CN111166867A

CN111166867A - Function and use of PD-1 ubiquitination agonist

Info

Publication number: CN111166867A
Application number: CN201811332819.2A
Authority: CN
Inventors: 许琛琦; 孟祥波; 刘希伟
Original assignee: Center for Excellence in Molecular Cell Science of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2018-11-09
Filing date: 2018-11-09
Publication date: 2020-05-19
Anticipated expiration: 2038-11-09
Also published as: CN111166867B

Abstract

The invention belongs to the technical field of life science, and particularly relates to functions and applications of a PD-1 ubiquitination agonist. According to the invention, extensive and intensive research shows that PD-1 can generate ubiquitination phenomenon and is further degraded, so that the functions of activation, proliferation, cytokine secretion and the like of T cells are enhanced, the killing function and proliferation capacity of tumor-infiltrated T cells are improved, the tumor cells are killed by an immune system, FBXO38 is a target point capable of promoting ubiquitination of PD-1, and the degradation of PD-1 can be remarkably promoted by promoting the expression of FBXO 38. Inhibition of FBXO38 expression inhibits the degradation of PD-1 and can be used to treat autoimmune diseases. Therefore, the invention provides strong scientific evidence for clinical immunotherapy of tumors and treatment of autoimmune diseases from clinical patient sample level, cell function level and molecular level.

Description

Function and use of PD-1 ubiquitination agonist

Technical Field

The invention belongs to the technical field of life science, and particularly relates to functions and applications of a PD-1 ubiquitination agonist.

Background

Malignant tumor is one of the most lethal diseases at present, and the conventional treatment means such as surgical excision, radiotherapy, chemotherapy and the like are mostly applied to tumor treatment, but the conventional treatment means has limitations in tumor treatment and is difficult to completely cure tumor, especially some metastatic malignant tumors.

As the most important line of defense for human health, the immune system is responsible for discovering and eliminating various pathogenic microorganisms outside (resisting infection) and harmful substances possibly generated in the body (resisting tumor), and avoiding damaging the body or generating autoimmune diseases due to too violent immune reaction. The immune system has a complex regulatory network to ensure that immune responses are in equilibrium, such as central tolerance mechanisms to ensure that the immune system eliminates autoreactive T somatic cells, and immunosuppressive cell-Tregs to suppress peripheral inflammatory responses (Lohmann et al, 1996; van Noort et al, 1993). In addition, immunosuppressive molecules expressed on the surface of immune cells are also important components for ensuring immune balance, such as molecules expressed on the surface of CD8+ T cells, such as PD-1, CTLA-4, LAG-3, and TIM 3. After activation of these immunosuppressive molecules, intracellular signal transduction pathways are initiated, inhibitory signals are transmitted to T cells, the threshold for T cell activation is increased, and functions such as T cell activation, proliferation, and cytokine secretion are suppressed. Activation of these immunosuppressive molecules can inhibit the development of autoimmune diseases. However, everything is twofold, and in the tumor microenvironment, these immunosuppressive molecular pathways are usually continuously activated, resulting in the inhibition of the killing and proliferation capacity of tumor-infiltrating T cells, which in turn escape the killing of the immune system.

Recent studies have found that sustained activation of the PD-1 pathway in the tumor microenvironment is an important mechanism for tumor immune escape. The surface of the tumor-infiltrated T cell highly expresses PD-1 molecules, and the tumor cell highly expresses the ligand PD-L1 molecules, so that the PD-1 pathway is continuously activated in a tumor microenvironment, and the tumor-infiltrated T cell also becomes anergy. Clinically, after blocking the PD-1 pathway by blocking antibodies to PD-1, disease is reduced in approximately 20% of tumor patients. The emergence of PD-1 antibodies is a milestone event in tumor therapy, allowing one to see the promise of treating tumors by activating the immune system, opening a completely new avenue for tumor therapy. However, a number of clinical data suggest that PD-1 antibodies are effective against most solid tumors by only about 20% to 40%, meaning that a significant proportion of patients do not benefit from immunotherapy.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims at the function and the application of the PD-1 ubiquitination agonist.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

the first aspect of the invention provides the application of the PD-1 ubiquitination stimulant in preparing a PD-1 degradation agent or preparing a tumor immunotherapy medicament.

In one embodiment, the tumor is selected from one or more of melanoma, non-small cell lung cancer, renal cancer, head and neck squamous carcinoma, hodgkin lymphoma, gastric cancer, liver cancer, bladder cancer, endometrial cancer, and colon cancer.

Further, the PD-1 ubiquitination agonist is a molecule having a promoting effect on PD-1 ubiquitination.

Specifically, the promotion of PD-1 ubiquitination can adopt various chemical, physical and biological methods. Including but not limited to:

(1) modulating a PD-1 metabolic pathway to increase PD-1 ubiquitination levels;

(2) ubiquitin was directly attached to PD-1.

Ubiquitin is a polypeptide consisting of 76 amino acids in eukaryotic cells, and the PD-1 ubiquitination refers to the ubiquitination modification of the ubiquitin connected to the lysine of PD-1, which affects the signal path of PD-1 or degrades PD-1 through proteasome.

The PD-1 ubiquitination agonist can enhance the functions of T cell activation, proliferation, cytokine secretion and the like, improve the killing function and proliferation capacity of tumor-infiltrated T cells, and enable the tumor cells to be killed by an immune system.

The ubiquitin has a nucleotide sequence shown as SEQ ID NO.1, and specifically comprises the following steps:

ATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCCGGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGTTGCGCCTCCGCGGTGGATAA。

the Genbank accession number of the PD-1 is as follows: AY 238517.

