney cells, and are transfected with adenovirus type 5 DNA fragments, and the cells can activate promoters of certain viruses, promote protein expression and have a high growth rate. 293FT cells were transfected with SV40 large T antigen on the basis of 293F cells and allowed very high level expression from vectors containing the SV40 origin. The 293FT cell line grows rapidly, is very easy to transfect, is a cell line commonly used in laboratories and is used for over-expressing genes or carrying out lentivirus packaging.

B16F10 melanoma cell lines: melanoma was isolated from skin tissue of C57BL/6 mice and was spindle-shaped, epithelial in shape. The cell is an adherent cell, is easy to transfect and can be stably passaged. The cell is mainly used for mouse melanoma tumor model construction and researches on cell proliferation, apoptosis, signal transduction and the like

B16F10-OVA cell line: OVA antigen is overexpressed in the B16F10 cell line and presented by the cells to the surface, and OVA antigen peptide presented as an antigen presenting cell stimulates activation of OT-1-derived T lymphocytes. The cell line can successfully activate OT-1 derived T lymphocytes for use in the ACT model.

EL4 cell line: mice with C57 background lymphoma derived from EL4 cell line, cultured in 1640 medium, appeared in a semi-suspended state with slight adherence. Through PD-L1 detection, the EL4 cell highly expresses PD-L1 protein and can be used for CD8 ⁺ Killing experiment of T cells.

1.1.5 introduction to the plasmid

pHAGE-fEF1a-IRES-ZsGreen/mCherry (pHAGE vector): protein overexpression and lentiviral packaging vectors, the promoter is fEF1a, with an IRES sequence. IRES is a special DNA sequence, can independently initiate the translation process in the middle of mRNA, and is connected with fluorescent protein ZsGreen/mCherry behind IRES, which can be used as the indicator of successful cell transfection. Meanwhile, the vector has LTRs sequence, can be used for packaging lentivirus and can be used for transfecting difficultly transfected cell lines, such as Jurtat cell line and primary CD8 of mice ⁺ T cells.

pHAGE-fEF1a-HA-PD-1-IRES-mCherry: the Pdcd1 sequence with HA tag at the N terminal is inserted into pHAGE vector and is positioned in front of IRES-mCherry. After transfection of cells, HA-tagged PD-1 molecules could be expressed intracellularly, with mCherry indicating a positive cell.

pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen: firstly, the method is carried out on the basis of a pHAGE vector

pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid. 3 pairs of complementary fragments:

complementary strand 1A (SEQ ID NO. 2):

5’-CAGGTGTCGTGAAGCATGGAACAGAAATTGATAAGTGAGGAAGATTTAG-3’；

complementary strand 1B (SEQ ID NO. 3):

5’-TTGCTCTAAATCTTCCTCACTTATCAATTTCTGTTCCATGCTTCACGACACCTG-3’；

complementary strand 2A (SEQ ID NO. 4):

5’-AGCAAAAGCTCATTTCTGAAGAGGACTTGGAACAGAAATTGATAAGTGAGGAAGATT-3’

complementary strand 2B ((SEQ ID No. 5):

5’-CCGCTAAATCTTCCTCACTTATCAATTTCTGTTCCAAGTCCTCTTCAGAAATGAGCTT-3’；

complementary strand 3A (SEQ ID NO. 6):

5' TAGCGGCCGCAGCAATGCATGCAGGCGCGCGCCAGAAACGCGTGGGCACCGGTCTGCAGC-; complementary strand 3B (SEQ ID NO. 7):

5’-GCTGCAGACCGGTGCCCACGCGTTTCTGGCGCGCCTGCATGCATTGCTGCGG-3’。

putting the three tubes into the tubes respectively, then putting the three tubes into boiling water, and naturally cooling the tubes to room temperature along with the boiling water. The DNA fragments were each gel-backed. Then the three DNA fragments are connected together by T4 ligase, and the connection product is glued back to obtain a 3Myc fragment, wherein the fragment is about 160 bp. Cutting the pHAGE vector with Not I incision enzyme and glue back, finally connecting the cut pHAGE-fEF1a-IRES-ZsGreen vector and the 3Myc fragment with a GBclonart seamless cloning kit to prepare pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid. The cDNA is used as a template, and the cDNA is obtained,

using Fbxo38 upstream primer (SEQ ID NO. 8):

5 'TGAGGAATTTAGCGATGGGCCCACGAAA GAAAAGTG 3' and

fbxo38 downstream primer (SEQ ID NO. 9):

5’-TGCATGCATT GCTGCTTAAA TGTAGTCATC TTCAACTG-3’；

fbxo38 is amplified and the product is recovered by gel. The pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid was cut with the endonuclease Not I and ligated using GBclonart seamless cloning kit. The plasmid pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen was prepared. After transfection of cells, FBXO38 molecules with Myc tags can be expressed in cells, zsGreen indicating positive cells.

pHAGE-fEF1a-V5-Ub-IRES-ZsGreen: the Ub sequence with a V5 tag at the N-terminal is inserted into the pHAGE vector and is positioned in front of IRES-ZsGreen, and the Ub WT, the UbK48R (the lysine at the 48 th position of the Ub is changed into R), the UbK63R (the lysine at the 63 th position of the Ub is changed into R) and the UbKtoR (the lysine at the 48 th position and the 63 th position of the Ub are changed into R) are included, so that the Ub sequence is used for detecting the ubiquitination modification of PD-1 protein in 293FT cells.

MSCV-3Myc-FBXO38-IRES-ZsGreen: the following primers were used:

fbxo38 upstream primer (SEQ ID NO. 10):

5’-GCGCCGGAATTAGATCTCATGGAACAGAAATTGATAAGTGAGGAAG-3’

fbxo38 downstream primer (SEQ ID NO. 11):

5’-GGGCGGAATTCGTTAACCTTAAATGTAGTCATCTTCAAC-3’

the 3Myc-FBXO38 gene was amplified from pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen plasmid. Simultaneously the MSCV vector was cut with restriction enzyme XhoI and glued back. And ligated using GBclonart seamless cloning kit. The MSCV-3Myc-FBXO38-IRES-ZsGreen plasmid is prepared. After transfection of cells, FBXO38 molecules with Myc tags can be expressed in cells, zsGreen indicating positive cells.

pHAGE-fEF1a-3Myc-FBXO47-IRES-ZsGreen: the sequence of Fbxo47 with 3 consecutive Myc tags at the N-terminus, located before IRES-ZsGreen, was inserted into the pHAGE vector. After transfection of cells, FBXO47 molecules with Myc tags can be expressed in cells, zsGreen indicating positive cells.