Further, the PD-1 ubiquitination agonist can promote the degradation of PD-1.

In one embodiment, the PD-1 ubiquitinated agonist may be a lentivirus or retrovirus packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide, or protein.

In one embodiment, the PD-1 ubiquitination agonist is a FBXO38 agonist.

Further, the FBXO38 agonist is a molecule having a promoting effect on FBXO 38.

Having a promoting effect on FBXO38 includes, but is not limited to: enhance FBXO38 activity, or promote transcription or expression of FBXO38 gene.

In one embodiment, the FBXO38 agonist is selected from a molecule capable of increasing the expression or activity of FBXO 38.

The molecule capable of increasing the expression or activity of FBXO38 may be a lentiviral or retroviral packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide or protein.

Alternatively, the FBXO38 agonist may be a vector that increases the expression level of FBXO 38. Specifically, the vector may contain FBXO38 gene and express FBXO 38. The vector may be a plasmid vector, a lentiviral vector, a retroviral vector. Such as pHAGE, pMXs, MSCV.

The embodiment of the invention specifically lists pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen and MSCV-3Myc-FBXO38-IRES-ZsGreen as vectors for increasing the expression level of FBXO 38. The pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen specifically comprises: the sequence of Fbxo38 with 3 consecutive Myc tags at the N-terminus, preceded by IRES-ZsGreen, was inserted into the pHAGE vector. After transfection of cells, the Myc-tagged FBXO38 molecule can be expressed intracellularly, ZsGreen indicating positive cells.

The MSCV-3Myc-FBXO38-IRES-ZsGreen specifically comprises the following components: the sequence of Fbxo38 with 3 consecutive Myc tags at the N-terminus was inserted on the MSCV vector before IRES-ZsGreen. After transfection of cells, the Myc-tagged FBXO38 molecule can be expressed intracellularly, ZsGreen indicating positive cells.

The Genbank accession number of the human FBXO38 is: BC 050424.

The Genbank accession number of the mouse FBXO38 is: AK 031347.

The tumor immunotherapy medicament has at least one of the following functions:

enhancing the killing function and proliferation ability of tumor-infiltrated T cells, inhibiting cancer cell proliferation, reducing cancer cell activity, promoting cancer cell apoptosis, and inhibiting tumor growth.

The tumor immunotherapy medicament necessarily comprises a PD-1 ubiquitination agonist, and takes the PD-1 ubiquitination agonist as an effective component of the function.

In the tumor immunotherapy medicament, the effective component exerting the functions can be only a PD-1 ubiquitination agonist, and can also comprise other molecules capable of playing similar functions.

The tumor immunotherapy medicine can be a single-component substance or a multi-component substance.

The tumor immunotherapy medicament is not particularly limited in form, and can be in the form of various substances such as solid, liquid, gel, semifluid, aerosol and the like.

Optionally, in the tumor immunotherapy medicament, the PD-1 ubiquitination agonist is FBXO38 agonist.

The tumor immunotherapy medicament mainly aims at mammals such as rodentia animals, artiodactyla animals, perissodactyla animals, lagomorpha animals, primates and the like. Preferably, the primate is a monkey, ape or homo sapiens.

In a second aspect of the invention, a method of immunotherapy of a tumor is provided, comprising administering to a subject a PD-1 ubiquitination agonist.

The subject may be a mammal. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human.

The subject may be a patient suffering from a tumor or an individual for whom treatment of a tumor is desired.

The PD-1 ubiquitination agonist may be administered to a subject before, during, or after receiving tumor therapy.

In a third aspect of the invention, a tumor immunotherapy medicament is provided, which comprises an effective amount of PD-1 ubiquitination agonist.

Furthermore, the tumor immunotherapy drug comprises an effective amount of PD-1 ubiquitination stimulant and a medicinal carrier.

That is, the PD-1 ubiquitination agonist is the only effective component or one of the effective components of the tumor immunotherapy medicament.

In one embodiment, the PD-1 ubiquitination agonist is a FBXO38 agonist.

Further, the FBXO38 agonist is a molecule having a promoting effect on FBXO 38.

Optionally, the pharmaceutical formulation further comprises a pharmaceutically acceptable carrier.

In a fourth aspect of the invention, a tumor combination therapy drug combination is provided, which comprises an effective amount of PD-1 ubiquitination agonist and at least one other tumor therapy drug.

The other tumor treatment medicines refer to tumor treatment medicines except the PD-1 ubiquitination agonist.

The combination therapy drug combination may be in any one of the following forms:

firstly), the PD-1 ubiquitination stimulant and other tumor treatment drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can be the same or different.

When the other tumor therapeutic agent is an antitumor antibody, a parenteral administration type is generally employed. When the other tumor treatment medicines are chemotherapy medicines, the administration forms can be rich, and the gastrointestinal administration or the parenteral administration can be carried out. Known routes of administration for each chemotherapeutic agent are generally recommended.

Secondly), PD-1 ubiquitination excitant and other tumor treatment drugs are prepared into a compound preparation. When the PD-1 ubiquitination agonist and other tumor treatment drugs are administered by the same route of administration and administered simultaneously, they may be formulated as a combination preparation.

In a fifth aspect of the invention, a method for treating a tumor is provided, wherein an effective amount of a PD-1 ubiquitination agonist is administered to a subject, and an effective amount of another tumor treatment drug is administered to the subject and/or another tumor treatment means is administered to the subject.

An effective amount of a PD-1 ubiquitination agonist and an effective amount of at least one other tumor treatment drug may be administered simultaneously or sequentially.

Such other tumor treatment drugs include, but are not limited to: antitumor antibodies, chemotherapeutic drugs or targeted drugs, etc.

The PD-1 ubiquitination agonist may be administered parenterally or parenterally. The other tumor treatment drug may be administered parenterally or parenterally. For antitumor antibodies or chemotherapeutic drugs, parenteral administration is generally employed.

In the sixth aspect of the invention, the application of FBXO38 as an action target in screening tumor immunotherapy medicines or screening autoimmune disease treatment medicines is provided.

In the use of screening the tumor immunotherapy drugs, the tumor is selected from one or more of melanoma, non-small cell lung cancer, kidney cancer, head and neck squamous carcinoma, Hodgkin lymphoma, gastric cancer, liver cancer, bladder cancer, endometrial cancer and colon cancer.

In the application of screening tumor immunotherapy drugs, the application specifically refers to: using FBXO38 as an action object, screening candidate substances, and verifying whether the candidate substances can enhance PD-1 ubiquitination and/or have promotion effect on FBXO38, if so, determining the candidate substances as tumor immunotherapy candidate medicines.

In the application of screening the tumor immunotherapy drugs, the candidate substances are selected from nucleic acid drugs, carbohydrate drugs, lipid drugs, small molecule drugs, polypeptide drugs or protein drugs.

In the use for screening a therapeutic agent for an autoimmune disease selected from one or more autoimmune diseases such as chronic lymphocytic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, chronic ulcerative colitis, pernicious anemia with chronic atrophic gastritis, goodpasture's syndrome, blain vulgaris, blain blains, primary biliary cirrhosis, multiple sclerosis, acute idiopathic polyneuritis, systemic lupus erythematosus, rheumatoid arthritis, systemic sclerosis, polyarteritis nodosa, systemic vasculitis, scleroderma and the like.

In the application of screening the autoimmune disease treatment drugs, the application specifically refers to: the candidate substance is screened with FBXO38 as the target of action to verify whether the candidate substance can reduce PD-1 ubiquitination and/or has inhibitory effect on FBXO38, and if so, the candidate substance is determined to be the candidate drug for treating autoimmune diseases.

In the use for screening a therapeutic agent for autoimmune diseases, the candidate substance is selected from a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug or a protein drug.

Having an inhibitory effect on FBXO38 includes, but is not limited to: inhibit FBXO38 activity, or inhibit FBXO38 gene transcription or expression.

The seventh aspect of the present invention provides a method for screening a tumor immunotherapy drug, comprising: and (3) verifying whether the medicament to be screened can enhance PD-1 ubiquitination and/or has a promoting effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for tumor immunotherapy.

In one embodiment, the drug to be screened is applied to cells in vitro expressing PD-1 to determine whether enhancement of ubiquitination of PD-1 occurs in the cells.

For example, the screening method may be: culturing in vitro cells expressing PD-1 under the condition suitable for cell growth, setting two groups of comparison experiments, adding a medicament to be screened into a culture dish of the in vitro cells in one group, adding an equal amount of physiological saline into the other group, incubating under the same conditions, and testing whether the in vitro cells PD-1 are subjected to ubiquitination enhancement.

The method for determining the enhancement of ubiquitination can specifically be as follows: and (3) detecting by a western blot technology or a mass spectrum technology.

In one embodiment, the drug to be screened is applied to cells in vitro expressing FBXO38 to determine whether FBXO38 has increased viability or is up-regulated in the cells.

For example, the screening method may be: culturing in vitro cells expressing FBXO38 under conditions suitable for cell growth, setting two groups of comparison experiments, adding the drug to be screened into a culture dish of the in vitro cells, adding the same amount of physiological saline into the other group, incubating under the same conditions, and testing whether the activity of FBXO38 in the cells is enhanced or the expression of the FBXO38 is up-regulated.

The method of determining whether FBXO38 has increased viability or upregulated expression in a cell may be: real-time quantitative PCR, real-time quantitative PCR and Western Blot detection, or mass spectrum detection.

In one embodiment, the tumor immunotherapy drug is a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug, or a protein drug.

The eighth aspect of the present invention provides a method for screening a therapeutic agent for autoimmune diseases, comprising: and (3) verifying whether the medicament to be screened reduces PD-1 ubiquitination and/or has a suppression effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for treating the autoimmune disease.

In one embodiment, the drug to be screened is applied to cells in vitro expressing PD-1 to determine whether the cells have reduced ubiquitination of PD-1.

For example, the screening method may be: culturing in vitro cells expressing PD-1 under the condition suitable for cell growth, setting two groups of comparison experiments, adding a medicament to be screened into a culture dish of the in vitro cells in one group, adding an equal amount of physiological saline into the other group, incubating under the same conditions, and testing whether the in vitro cells PD-1 are subjected to ubiquitination weakening.

The method for determining the reduction of ubiquitination can specifically be as follows: and (3) detecting by a western blot technology or a mass spectrum technology.

In one embodiment, the drug to be screened is applied to cells in vitro expressing FBXO38 to determine whether FBXO38 is less viable or less expressed in the cells.

For example, the screening method may be: culturing in vitro cells expressing FBXO38 under conditions suitable for cell growth, setting two groups of comparison experiments, adding the drug to be screened into a culture dish of the in vitro cells, adding the same amount of physiological saline into the other group, incubating under the same conditions, and testing whether the activity or the expression of FBXO38 in the cells is weakened or reduced.

Methods for determining whether FBXO38 has become less viable or reduced in expression in a cell may be: real-time quantitative PCR, real-time quantitative PCR and Western Blot detection, or mass spectrum detection.