Plko.1g vector: for generating gene-specific shRNAs, knocking down specific genes in cells. The vector can express GFP protein, is used for indicating positive cells, and can be used for screening. In the subject, the vector was used to generate CD8 in Jurkat and mice ⁺ Knockdown of the Fbxo38 gene in T cells.

psPAX2 and pmd2.G: both of the second generation lentiviral packaging plasmids were used with the pHAGE vector as a three plasmid system to generate lentiviruses. The main elements of psPAX2 include the promoter followed by GAG, POL, TAT, REV sequences, and pMD2.G includes mainly the promoter followed by ENV sequences. In the present invention, psPAX2 and pMD2.G can be lentivirally packaged by transfecting 293FT cell lines with pHAGE vector and PLKO.1G vector.

Introduction to 1.1.6 antibodies

1.1.7 introduction to Experimental animals

Fbxo38 gene conditional knockout mice: fbxo38 ^flox/flox Mice were purchased from Kayki Biotech, inc. of North China (Beijing CasGene Biotech), and designated as generation F0. After the F0 mice grow for 8 weeks, the mice are combined with CD4 ^cre The Fbxo38 of the FBXO38 protein which is specifically knocked out in CD4 and CD8 cells can be obtained by mating the mice for multiple generations ^CKO A mouse.

OT-1 mice: c57BL/6-Tg (Tcr alpha, tcr beta) 1100Mjb/J, tcr alpha-V2 and Tcr beta-V5 genes are inserted into a mouse transgenic group, so that the transgenic T cell receptor of the mouse can only recognize Ovalbumin 257-264 (OVA) _257-264 ) Peptide fragment of residue at position for studying CD8 ⁺ T cell response to antigen. Like most TCR transgenic mice, these mice are somewhat immunodeficient. The mice were on C57BL/6 background and purchased from

mice。

C57BL/6 mice: purchased directly from Shanghai SLAC, SPF grade, 8-10 weeks for animal testing.

All mice used in the present invention were raised in an SPF environment, and both Fbxo38 conditional knockout and OT1 mice were PCR-identified prior to use. In tumor experiments, the age difference between the mice in the control group and the mice in the experimental group is within 2 weeks, and the sexes are consistent.

1.2 Experimental methods

1.2.1 cell assay

1.2.1.1 transfection of 293FT cells with liposomes

1, 1-2 days before cell transfection, cells were passaged according to the ratio of 1. Digesting 293FT cells (with the density of 90-100%) for 1 minute by using pancreatin, removing the pancreatin, then quickly adding a DMEM culture medium, resuspending, blowing, beating, uniformly mixing, passaging to a new 10cm culture dish, blowing and beating by using a pipetting gun for several times, and thoroughly and uniformly mixing to avoid cell agglomeration and crowding.

2, 4h before cell transfection, the solution is changed. When the cell density reached about 50%, the old medium was replaced with new DMEM medium. 6ml of old medium can be aspirated by a pipette, and 6ml of 37 ℃ preheated fresh DMEM medium is slowly added, and the culture is continued for 4 hours.

And 3, transfection. According to different experimental purposes, different plasmid transfection amounts are selected, and the amount of the Lipofectamine2000 transfection reagent is correspondingly adjusted.

In general, the amount of Lipofectamine2000 (μ l)/mass of plasmid (μ g) is 2. The specific transfection steps are as follows: adding 250 μ l OPTI-MEM culture medium into 2 Ep tubes of 1.5mL, respectively, adding 10 μ g plasmid into one tube, adding 20 μ l Lipofectamine2000 transfection reagent into the other tube, respectively mixing, and standing for 5min; then, mixing the two tubes of solution under sterile condition, and standing for 20min at room temperature; then, the mixture was added dropwise to the cell culture medium, followed by gently mixing, and the mixture was placed in a 37 ℃ cell incubator to continue the culture. For the PD-1 ubiquitination experiments, the plasmid transfection amount in 10cm plates was: 15 mu g of Myc-Fbxo38, 3.5 mu g of HA-Pd1, 3 mu g of V5-Ub and 2000 mu l of Lipofectamine; for the PD-1 degradation experiments, the plasmid transfection amount in 6cm dishes was: myc-Fbxo 38. Mu.g, HA-Pd 1. Mu.g, lipofectamine 2000. Mu.l.

After 4,24-72 h, the cells successfully transfected express fluorescent protein by observing the positive rate under a fluorescent microscope.

The experimental method is suitable for over-expressing genes in 293FT cells or carrying out lentivirus packaging.

1.2.1.2 Lentiviral systemic infection of Jurkat cell line

Lentiviral packaging was performed as described in 1.2.1.1, and the packaging plasmid and the gene of interest plasmid were transfected into 293FT cell line using Lipofectamine 2000. The mass of the plasmid is typically: 10. Mu.g of the plasmid of interest + 7.5. Mu.g of psPAX2+ 3. Mu.g of pMD2.G.

2, after transfection for 24h, the positive rate should reach more than 80% when observed under a fluorescence microscope. If the molecular weight of the protein of interest is large, the transfection efficiency may be low.

3, after 48-60h of transfection, virus supernatants were collected. The viral supernatant was carefully placed in a 15ml centrifuge tube, centrifuged at 6000rpm/min for 5 minutes, filtered through a 0.45 μm syringe filter to obtain a lentiviral supernatant, and the lentiviral supernatant was then used directly to infect Jurkat cells. Generally, 10mL of virus solution can be added to 1-2X 10 ⁶ Jurkat T cell, for safety, the supernatant was placed in a culture flask to infect the cells. After 72 hours of infection, significant fluorescence was seen. If the target gene is very large, for example, 3500bp gene such as Fbxo38, the positive rate is slightly low, generally 30%; in the case of a DNA sequence of only 20bp such as shRNA, the positive rate is generally 100%.

4, the fluid is changed after 72-96h of infection. Centrifuging the virus supernatant according to 500g, suspending cells by using fresh 1640 culture medium, continuously culturing for 72-96h to obtain relatively stable positive cells, and sorting by using a flow cytometer.

1.2.1.3 Lentiviral systems infecting mouse Primary cell lines

(1) Virus package

Lentiviral packaging was performed as described above, using Lipofectamine2000 to transfect 293FT cell line, the mass of plasmid: 10 μ g PLKO.1G +7.5 μ g psPAX2+3 μ g pMD2.G. Each shRNA was transfected into three 10cm dishes for subsequent virus concentration.

2, collect the virus supernatant as described above, filter it with 0.45 μm syringe filter, put all 3 dishes of virus supernatant into a 38ml ultracentrifuge tube, centrifuge it at 27000rpm/min for 4 degrees 2h. After centrifugation, the supernatant was quickly decanted, 500. Mu.l of FBS-free 1640 medium was added along the walls, the virus was resuspended, placed at 4 ℃ and used overnight.