In one embodiment, the autoimmune disease treatment drug is a nucleic acid drug, a carbohydrate drug, a lipid drug, a small molecule drug, a polypeptide drug, or a protein drug.

Compared with the prior art, the invention has the following beneficial effects:

the invention is widely and deeply researched, and firstly discovers that PD-1 can be ubiquitinated and further degraded, so that the functions of activation, proliferation, cytokine secretion and the like of T cells are enhanced, the killing function and proliferation capacity of tumor-infiltrated T cells are improved, the tumor cells are killed by an immune system, FBXO38 is a target point capable of promoting the ubiquitination of PD-1, and the degradation of PD-1 can be remarkably promoted by promoting the expression of FBXO 38. Inhibition of FBXO38 expression inhibits the degradation of PD-1 and can be used to treat autoimmune diseases. Therefore, the invention provides strong scientific evidence for clinical immunotherapy of tumors and treatment of autoimmune diseases from clinical patient sample level, cell function level and molecular level.

Drawings

FIG. 1 ubiquitination modification and degradation of PD-1 following T cell activation

a, detecting the ubiquitination modification condition of PD-1 in PBMC of human peripheral blood mononuclear cells by using a co-immunoprecipitation and western blot method.

b, detecting ubiquitination modification dynamics of PD-1 at different times in the Jurkat cell line by using the co-immunoprecipitation and western blot method.

And c, detecting the ubiquitination modification condition of the PD-1 in the Jurkat cell line by using the co-immunoprecipitation and western blot method.

d, detecting the action of the proteasome inhibitor MG132 on PD-1 by using a flow cytometry technology.

And e, detecting the action condition of the proteasome inhibitor MG132 on the ERK by using a western blot method.

f, detecting the effect of the lysosome inhibitor NH4Cl on PD-1 by using a flow cytometry technology.

g, the effect of the lysosomal inhibitor NH4Cl on p62 was examined using the western blot method.

h, detecting the effect of the lysosome inhibitor BFA on PD-1 by using a flow cytometry technology.

i.e. the effect of the lysosomal inhibitor BFA on p62 was examined using the western blot method.

FIG. 2FBXO 38-specific modulation of PD-1 levels

a, detecting the interaction condition of the transfected HA-PD-1 and Myc-FBXO38 by using a co-immunoprecipitation technology in 293FT cells.

b, detecting the interaction condition of the transgressed Myc-FBXO38 and HA-PD-1 in 293FT cells by using a co-immunoprecipitation technology.

c, detecting the interaction condition of the transfected Myc-FBXO38 and HA-PD-1 in Jurkat cells by using a co-immunoprecipitation technology.

d, the co-immunoprecipitation technique was used to detect the interaction of the transfected Myc-FBXO38 with endogenous PD-1 in Jurkat cells.

e, co-immunoprecipitation was used to detect the interaction of transfected Myc-FBXO47 and HA-PD-1 in 293FT cells.

f, detecting the overexpression of Myc-FBXO38 and Myc-FBXO47 in Jurkat cells by using a western blot method.

g, surface levels of CD3 in Jurkat cells overexpressing Myc-FBXO38 and Myc-FBXO47 were measured by flow cytometry.

h-i, surface levels of PD-1 in Jurkat cells overexpressing Myc-FBXO38 and Myc-FBXO47 were measured by flow cytometry.

j, the knock down efficiency of Fbxo38 was measured by fluorescent quantitative PCR technique.

k, protein levels of Fbxo38 were measured after Fbxo38knock down using western blot method.

l, the surface level of CD3 was detected in Fbxo38knock down Jurkat cells using flow cytometry.

m, detecting the surface level of PD-1 in Jurkat cells of Fbxo38knock down by flow cytometry.

And n, detecting the mRNA level of PD-1 in Jurkat cells of Fbxo38knock down by using a fluorescent quantitative PCR (polymerase chain reaction) technology.

o, protein level of PD-1 in Jurkat cells of Fbxo38knock down was detected by the western blot method.

FIG. 3FBXO38 catalyzes PD-1 to generate K-48 type polyubiquitination modification and promote degradation

a, detecting the ubiquitination of the PD-1 by FBXO38 and the influence of two lysines conserved in the PD-1 intracellular region on the ubiquitination of the PD-1 by using a co-immunoprecipitation and western blot technique in 293FT cells.

b, detecting the influence of FBXO38 overexpression on PD-1 ubiquitination in Jurkat cells by using a co-immunoprecipitation and western blot method.

And c, detecting the influence of FBXO38knock down on PD-1 ubiquitination in Jurkat cells by using a co-immunoprecipitation and western blot method.

d, detecting the influence of two conservative lysines K210 and K233 in the PD-1 intracellular region on PD-1 ubiquitination by using co-immunoprecipitation and western blot technology in 293FT cells.

And e, detecting the important function of the F-box sequence on the mediation of PD-1 ubiquitination by FBXO38 in 293FT cells by using a co-immunoprecipitation and western blot technology.

f, detecting the FBXO38 mediated PD-1 ubiquitination type in 293FT cells by co-immunoprecipitation and western blot technique. g, the effect of FBXO38 in promoting PD-1 degradation was examined in 293FT cells using western blot techniques.

h, the effect of two conserved lysines in the PD-1 intracellular domain in the degradation of PD-1 was examined in 293FT cells using western blot technique.

i.e.the role of the F-box sequence of FBXO38 in mediating PD-1 degradation was examined in 293FT cells using the western blot technique.

FIG. 4 Effect of Fbxo38 knockout on T cell development

a, WT and FBXO38-CKO mouse CD8⁺Protein levels of FBXO38 in T cells.

b, detecting CD4 in thymocytes of WT and CKO mice by using flow cytometry^-CD8^-(DN),CD4⁺CD8⁺(DP),CD4⁺CD8^-(CD4SP)and CD4^-CD8⁺(CD8SP) proportion of cells.

c, detecting WT and CKO mouse thymus CD4 by using flow cytometry^-CD8^-CD44 in cells⁺CD25^-(DN1),

CD44⁺CD25⁺(DN2),CD44^-CD25⁺(DN3) and CD44^-CD25^-(DN4) proportion of cells.

d, flow cytometry for CD4 in spleen of WT and CKO mice⁺And CD8⁺Proportion of T cells.

e, flow cytometry for CD4 detection in WT and CKO mouse lymph nodes⁺And CD8⁺Proportion of T cells.

f, detecting CD4 in the spleen of WT and CKO mice by using flow cytometry⁺In T cells

(CD44^loCD62L^hi),central memory(CD44^hiCD62L^hi(ii) a CM) and effector/effector memory (CD 44)^hiCD62L^lofactor/EM).

g, flow cytometry for CD4 detection in lymph nodes of WT and CKO mice⁺In T cells

(CD44^loCD62L^hi),central memory(CD44^hiCD62L^hi(ii) a CM) and effector/effector memory (CD 44)^hiCD62L^lo,

effect/EM).

h, flow cytometry is used for detecting WT and CKO mouse spleen CD8⁺In T cells

i.e.detection of WT andCD8 in lymph nodes of CKO mice⁺In T cells

effect/EM).

FIG. 5 Effect of Fbxo38 knockout on T cell activation

a, detection of unactivated WT and CKO CD8 by flow cytometry⁺TCR and CD28 surface levels of T cells.

b, detecting WT and CKO CD8 by flow cytometry⁺Expression level of CD44 following T cell activation in vitro.

c, detecting WT and CKO CD8 by flow cytometry⁺Expression level of LAG-3 following T cell activation in vitro.

d, detection of WT and CKO CD8 by flow cytometry⁺levels of IFN-. gamma.granzyme B and TNF- α following in vitro activation of T cells.

FIG. 6 Effect of Fbxo38 knock-out on T cell proliferation and apoptosis

a, detecting WT and CKO CD8 by Celltracker staining and flow cytometry⁺Proliferation of T cells following in vitro activation.

b, detection of WT and CKOCD8 using Annexin V and Propidium Iodide (PI) staining and flow cytometry⁺Apoptotic status of T cells.

FIG. 7Fbxo38 knock-out on CD8⁺Effect of T cell transcriptome

a, RNA-seq analysis WT and CKO CD8⁺T cells in

And the level of gene transcription in the activated state. The transcription levels of surface molecules, functional molecules and important transcription factors associated with T cell function are shown.

FIG. 8Fbxo38 regulating expression level of PD-1

a, detection of WT and CKO CD8 by flow cytometry⁺T is thinExpression level of PD-1 after in vitro activation.

b, detecting WT and CKO CD4 by flow cytometry⁺Expression level of PD-1 after in vitro activation of T cells.

And c, detecting the expression level of nTreg cell PD-1 in WT and CKO spleen by using a flow cytometry technology.

FIG. 9Fbxo38 modulates the anti-tumor immunocompetence of T cells

a, the effect of FBXO38 knock-out on mouse tumor growth was studied using the B16F10 subcutaneous tumor model.

B, the effect of FBXO38 knock-out on tumor-bearing survival of mice was studied using the B16F10 subcutaneous tumor model.

c, detecting the tumor infiltration of CD8 in a B16F10 subcutaneous tumor model by using a flow cytometry method⁺Expression level of CD44 in T cells.

d, detection of tumor infiltration of CD8 in B16F10 subcutaneous tumor model by flow cytometry⁺Expression level of PD-1 in T cells.

e, detection of tumor infiltration of CD8 in B16F10 subcutaneous tumor model by flow cytometry⁺Expression levels of cytokines in T cells.

F, detection of tumor infiltration of CD8 in B16F10 subcutaneous tumor model by flow cytometry⁺Expression level of Ki-67 in T cells.

g, CD8 of tumor infiltration in B16F10 subcutaneous tumor model⁺T cell, CD4⁺T cell number and ratio analysis.

h, analysis of the number of Treg cells infiltrated by the tumor in the B16F10 subcutaneous tumor model.

i, detection of tumor infiltration of CD4 in B16F10 subcutaneous tumor model by flow cytometry⁺Expression level of PD-1 in T cells.

j, detecting the expression level of PD-1 in tumor-infiltrating Treg cells in the B16F10 subcutaneous tumor model using flow cytometry.

FIG. 10Fbxo38 knock-out affects anti-tumor immunity of T cells

a, the effect of FBXO38 knockdown on mouse tumor growth was studied using the MC38 subcutaneous tumor model.

b, using stream typeCell technology detection of CD8 for tumor infiltration in MC38 subcutaneous tumor model⁺Expression level of PD-1 in T cells.

c, detecting the tumor infiltration CD4 in the MC38 subcutaneous tumor model by using the flow cytometry⁺Expression level of PD-1 in T cells.

d, detecting the expression level of PD-1 in tumor-infiltrated Treg cells in the MC38 subcutaneous tumor model by using a flow cytometry method.

e, CD8 of tumor infiltration in the MC38 subcutaneous tumor model⁺T cell, CD4⁺T cell number and ratio analysis.

f, analysis of the number of tumor-infiltrating Treg cells in the MC38 subcutaneous tumor model.