(2)CD8 ⁺ T cell culture and infection

1, sorting with magnetic beads

CD8 ⁺ T cells, cultured in the following media: RPMI-1640+10% of FBS +1% PS + IL-7 (10 ng/ml) + IL-15 (100 ng/ml) +0.05mM 2-mercaptoethanol, 200 ten thousand cells were cultured per well, and it was observed that the cell volume was increased and a small cell mass appeared after culturing for 48-72 hours. One day prior to infection, rereoNectin (1 mg/ml, T100B, takara) diluted in PBS was plated in 24-well plates (cat # 351147, BD), typically 400. Mu.l/well, overnight at 4 ℃.

2, counting cells, and then culturing the cultured CD8 ⁺ The T cells were centrifuged, and 200 ten thousand CD8 cells were collected by centrifugation at 200 ten thousand/15 ml in a centrifuge tube, and after removing the supernatant, 500ul of the concentrated virus supernatant was used to separately collect 200 ten thousand CD8 cells ⁺ T cells were then added gently to the RereoNectin-plated wells washed once with PBS, and centrifuged at 37 ℃ and 2000g for 60min.

3, after centrifugation, the cells were plated onto the bottom of 24-well plates, the supernatant was removed directly, and incubation was continued for 3 days with fresh medium containing IL-7 and IL-15.

And 4, detecting the positive rate by using a flow cytometer or a fluorescence microscope. Positive cells may be sorted for GFP expression for subsequent function or the cells may be expanded for use in the ACT model.

During the whole infection process, cells were in the Memery like state when cultured only in the medium containing IL-7 and IL-15, but did not activate TCR signal, so these cells did not express PD-1 protein.

1.2.1.4 retroviral System overexpression of FBXO38 in mouse Primary cell lines

Use of retroviral MSCV in mouse CD8 ⁺ FBXO38 protein is overexpressed in T cells.

(1) Virus package

1, retroviral packaging as described in 1.2.1.1, using Lipofectamine2000 to transfect MSCV-3Myc-FBXO38-IRES-ZsGreen plasmid into plat E cells.

2, after 48 hours of transfection, the virus supernatant was collected, filtered through a 0.45 μm syringe filter, and then concentrated 50-70-fold at room temperature at 3000g centrifugation speed using an ultrafiltration tube (Millipore, 100 KD).

3, spleens of OT1 mice were removed, ground, red blood cells lysed, and activated for 24 hours in 1640 medium containing 10nM OVA and 10ng/ml IL-2. Activated cells were resuspended in RetroNectin (1 mg/ml, T100B, takara) pre-treated 24-well plates using 1ml of virus medium (including 500ul of concentrated virus, 500ul of fresh complete RPMI-1640 medium and 10. Mu.g/ml polybree). Subsequently, the cells were centrifuged at 2500rpm at 37 ℃ for 2 hours, and then cultured in an incubator for 10 hours. Then transfected again as above. After two transfections, cells were resuspended in fresh complete RPMI-1640 medium for culture. GFP positive cells are those that overexpress FBXO 38. In the above process, there was always 10ng/ml IL-2 in the medium.

1.2.2 animal experiments

1.2.2.1 isolation of CD8+ cells in mouse spleen

1, taking Fbxo38 for about 8-10 weeks ^CKO Or C57BL6 mice, cervical dislocation lethal;

sterilizing with 2,70% ethanol, taking out spleen, placing in PBS, mashing whole spleen with forceps, grinding, and sieving with 40 μm nylon filter screen to obtain single cell suspension;

3,500g for 5min, and resuspended to 10 with MACS buffer ⁸ (iv)/mL, transferred to a 5mL flow tube;

5, 1mL of the cells were added with 15. Mu.L of Biotin-labeled negative selection antibody Cocktail (Stem Cell, mouse CD 8) ⁺ T Cell Isolation Kit, 19852), incubation at room temperature for 15 minutes;

6, adding 30 mu L of Streptavidin cross-linked magnetic beads, and continuously incubating for 5 minutes at room temperature;

7, adding MACS buffer to 3mL volume, then inserting a flow tube into a magnetic pole, and standing for 2 minutes at room temperature;

8, turning over the magnetic pole, pouring the liquid into a new 15mL centrifuge tube, and centrifuging at 400g and 4 ℃ for 10min;

9,PBS or RPMI-1640 medium, counting, and screening the cells to obtain CD4 ⁺ Or CD8 ⁺ A T cell;

10, taking a small part of cells, and after staining with anti-CD4 or anti-CD8, detecting the purity of the cells by flow staining, wherein the purity is generally more than 90%.

1.2.2.2anti-CD3/CD28 antibody-activated mouse CD8+ cells

One day in advance, the antibody was diluted with PBS PH =9.0 to a final concentration of anti-CD3 (2 μ g/ml) + anti-CD28 (2 μ g/ml). In a 48-well plate, 140. Mu.l of PBS is typically added.

Isolation of Primary CD8 from mice ⁺ T cells were counted and resuspended to 4X 10 with RPMI 1640 medium containing 10% FBS +10ng/ml IL-2 ⁵ mL, added to 48 well plates, 40 million cells per well.

And (3) collecting cells between 3,24 and 96 hours, and carrying out surface staining to detect PD-1 expression or internal staining to detect cytokine secretion.

And 4, surface staining and detecting the expression of cell surface molecules. After harvesting the cells, the cells were centrifuged at 400g for 5 minutes at room temperature to remove the supernatant, and 500. Mu.l of 4 ℃ precooled PBS was added to the supernatant, followed by centrifugation to remove the supernatant again. Thereafter, the cells were resuspended in PBS +0.1% BSA + antibody staining solution and left at 4 ℃ in the dark for 45 minutes. After that, 500. Mu.l of PBS was added, and the mixture was centrifuged at 400g 4 ℃ for 5 minutes to remove the supernatant, and then 500. Mu.l of PBS was added to resuspend the cells for flow assay.

And 5, intracellular staining and detecting cytokine secretion. After harvesting the cells, surface staining is usually performed, for example, by labeling the cell surface with anti-CD8, as described above. After washing once with PBS, 300. Mu.L of 4% PFA was added, fixed at room temperature for 10 minutes, and then centrifuged at 1500g for 5 minutes to remove the supernatant; adding 1ml of PBS, centrifuging at 1500g, and washing once; then BSA +0.1% after adding PBS +0.5% Triton X-100+ antibody (e.g., IFN-. Gamma., TNF-. Alpha., granzyme B), staining at 4 degrees for 2h or overnight; adding 500 mu l PBS, centrifuging at 1500g, and removing supernatant; add 500. Mu.l PBS to resuspend the cells and perform flow assay.