FIG. 11Fbxo38 knockdown did not affect activation of T cells

a, detecting the knocking-down efficiency of Fbxo38 by using a real-time fluorescent quantitative PCR technology.

b, using western blot technique to detect knockdown efficiency of Fbxo 38.

c, detecting the expression level of CD3 and CD28 on the cell surface after the Fbxo38 is knocked down by using a flow cytometry technology

d, detection of Fbxo38 knockdown by Western blot technique followed by in vitro activation of CD8⁺Alterations in T cell TCR signaling pathways.

e, detection of in vitro activated CD8 after knockdown of Fbxo38 by flow cytometry⁺Expression level of CD69 on the surface of T cells.

f, detecting in vitro activation 24 hours of Fbxo38 knockdown CD8 by flow cytometry⁺Expression level of IFN-gamma in T cell.

g, detection of in vitro activation of Fbxo38 knockdown for 48 hours by flow cytometry CD8⁺Expression level of IFN-gamma in T cell.

FIG. 12 knockdown of Fbxo38 upregulated the level of PD-1 and affected CD8⁺Tumor killing ability of T cells

a, detection of in vitro stimulated CD8 after Fbxo38 knockdown by flow cytometry⁺PD-1 levels on the surface of T cells.

And b, detecting the expression of PD-L1 in the EL-4 cells by using a flow cytometry technology.

c, ELISA detection of CD8 after Fbxo38 knockdown⁺In vitro killing of EL-4 cells by T cells.

d, flow assay of overexpression efficiency of Fbxo38 in mouse CTL.

e, depicted as flow-detecting the level of PD-1 after overexpression of Fbxo38 in mouse CTL.

f, as a statistical plot of PD-1 levels after flow-detecting overexpression of Fbxo38 in mouse CTLs.

FIG. 13FBXO38 endogenously regulates CD8⁺Anti-tumor capacity of T cells

a, shown schematically as an experimental approach for adoptive cellular immunotherapy in a B16F10 subcutaneous tumor model.

b, flow assay of reinfused CD8 in day 18 tumor-infiltrating lymph nodes (dLN)⁺T cells (GFP)⁺) The ratio of (a) to (b).

c, flow assay of returned CD8 in day 18 non-tumor infiltrating lymph nodes (non-dLN)⁺T cells (GFP)⁺) The ratio of (a) to (b).

d, flow assay of reinfused CD8 in day 18 tumor-infiltrating lymph nodes (dLN)⁺T cells (GFP)⁺) The level of PD-1 of (1).

e, flow assay for reinfused CD8 in day 18 tumor-infiltrating lymph nodes (dLN)⁺T cells (GFP)⁺) The level of Ki-67.

f, growth curves of mouse tumors after adoptive immunotherapy followed by Fbxo38knock down.

g, survival curves of mice after adoptive immunotherapy following Fbxo38knock down.

h, growth curves of mouse tumors after Fbxo38knock down followed by adoptive immunotherapy combined with PD-1 antibody treatment.

i, survival curves of mice after Fbxo38knock down followed by adoptive immunotherapy combined with PD-1 antibody treatment. In all figures, Error bars stands for mean +/-SEM.

ns represents no significant difference, P <0.05, P <0.01, P <0.001.

Detailed Description

To date, studies on the regulation of PD-1 expression have focused on the transcriptional level, and no studies have been published on the post-transcriptional level of PD-1. At present, the regulation of the PD-1 protein at the posttranslational level is still blank. In the research of the invention, the PD-1 can be degraded by the ubiquitination of the PD-1, so that the functions of activation, proliferation, cytokine secretion and the like of T cells are enhanced, the killing function and the proliferation capacity of T cells infiltrated by tumors are improved, the tumor cells are killed by an immune system, the FBXO38 is a target point capable of promoting the ubiquitination of the PD-1, and the degradation of the PD-1 can be remarkably promoted by promoting the expression of the FBXO 38.

Ubiquitin is a highly conserved polypeptide consisting of 76 amino acids in eukaryotic cells, and can be covalently cross-linked to lysine of a target protein through the action of three enzymes (E1: Ub-activating enzyme; E2: Ub conjugating enzyme; E3: Ub protein ligand), so as to form ubiquitination modification on the target protein, further influence the signal path of the target protein or degrade the target protein through proteasome. Ubiquitination regulates many important physiological processes within the cell, such as controlling the cycle, down-regulating membrane proteins, participating in signal transduction, and the like. The target protein lysine can be connected with one ubiquitin to form mono-ubiquitination modification, and can also be connected with a plurality of ubiquitinations to form polyubiquitination modification. In polyubiquitination, polyubiquitination mediated by lysine 48 on ubiquitin generally degrades the target protein through the proteasome pathway, and polyubiquitination mediated by lysine 63 on ubiquitin plays a role in many signal transduction pathways.

The PD-1 ubiquitination refers to that ubiquitin is connected to lysine of PD-1, ubiquitination modification is carried out, the signal path of PD-1 is influenced, or PD-1 is degraded through a proteasome.

PD-1 ubiquitination agonists

Refers to a molecule having a promoting effect on PD-1 ubiquitination.

Further, the PD-1 ubiquitination agonist can promote the degradation of PD-1.

Further, the PD-1 ubiquitination agonist is an FBXO38 agonist.

Further, the FBXO38 agonist is a molecule having a promoting effect on FBXO 38.

Enhancing FBXO38 activity refers to increasing FBXO38 activity. Preferably, FBXO38 activity is increased by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% as compared to its activity prior to enhancement.