And 6, detecting cell proliferation. In stimulating CD8 ⁺ Prior to the cells, 0.5 μm viable cell dye CellTracker was used ^TM Deep Red fluorescent dye (C34565, thermo Fisher Scientific) was incubated at 37 ℃ for 20 minutes, then washed three times with PBS, washed off the dye and stimulated. At different timesCells were harvested and proliferation was detected by flow cytometry.

And 7, detecting apoptosis. CD8 ⁺ After the cells, the cells were harvested at different times and the apoptosis was detected with an apoptosis kit (eBioscience).

1.2.2.3 Induction of CTL cells in OT1 mice

1, killing the mouse by dislocation of cervical vertebrae, sterilizing with 70% ethanol, and taking out the spleen.

2, 5mL of PBS was added to a 6cm dish, and the cell strainer was placed in the dish. The spleen was shredded with forceps, placed on a filter screen, and ground with a syringe plunger until all cells diffused through the screen into PBS.

And 3, adding the obtained cell suspension into a 50mL centrifuge tube, adding 45mL erythrocyte lysate, reversing, uniformly mixing, and standing for 2-3min. Centrifuge at 500g for 5min and discard the supernatant.

4, resuspend with 50mL PBS, filter with cell strainer (optional), centrifuge at 500g for 5min, discard supernatant.

5, resuspend the cells in 30mL1640 medium, add 30. Mu.L of 10. Mu.g/mL IL-2 (final concentration 10 ng/mL), 3uL of 100. Mu.M OVA _257-264 (final concentration 10 nM), mixing, adding into medium-sized culture flask, and culturing in cell culture box.

6, the medium turned yellow after typically three days, then changed fluids every day, passaged according to the ratio of 1. Meanwhile, cells can be taken every day for surface staining, and the expression level of PD-1 can be detected.

Killing assay for 1.2.2.4CD8+ cells

1,CTL induction. CTL-induced generation from the spleen of OT1 mice was used as described in 1.2.2.3, and the cell status was generally tested with CTL cells from day five to day six, at which time the cell status was good.

2, target cells EL-4 cells were treated with 10nM OVA _257-264 Incubation at 37 ℃ for 1 hour; effector CTL cells and target cells were washed twice with a killing buffer (phenol free-RPMI,2% FBS) and resuspended at a concentration of 1million/mL and 0.1million/mL, respectively. Adding 100 mu L of target cells into a U-shaped bottom 96-well plate every empty period; CTL cells and target cells according to fixed EffectThe ratio (10. Control wells were set according to kit requirements.

1.2.2.5B16F10 and MC38 tumor models

1,B16F10 and MC38 cells. The cells were digested with pancreatin, washed three times with PBS, filtered through a 40 μm filter to give a single cell suspension, and the cell density was adjusted to 3.2 millions/ml. When B16F10 cells are cultured, attention is paid to timely replacing the culture medium, and the condition that the cell state is influenced by overlarge cell density is avoided. In the course of digestion with pancreatin, the digestion time for B16F10 was slightly longer than 293FT, approximately 1.5 minutes, and the digestion time for MC38 cells was relatively short, approximately 45 seconds. Before the inoculation of the mice, the cell density of B16F10 and MC38 is controlled to be about 80%, and the cell state is the best at this time, and the tumor formation rate is the highest.

2, b16f10 and MC38 cell transplantation: the tumor cell transplantation experiment is carried out by using mice of 8-10 weeks old, and the concrete operations are as follows: 100 mu L of anesthetized mice were intraperitoneally injected with 3% sodium pentobarbital, and 0.4million B16F10 or 0.5million MC38 single cell suspension was injected into the epidermis of the mice slightly below the back and near the abdomen in a subcutaneous injection volume of 125 mu L. In C57BL/6 background mice, tumor formation was visually observed after 6-8 days after subcutaneous injection of tumor cells.

Tumor measurements and sacrifice. Approximately 8-10 days, tumor size was recorded with a vernier caliper and measured for the long diameter (mm) and wide diameter (mm) of the tumor, expressed as the long diameter multiplied by the wide diameter. Generally, tumors reach 10mm × 10mm in about 13 days and 15mm × 15mm in about 18-20 days. And (3) euthanizing a mouse with the tumor length or the tumor width being larger than 15mm, or a mouse with the tumor ulceration being larger than 10mm, or a mouse with the affected part of the tumor having skin ulceration in the experimental process and the feeding process until the secondary infection occurs.

And 4, carrying out phenotypic analysis on tumor infiltrated lymphocytes. Generally on days 14-16, when the tumor size was around 12mm X12mm, the mice were sacrificed by dislocation of the cervical vertebrae, sterilized with 70% ethanol, the spleen was removed and cut into small pieces (3mm X3mm) and resuspended with 10ml of digestive juice (5% fbs,2mm glutamine,50 μ M β -mercaptoethanol,1.6mg/ml collagene IV,1.6mg/ml collagene I,0.02% dnase I), placed in a 37 degree rotating bed and rotated for 1.5 hours, it was seen that most of the tumor tissue was digested into a cell suspension, leaving only a small amount of fat or decapitated single cell tissue, followed by filtration through a 70 μ M filter to obtain a suspension, followed by density gradient centrifugation with 40% and 70% percoll, and the tumor-infiltrated lymphocytes were enriched at the interface between 40% and 70% percoll. Carefully sucking out lymphocytes by using a pipette or a pipette gun, washing twice with PBS to obtain enriched tumor-infiltrated lymphocytes, and directly carrying out surface staining to detect molecular expressions such as CD8, CD44, PD-1 and the like. If cytokine secretion function is to be detected, it is stimulated with 1640 medium containing 1. Mu.M Ionomycin +50ng PMA + 5. Mu.g/ml BFA at 37 degrees for 4 hours, followed by intracellular staining.

1.2.2.6 Adoptive Cell Therapy (ACT) model

1, 0.4 milliion B16F10-OVA cells were inoculated subcutaneously into C57 mice according to the method described in 1.2.2.5, with at least 15 mice per experimental group.

2, following the procedure of 1.2.1.3 lentivirus systemic infection of mouse primary cell lines, knockdown of the Fbxo38 gene in OT1 background CD8 cells, sorting of GFP positive cells and continued culture with medium containing IL-7 and IL-15 for three-four days, generally cells that were three-fold expanded.

3, B16F10-OVA cells were injected four days after injection, 1.25 millions/Fbxo 38 knockdown cells were injected in the tail vein, and PBS was injected in the control group.

4, counting the tumor sizes of the control group and the experimental group at about 8-10 days, and counting once every two days.

5, if it is desired to analyse the phenotype of the transferred OT1CD8T cells, the mice are sacrificed around day 18; if anti-PD-1 in combination with ACT treatment is required, the PD-1 antibody is injected around day 10, the clone number of the PD-1 antibody is J43, 100. Mu.g/mouse, once every three days, for a total of four injections.

1.2.2.7RNA-seq, library construction and Biometrics analysis

1,RNA-seq sample preparation. From three pairs of female Fbxo38 ^CKO And spleen of corresponding littermate wild-type mice

CD8 ⁺ T cells, one fraction lysed directly with TRIZOL and the other fraction stimulated in 48-well plates as described under 1.2.2.2, with antibody concentration anti-CD3 (2. Mu.g/ml) + anti-CD28 (2. Mu.g/ml) for 96 hours, were also lysed with TRIZOL after cell harvest. Total RNA was extracted and the quality of RNA was checked by an Agilent Bioanalyzer 2100 and further purified by two kits, RNAclean XP Kit (Cat A63987, beckman Coulter) and RNase-Free DNase Set (Cat #79254, QIAGEN).

And 2, constructing a library. By using

Construction of a library with the RNA Sample Preparation Kit (Illumina, USA) Kit, and further by

2.0Fluorometer (Life Technologies) and validated by Agilent 2100bioanalyzer (Agilent Technologies) purification, enrichment and quantification of the library.

3, sequencing. Cluster was generated using cBot and sequencing was performed using Illumina HiSeq 2500 (Illumina, USA).

And 4, analyzing gene expression. The sequencing reading for each gene was converted to FPKM values and calculated according to the following equation:

1.2.3 Biochemical experiments

1.2.3.1 Co-immunoprecipitation

1, taking at least 10 ⁷ Cells (suitable for Jurkat and 293FT cells), centrifuged at 500g for 5min, the supernatant discarded, lysed with lysine Buffer for Co-IP at 4 ℃ with a rotary shaker greater than 20rpm and half lysedAfter hours, the cell suspension became clear and a flocculent precipitate appeared. Centrifuging at 4 deg.C and maximum rotation speed for 5min, and picking out flocculent precipitate with 200 μ L gun head. And (3) adding 4-time concentrated SDS loading buffer into 30 mu L of supernatant, uniformly mixing, boiling the mixture for three times for 5min in a 100-DEG heater, and reserving the mixture as a whole cell lysate sample.

2, adding 40 μ L Protein G Sepharose beads to the residual supernatant, incubating for 2h at 4 ℃ with a rotary shaker, and removing non-specific binding Protein. Centrifuging at 400G for 5min at 4 deg.C, taking out supernatant, adding 1.5-3 μ G antibody, rotating and shaking at 4 deg.C, incubating for 12 hr, adding 60 μ L Protein G Sepharose beads, and incubating for 4 hr.

After centrifugation at 400g for 5min at 3,4 ℃ the supernatant was removed and washed 3 times with 1mL of 0.5% NP-40 in IP lysate. The supernatant was aspirated off with a spatula tip, mixed with 30. Mu.L SDS loading buffer, and boiled in a 100 ℃ heater with shaking once every 5min for a total of three times. Centrifuging at the maximum speed for 5min, sucking the lysate into a new EP tube by using a flat gun head, and using the lysate for a Western Blot experiment.

1.2.3.2 Detection of PD-1 ubiquitination in 293FT cells

1, plasmids of PD-1, FBXO38, ub were transfected in 293FT cells, cells were harvested after 36h, 293FT cells were blown out of a 10cm dish directly with PBS, centrifuged at 500g, the supernatant removed and washed once with PBS.

2, 100ul Lysis Buffer for inactivation 1 was used to lyse the cells, the pipette tip was used to blow the cells to a viscous state, vortex3-5 times, and the cells were incubated on a 100 ℃ sample cooker for 10 minutes, and then cooled on ice for about 10 minutes.

3, 900. Mu.l of lysine Buffer for inactivation 2 was added to dilute the SDS concentration to 0.1%, facilitating the subsequent immunoprecipitation experiment. After these treatments, the sample formed a compact mass, which was subsequently broken up using an ultrasonicator to form a uniform looking emulsion, and placed in a 4 degree rotary table for 1h.

Centrifugation was carried out at 4,4 ℃ for 10 minutes at the highest rotation speed to remove the precipitate, the supernatant was retained, and IP treatment was carried out using an antibody against anti-HA at a concentration of 4. Mu.g/ml, and a part of the supernatant was retained as a whole cell lysis sample.

The rest of the steps refer to the method of co-immunoprecipitation of 1.2.3.1.

1.3 statistical analysis method of test

All experiments were performed in at least 3 independent replicates (some mouse tumor experiments were performed in duplicate). All data are expressed as mean and standard deviation or standard error (mean ± SD or mean ± SEM). Defining a P value less than 0.05 as a significant difference, specifically: * p <0.05; * P <0.01; * P <0.001; n.s.p > =0.05, no significant difference.

For n =3 experimental data: if the variances of the two groups of samples are not significantly different, using two-tailed unpaired t-test to carry out difference detection; if there is a significant difference in the variance between the two sets of samples, the difference is measured using two-tailed unpaired t-test with Welch's correction.

For n >3 experimental data, it was first tested whether the data fit a normal distribution using Kolmogorov-Smirnov test: if the positive-too-distribution is met and the variance has no significant difference, using two-tailed unpaired t-test to carry out difference detection; if the positive Tai distribution is met and the variance is significantly different, performing difference detection by using two-tailed unpaired t-testwith Welch's correction; if too positive distribution is not met, a difference test is performed using Mann-Whitney test.

For the human samples in a and e in fig. 3.4.1, kolmogorov-Smirnov test was first used to test whether the data fit to a normal distribution: if the positive-too-distribution is met, performing difference detection by using the paired t-test; if too-positive distribution is not met, a Wilcoxon matched-pairs signed rank test is used for the difference detection.

Mouse tumor growth curves were analyzed for significance using the two-way ANOVA test; the survival curves were analyzed for significance using the log-rank (Mantel-Cox) test.

1.4 results of the experiment

1.4.1T cell activation followed by ubiquitination modification of PD-1

The present invention immunoprecipitates PD-1 protein directly using PD-1 antibody (EH 12.1, BD) in activated human Peripheral Blood Mononuclear Cells (PBMC) and Jurkat cell lines, followed by pan-useImmunoblot detection of antibodies specific for biotin revealed that PD-1 has significant ubiquitination modifications in both human PBMC and Jurkat cell lines, and also has dynamic changes in ubiquitination modifications in Jurkat cell lines (fig. 1. A-c). Among them, specific methods for isolating PBMC cells from human blood refer to Lymphoprep from STEMCELL ^TM The sensitivity Gradient Medium for the Isolation of Monouflear Cells Isolation Kit (Catalog # 07801).