Promoting the transcription or expression of FBXO38 gene means that: accelerating the transcription of FBXO38 gene, or increasing the transcription activity of FBXO38 gene, or accelerating the expression of FBXO38 gene, or increasing the expression activity of FBXO38 gene.

The regulation of gene transcription or expression of FBXO38 can be performed by one skilled in the art using conventional methods.

Preferably, FBXO38 gene transcription or expression is increased by at least 10%, preferably by at least 30%, even more preferably by at least 50%, even more preferably by at least 70%, most preferably by at least 90% compared to the wild type.

PD-1 ubiquitination agonist preparation medicine

PD-1 ubiquitination agonist is used as main active ingredient or one of the main active ingredients to prepare the medicine. Generally, the medicament may comprise one or more pharmaceutically acceptable carriers or excipients in addition to the active ingredient, according to the requirements of different dosage forms.

By "pharmaceutically acceptable" is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

A "pharmaceutically acceptable carrier or adjuvant" should be compatible with, i.e., capable of being blended with, a PD-1 ubiquitinated agonist without substantially diminishing the effectiveness of the pharmaceutical composition under ordinary circumstances. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered gum tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as glycerol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tabletting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration.

In the present invention, unless otherwise specified, the pharmaceutical dosage form is not particularly limited, and may be prepared into injection, oral liquid, tablet, capsule, dripping pill, spray, etc., and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched to the mode of administration.

Combination therapeutic drug combinations and methods of administration

one) PD-1 ubiquitination excitomotor and other antitumor drugs are respectively prepared into independent preparations, the preparation formulations can be the same or different, and the administration routes can be the same or different. When in use, several medicines can be used simultaneously or sequentially. When administered sequentially, the other drugs should be administered to the body during the period that the first drug is still effective in the body.

Secondly), PD-1 ubiquitination excitomotor and other anti-tumor drugs are prepared into compound preparations. When the PD-1 ubiquitination agonist and the other antitumor agent are administered by the same administration route and simultaneously administered, the two may be formulated into a compound preparation.

The antibody is usually administered by intravenous injection, intravenous drip or arterial infusion. The usage and the dosage can refer to the prior art.

The small molecule compounds are usually administered by either gastrointestinal or parenteral administration. The siRNA, shRNA and antibody are generally administered parenterally. Can be administered locally or systemically.

An effective amount of a PD-1 ubiquitination agonist and an effective amount of other tumor treatment drugs may be administered simultaneously or sequentially. When in use, the effective dose of the PD-1 ubiquitination stimulant and the effective dose of other tumor treatment medicines can be used simultaneously, and the effective dose of the PD-1 ubiquitination stimulant and the effective dose of the other tumor treatment medicines can be used successively. When administered sequentially, the other drug should be administered to the organism during the period that the first drug is still effective for the organism.

Chemotherapeutic agents include alkylating agents (e.g., nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, and glyphosate), antimetabolites (e.g., nucleotide analogs such as doxifluridine, doxycycline, fluorouracil, mercaptopurine, methotrexate), antitumor antibiotics (e.g., antibiotics such as actinomycin D, doxorubicin, and daunorubicin), antitumor animal and plant components (e.g., vinorelbine, taxol, cephalotaxine, irinotecan, taxotere, and vinblastine), antitumor hormonal agents (e.g., atalmentane, anastrozole, aminoglutethimide, letrozole, formestane, and tamoxifen), and conventional chemotherapeutic agents such as cisplatin, dacarbazine, oxaliplatin, lesonidine, carboplatin, mitoxantrone, and procarbazine.

Targeted drugs include EGFR blockers such as Gefitinib (Gefitinib, Iressa and Iressa) and Erlotinib (Erlotinib, Tarceva), monoclonal antibodies to specific cell markers such as Cetuximab (Cetuximab, Erbitux) and anti-HER-2 mabs (Herceptin, Trastuzumab, Herceptin), tyrosine kinase receptor inhibitors such as Crizotinib (Crizotinib, Xalkori), anti-tumor angiogenesis drugs such as Bevacizumab, endostatin and Bevacizumab, etc., Bcr-Abl tyrosine kinase inhibitors such as Imatinib and Dasatinib, anti-CD 20 mabs such as Rituximab, IGFR-1 kinase inhibitors such as NVP-AEW541, mTOR kinase inhibitors such as CCI-779, ubiquitin-proteasome inhibitors such as Bortezomib, etc.

Other tumor treatment modalities may be selected from one or more of surgical resection, radio frequency ablation, argon helium superconducting surgical treatment, laser ablation therapy, high intensity focused ultrasound, and radiation therapy including X-ray, R-ray, 3D-CRT, and IMRT.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ conventional techniques in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, gene mutation techniques, and related fields.

Example 1

1.1 Experimental materials

1.1.1 buffer formulation

Lysine Buffer for Co-IP (used for Co-immunoprecipitation assays in 293FT cells and Jurkat cells): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na₃VO4,20mM NaF,10mMIodoacetamide,0.5％NP40,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Lysine Buffer for inactivation (activated CD8 for mouse and human use)⁺T cell lysis, detection of ubiquitination modification of PD-1): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na₃VO4,20mMNaF,10mM Iodoacetamide,1％NP40,0.1％SDS,1mM PMSF,1mM DTT,Complete ProteaseInhibitor Cocktail(Sigma)；

Lysis Buffer for ubiquitin 1 (for Ubiquitination assay in 293FT cells, containing 1% SDS): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na₃VO4,20mM NaF,10mMIodoacetamide,1％NP40,1％SDS,1mM PMSF,1mM DTT,Complete Protease InhibitorCocktail(Sigma)；