According to the invention, a proteasome degradation pathway inhibitor MG132 or lysosome degradation pathway inhibitors NH4Cl and BFA are added into a culture medium of a mouse CTL cell expressing PD-1, and only MG132 can cause accumulation of PD-1, while NH4Cl and BFA have no influence on expression of PD-1 (figure 1. D-i). To ensure that the MG132 and NH4Cl, BFA concentrations are sufficient to inhibit both the proteasome and lysosomal degradation pathways, the present invention detects ERK1/2 protein and p62 protein, respectively, as positive controls for the proteasome degradation pathway and the lysosomal degradation pathway, respectively. The invention discovers that ERK1/2 protein and p62 protein are accumulated in the same cell. Therefore, the above data suggest that the PD-1 protein is present in CD8 ⁺ There are significant dynamic changes following induction of expression, and ubiquitination modification and proteasome-dependent degradation of PD-1 may be important mechanisms therein.

1.4.2FBXO38 specifically regulates PD-1 expression in Jurkat cell line

The invention uses lipo2000 to over-express Fbxo38 in 293FT cells, uses a lentivirus packaging system to infect Jurkat cells, and uses pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen to over-express Fbxo38 in Jurkat cells. It was demonstrated by co-immunoprecipitation experiments in 293FT cells and Jurkat cell lines that Myc-FBXO38 can interact with HA-PD-1, and that exogenously overexpressed Myc-FBXO38 can also interact with endogenously induced expressed PD-1 (FIGS. 2. A-d). Myc-FBXO47 also interacts with HA-PD-1 in 293FT cells (FIG. 2. E). In order to examine the effect of FBXO38 and FBXO47 on PD-1 stability, the present invention over-expressed FBXO38 and FBXO47 genes in Jurkat cell lines using phege-ffef 1a-3Myc-FBXO38-IRES-ZsGreen and phege-ffef 1a-3Myc-FBXO47-IRES-ZsGreen, respectively, found that the over-expression did not affect the expression level of CD3 on the surface of Jurkat cell lines, but after anti-CD3 stimulation, PD-1 expression level was significantly lower in FBXO38 over-expressed Jurkat cells than in control group, while PD-1 was not affected in FBXO47 over-expressed Jurkat cells (fig. 2. F-i), which suggests that FBXO38 and FBXO47 both interact with PD-1 and FBXO38 may be more important. Further, the present invention successfully knockdown the Fbxo38 gene with shRNA in Jurkat cell line with significantly reduced levels of both transcript and protein, while CD3 expression on the cell surface was unaffected (fig. 2. J-l). After anti-CD3 stimulation, PD-1 expression was significantly higher in the Fbxo38 knock-down group than in the control group, and there was no significant difference in transcript levels between the two groups (FIG. 2. M-n). Further, the inventive co-immunoprecipitated antibody IP with PD-1 and detection of Fbxo38 knock-down with western blot enabled a significant increase in PD-1 protein levels (FIG. 2. O). In combination with co-immunoprecipitation experiments and overexpression and knock-down experiments in Jurkat cells, FBXO38 is considered to be a key protein for regulating PD-1 stability.

The DNA nucleotide sequence for coding the shRNA is 5'GACTTCCTTTGTATCAGCTTA 3' (SEQ ID NO. 12).

1.4.3FBXO38 catalyzes PD-1 to carry out polyubiquitination modification of K-48 type and promotes degradation

The invention firstly over-expresses Myc-Fbxo38, HA-Pd1 and V5-Ub in 293FT cells, and finds that FBXO38 can promote ubiquitination of PD-1, and after two lysines of PD-1 intracellular segment are all mutated into R, ubiquitination signal of PD-1 is completely disappeared, which indicates that FBXO38 can catalyze ubiquitination of PD-1 at the two sites (FIG. 3. A). In the Jurkat cell line with Fbxo38 overexpressed and knocked down, the present inventors found that Fbxo38 could significantly affect the ubiquitination modification of endogenous PD-1 (fig. 3. B-c). The present invention compares ubiquitination signals of wild-type PD-1 and KtoR mutated at K210R, K233R and both K mutations, respectively, and finds that K210R mutation does not affect ubiquitination signal of PD-1, whereas K233R and KtoR mutations hardly detect ubiquitination modification of PD-1, which indicates that FBXO38 catalyzes ubiquitination modification at K233 site of PD-1 (fig. 3. D). FBXO38 belongs to the F-box E3 ligase family, which has an important F-box functional domain, and after F-box deletion, the ability of FBXO38 to catalyze PD-1 ubiquitination modification is found to be significantly affected (FIG. 3. E). In the invention, different V5-Ub mutations are transfected into 293FT cells, and after K-48R mutation is found, the ubiquitination signal of PD-1 is obviously influenced, but the signal of K63R is hardly influenced, which indicates that FBXO38 also catalyzes PD-1 to generate K-48 type polyubiquitination modification (figure 3. F). Finally, the protein synthesis inhibitor CHX is used for blocking protein synthesis, the protein stability of PD-1 is detected, and the FBXO38 can be found to remarkably promote the degradation of PD-1. Both PD-1 became more stable if either both lysines of PD-1 were mutated to R or the F-box domain of FBXO38 was deleted (FIG. 3. G-i). Therefore, the above data indicate that FBXO38 can catalyze polyubiquitination modification of the K-48 type at the K233 site of PD-1 and promote PD-1 degradation.

1.4.4 Effect of Fbxo38 knockout on T cell development

The invention adopts Fbxo38 conditional knockout mice (Fbxo 38) with C57 background ^CKO ) (FIG. 4 a).

The invention firstly adopts the flow cytometry technology to detect the influence of Fbxo38 gene knockout on the development of mouse T cells. In the thymus, CD4 and CD8 cells develop at Fbxo38 ^CKO There were no significant differences in mice compared to the control group, including DN (CD 4) ^- CD8 ^- )、DP(CD4 ⁺ CD8 ⁺ )、CD4SP(CD4 ⁺ CD8 ^- ) And CD8SP (CD 4) ^- CD8 ⁺ ) There were also no significant differences in the DN1, DN2, DN3 and DN4 stages of DN cells (fig. 4. B-c). In peripheral spleen and lymph node, the ratio of CD4 and CD8 cells is in Fbxo38 ^CKO There was no significant difference in mice compared to the control group, and most of the CD4 and CD8 cells remained

State, central memory (CD 44) ^hi CD62L ^hi ) And an effector/effector memory (CD 44) ^hi CD62L ^lo ) There were also no significant differences in the cells (FIG. 4. D-i). Therefore, these data indicate that Fbxo38 gene knockout does not affect T cell development and peripheral immune homeostasis.

1.4.5 Effect of Fbxo38 knockout on T cell activation, proliferation and apoptosis

The invention adopts the flow cytometry technology to detect the Fbxo38 ^CKO And CD8 in control mice ⁺ Expression of CD3 and CD28 on the surface of T cells, it was found that Fbxo38 knock-out did not affect the expression of CD3 and CD28 (fig. 5. A). Fbxo38 after stimulation with anti-CD3 and anti-CD28 ^CKO And control group CD8 ⁺ The expression level of the activating molecule CD44 on the T cell surface was comparable (fig. 5. B). Meanwhile, the invention also detects CD8 by using the flow cytometry technology ⁺ After T cell activation, the ability to secrete cytokines was found to be not significantly affected at both 72h and 96h secretion of IFN-. Gamma.TNF-. Alpha.and GranzymB (FIG. 5. D).

1.4.6Fbxo38 knock-out on T cell proliferation and apoptosis

The invention further uses Celltracker staining and flow cytometry to detect WT and CKO CD8 ⁺ Proliferation of T cells after in vitro activation, WT and CKO CD8 were detected using Annexin V and Propidium Iodide (PI) staining and flow cytometry ⁺ T cell apoptosis, finding that Fbxo38 knock-out also did not affect CD8 ⁺ Proliferation and apoptosis of T cells (fig. 6).

1.4.7Fbxo38 knockout on CD8 ⁺ Effect of T cell transcriptome

The invention adopts RNA-seq to analyze WT and CKO CD8 ⁺ T cells in

And the gene transcription level in the activated state, three pairs of Fbxo38 were selected ^CKO And control mice, CD8 was isolated ⁺ T cells are stimulated by anti-CD3 and anti-CD28, expression changes of a plurality of cell surface molecules, cytokines, activating molecules and transcription factors are detected through RNA-Seq, and Fbxo38 knockout also does not influence CD8 ⁺ Expression of these functional molecules in T cells. However, CD8 ⁺ Following T cell activation, protein levels of PD-1 were at Fbxo38 knock-out CD8 ⁺ There was a significant increase in T cells. In contrast, there was no difference in the expression level of the other immunosuppressive molecule, LAG-3. In these experiments, the major target of FBXO38 in CD8+ T cells was PD-1, and the PD-1 pathwayIn the absence of activation, fbxo38 knockout mice had normal activation capacity (fig. 7 a).

1.4.8 Effect of Fbxo38 knockout on PD-1

The invention uses flow cytometry to detect WT and Fbxo38 ^CKO Mouse CD8 ⁺ 、CD4 ⁺ Expression levels of PD-1 on the surface of T cells and Treg cells. Fbxo38 after stimulation with anti-CD3 and anti-CD28 ^CKO CD8 compared to WT ⁺ And CD4 ⁺ PD-1 levels on the T cell surface were significantly high (FIGS. 8. A-b). Meanwhile, the invention also detects Treg (CD 4) in mouse spleen by using flow cytometry ⁺ CD25 ⁺ ) PD-1 level of the cells, fbxo38 was found ^CKO PD-1 levels were significantly increased in tregs compared to WT (fig. 8. C). In conclusion, the knockout of Fbxo38 leads to a significant increase in the expression level of PD-1 in T cells.

1.4.9Fbxo38 knock-out affects the anti-tumor immunity of T cells

The invention utilizes a tumor model to research the CD8 of FBXO38 under physiological conditions ⁺ The function of the anti-tumor immunity of the T cells. The B16F10 cells highly express PD-L1 molecules, and the discovery means that the PD-1-PD-L1 pathway is activated continuously in a B16F10 model, and the PD-1 pathway plays an important role in tumor immune escape of the model. B16F10 is a very malignant tumor model, and the growth rate of the tumor is fast. However, fbxo38 was compared with the control mice ^CKO Tumors grew faster and survived in mice (fig. 9. A-b). Further analysis of tumor-infiltrated T cells found (fig. 9. C), more than 90% tumor-infiltrated CD8 ⁺ T cells were all CD44 positive, meaning that these cells were antigen activated, whereas Fbxo38 ^CKO CD8 in mice ⁺ T cells with higher PD-1 expression level, lower proliferation capacity (Ki 67 expression) and defective function of secreting cytokines (IFN-. Gamma., TNF-. Alpha.and GranzymB), CD4 ⁺ 、CD8 ⁺ And the proportion of Treg cells was not affected (fig. 9. D-j).

1.4.10.0Fbxo38 knock-out affects T cell anti-tumor immunity

The present invention uses the MC38 model, also found Fbxo38 ^CKO CD8 in mice ⁺ T cells had higher PD-1 expression levels and tumors grew faster (fig. 10. A-f). These data demonstrate that FBXO38 protein can affect CD8 by modulating the expression of PD-1 ⁺ Function of T cells.

1.4.11Fbxo38 knockdown did not affect activation of T cells

The invention uses shRNA in OT1CD8 in vitro ⁺ Knocking down Fbxo38 gene in T cells, observing CD8 of Fbxo38 knocked down group and control group ⁺ PD-1 levels of T cells. Through screening, two specific shRNAs of Fbxo38 are selected, and endogenous Fbxo38 can be effectively knocked down through qPCR and immunoblot verification (figure 11. A-b). Fbxo38 knockout following CD8 ⁺ Like T cells, fbxo38 knockdown did not affect the expression of CD3 and CD28 molecules on the cell surface (fig. 11. C). Furthermore, the present invention examined the effect of Fbxo38 knockdown on the TCR signaling pathway and found that including CD3 phosphorylation, PLC-phosphorylation and ERK phosphorylation were not affected by Fbxo38 knockdown, nor was the secretion of the T cell activating molecule CD69 and the cytokine IFN-, (fig. 11. D-g).

The DNA nucleotide sequence for coding the shRNA is as follows:

5’GTGGATGCGACTGGTTGATAT 3’(SEQ ID NO.13)

5’CGTAATCGTAACGGAGCATTT 3’(SEQ ID NO.14)

1.4.1.12Fbxo38 knockdown up expression of PD-1 and affects CD8 ⁺ Killing ability of T cells

PD-1 levels were flow-assayed after T-cell activation with anti-CD3 and anti-CD28 antibodies and significantly increased PD-1 expression levels were found in cells of the Fbxo 38-knockdown group (FIG. 12. A), which is consistent with CD8 knockout with Fbxo38 ⁺ T cell phenotypes were consistent. To investigate whether high expression of PD-1 affects CD8 ⁺ T cell function, the present invention selects OT1CD8 with EL-4 cells as target cells ⁺ T cell killing system. EL-4 cells highly express PD-L1, in OT1CD8 ⁺ The PD-1 pathway can be activated efficiently when T cells are killed (FIG. 12. B). Compared with a control group, the killing capacity of the cells of the Fbxo38 knock-down group is obviously influenced; meanwhile, anti-PD-1 can completely recover the functional defect (FIG. 12. C). Further validation of FBXO38 regulationCD8 ⁺ PD-1 levels in T cells, fbxo38 was overexpressed in OVA-activated CTLs using retroviral MSCV and a significant reduction in PD-1 levels was observed (FIG. 12. D-f). These data suggest that PD-1 is the primary target for FBXO 38.

1.4.1.3FBXO38 endogenously regulates the antitumor capacity of CD8+ T cells

The present invention was studied using Adoptive T cell therapy (Adoptive Transfer Model) for the B16F10 tumor Model. In this model, the invention provides for the in vitro delivery of shRNA to OT1CD8 ⁺ Knockdown of Fbxo38 gene in T cells (shRNA used identical to that used in 1.4.11), sorting and expansion of these cells, followed by injection into tumor-bearing mice (B16F 10-OVA), observation of CD8 in Fbxo38 knockdown and control groups ⁺ Tumor control ability of T cells (fig. 13. A). In the invention, unstimulated cells of the Fbxo38 knocked-down group and the control group are back-infused into a B16F10-OVA tumor-bearing mouse, and the proportion of the cells of the Fbxo38 knocked-down group and the expression amount of Ki67 in inguinal lymph node (drainage lymphoma node) of the mouse are obviously lower than those of the control group, while the expression amount of PD-1 is obviously higher than that of the control group; in the mesenteric lymph node (non-draining lymph node), the ratio of the two groups of cells was comparable, indicating that the Fbxo38 knockdown did not affect the migration of T cells into secondary lymphoid organs (FIGS. 13. B-e). Therefore, the control ability of the Fbxo38 knock-down group cells on tumors was significantly lower than the control group, and the survival of the mice was also shorter (fig. 13. F-g), which is consistent with the data for Fbxo38 conditional knock-out mice. Finally, the invention researches the control condition of the combined treatment of anti-PD-1 and ACT on tumors, and finds that the combined treatment has obviously better effect than that of the single treatment of ACT in the Fbxo38 knock-down and control groups, and the sizes and survival periods of the tumors of two groups of mice have no obvious difference after the combined treatment (figure 13. H-i), which shows that the anti-PD-1 can recover the functional defect caused by the Fbxo38 knock-down. These data in combination with Fbxo38 knock-down conditional knockout data illustrate that: FBXO38 can regulate CD8 by specifically regulating expression level of PD-1 ⁺ Anti-tumor immune function of T cells.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions of the present invention as set forth herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention is not limited to those specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Shanghai Living sciences research institute of Chinese academy of sciences

<120> function and use of PD-1 ubiquitination agonist

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 231

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgcagatct ttgtgaagac cctcactggc aaaaccatca cccttgaggt cgagcccagt 60

gacaccattg agaatgtcaa agccaaaatt caagacaagg agggtatccc acctgaccag 120

cagcgtctga tatttgccgg caaacagctg gaggatggcc gcactctctc agactacaac 180

atccagaaag agtccaccct gcacctggtg ttgcgcctcc gcggtggata a 231

<210> 2

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caggtgtcgt gaagcatgga acagaaattg ataagtgagg aagatttag 49

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttgctctaaa tcttcctcac ttatcaattt ctgttccatg cttcacgaca cctg 54

<210> 4

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agcaaaagct catttctgaa gaggacttgg aacagaaatt gataagtgag gaagatt 57

<210> 5

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccgctaaatc ttcctcactt atcaatttct gttccaagtc ctcttcagaa atgagctt 58

<210> 6

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tagcggccgc agcaatgcat gcaggcgcgc cagaaacgcg tgggcaccgg tctgcagc 58

<210> 7

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gctgcagacc ggtgcccacg cgtttctggc gcgcctgcat gcattgctgc gg 52

<210> 8

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgaggaagat ttagcgatgg ggccacgaaa gaaaagtg 38

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgcatgcatt gctgcttaaa tgtagtcatc ttcaactg 38

<210> 10

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcgccggaat tagatctcat ggaacagaaa ttgataagtg aggaag 46

<210> 11

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gggcggaatt cgttaacctt aaatgtagtc atcttcaac 39

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gacttccttt gtatcagctt a 21

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtggatgcga ctggttgata t 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgtaatcgta acggagcatt t 21

Claims

Use of a PD-1 ubiquitinated agonist in the preparation of a PD-1 degradant or in the preparation of a medicament for the immunotherapy of cancer, said PD-1 ubiquitinated agonist being an FBXO38 agonist.
2. Use according to claim 1, further comprising one or more of the following features:

a. the PD-1 ubiquitination agonist is a molecule having a promoting effect on PD-1 ubiquitination;

b. the PD-1 ubiquitination agonist is selected from lentivirus or retrovirus packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide or protein.
3. Use according to claim 1, further comprising one or more of the following features:

c. the FBXO38 agonist is a molecule having a promoting effect on FBXO 38;

d. the FBXO38 agonist is selected from a molecule capable of increasing the expression or activity of FBXO 38.
4. Use according to claim 3, characterized in that in characteristic d the molecule capable of increasing the expression or activity of FBXO38 is selected from the group consisting of lentivirus or retrovirus packaged plasmids, carbohydrates, lipids, small molecule compounds, RNA, polypeptides or proteins.
5. An immunotherapeutic drug for tumors, comprising an effective amount of a PD-1 ubiquitination agonist, said PD-1 ubiquitination agonist being an FBXO38 agonist.
Use of FBXO38 as an action target in screening a tumor immunotherapy medicament or screening an autoimmune disease treatment medicament.
7. A method for screening a tumor immunotherapy drug, comprising: and (4) verifying whether the medicament to be screened can have a promoting effect on the FBXO38, and if so, determining the medicament to be screened as a candidate medicament for tumor immunotherapy.
8. The method for screening a tumor immunotherapeutic drug according to claim 7, which comprises: the drug to be screened is acted on the in vitro cell expressing FBXO38 to determine whether the FBXO38 in the cell has activity enhancement or expression up-regulation.
9. The method for screening a tumor immunotherapeutic drug according to claim 8,

the method for determining whether the FBXO38 has increased viability or up-regulated expression in the cell is: real-time quantitative PCR and/or Western Blot detection, or mass spectrometric detection.
10.A method for screening a therapeutic agent for an autoimmune disease, comprising: and (4) verifying whether the medicament to be screened can inhibit the FBXO38, and if so, determining the medicament to be screened as a candidate medicament for treating the autoimmune disease.
11. The method for screening for an autoimmune disease therapeutic agent according to claim 10, comprising:

the drug to be screened is applied to the in vitro cells expressing FBXO38 to determine whether the FBXO38 in the cells has weakened activity or reduced expression.
12. The method of screening for an autoimmune disease therapeutic agent according to claim 11,

the method for determining whether the FBXO38 has decreased viability or expression in a cell is: real-time quantitative PCR and/or Western Blot detection, or mass spectrometric detection.