Lysis Buffer for ubiquitin 2 (for Ubiquitination assay in 293FT cells, without SDS): 50mM Tris-HCl, pH 7.4,155mM NaCl,2mM EDTA,2mM Na₃VO4,20mM NaF,10mMIodoacetamide,1％NP40,1mM PMSF,1mM DTT,Complete Protease Inhibitor Cocktail(Sigma)；

Tris buffer: 50mM Tris,200mM NaCl, pH 8.0;

PBS buffer: 8g NaCl,0.2g KCl,3.58g NaH₂PO₄·12H₂O,0.27g K₂HPO₄Fixing the volume to 1L, adjusting the pH value to 7.4, and sterilizing at high temperature and pressure;

protein electrophoresis buffer (Tris-glycine): 25mM Tris, 250mM glycine, 0.1% SDS;

protein Transfer Buffer (Transfer Buffer): 39mM glycine, 48mM Tris, 0.037% SDS;

striping Buffer: 1.5% glycine, 0.1% SDS, 1% Tween 20, adjust pH to 2.2;

TBST buffer: 150mM NaCl, 50mM Tris, 0.1% Tween 20, adjusted to pH 7.4, was used to formulate primary, secondary and blocking solutions for immunoblotting.

Immunoblot blocking solution 10% BSA in TBST Buffer;

magnetic bead sorting buffer (mouse/human CD 8)⁺T cell): dissolving 2% FBS and 2mM EDTA in PBS, adjusting pH to 7.2, and performing filtration sterilization by using a 0.2 mu M filter membrane;

surface staining buffer: 0.1% BSA in PBS Buffer;

intracellular staining buffer: 0.5% BSA in PBS Buffer, 0.1% Triton X-100;

1.1.2 chemical reagents

1.1.3 kits, cytokines, genetic tools and enzymes

1.1.4 cell lines

Jurkat cell line: peripheral blood isolated from 14 year old boys with one T cell leukemia in the 70 th 20 th century, cells in suspension, a common cell line for studying T cell signaling, could be activated by either CD3 antibody or PMA + Ionomycin. In the paper, Fbxo38 gene is mainly overexpressed or knocked down in Jurkat cell line, so as to detect the expression level and ubiquitination modification of PD-1.

HEK-293FT cell line: 293F cell is a cell strain derived from human embryonic kidney cells, wherein adenovirus 5 type DNA fragments are transfected, and the cell can activate promoters of certain viruses, promote protein expression and has a faster growth rate. 293FT cells were transfected with the SV40 large T antigen on the basis of 293F cells and were capable of very high level expression from vectors containing the SV40 origin. The 293FT cell line grows rapidly, is very easy to transfect, is a cell line commonly used in laboratories and is used for over-expressing genes or carrying out lentivirus packaging.

B16F10 melanoma cell line: melanoma was isolated from skin tissue of C57BL/6 mice and was spindle-shaped, epithelial in shape. The cell is adherent, easy to transfect and can be stably passaged. The cell is mainly used for mouse melanoma tumor model construction and researches on cell proliferation, apoptosis, signal transduction and the like

B16F10-OVA cell line: OVA antigen is overexpressed in the B16F10 cell line and presented by the cells to the surface, and OVA antigen peptide presented as an antigen presenting cell stimulates activation of OT-1-derived T lymphocytes. The cell line successfully activated OT-1 derived T lymphocytes for use in the ACT model.

EL4 cell line: mice with C57 background lymphoma from EL4 cell line, cultured in 1640 medium, appeared semi-suspended and slightly adherent. Through PD-L1 detection, the EL4 cell highly expresses PD-L1 protein and can be used for CD8⁺Killing experiment of T cells.

1.1.5 introduction to the plasmid

pHAGE-fEF1a-IRES-ZsGreen/mCherry (pHAGE vector): protein overexpression and lentiviral packaging vectors, the promoter is fEF1a, with an IRES sequence. IRES is a special DNA sequence, can independently initiate the translation process in the middle of mRNA, and is connected with fluorescent protein ZsGreen/mCherry behind IRES, which can be used as the indicator of successful cell transfection. Meanwhile, the vector has LTRs sequence, can be used for packaging lentivirus and is used for transfecting difficultly transfected cell lines, such as Jurtat cell line and mouse primary CD8⁺T cells.

pHAGE-fEF1 a-HA-PD-1-IRES-mCherry: the Pdcd1 sequence with HA tag at the N-terminal is inserted into pHAGE vector and is positioned before IRES-mCherry. After transfection of cells, the HA-tagged PD-1 molecule can be expressed intracellularly, with mCherry indicating a positive cell.

pHAGE-fEF1a-3Myc-FBXO 38-IRES-ZsGreen: firstly, the method is carried out on the basis of a pHAGE vector

pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid. 3 pairs of complementary fragments:

complementary strand 1A (SEQ ID NO. 2):

5’-CAGGTGTCGTGAAGCATGGAACAGAAATTGATAAGTGAGGAAGATTTAG-3’；

complementary strand 1B (SEQ ID NO. 3):

5’-TTGCTCTAAATCTTCCTCACTTATCAATTTCTGTTCCATGCTTCACGACACCTG-3’；

complementary strand 2A (SEQ ID NO. 4):

5’-AGCAAAAGCTCATTTCTGAAGAGGACTTGGAACAGAAATTGATAAGTGAGGAAGATT-3’

complementary strand 2B ((SEQ ID No. 5):

5’-CCGCTAAATCTTCCTCACTTATCAATTTCTGTTCCAAGTCCTCTTCAGAAATGAGCTT-3’；

complementary strand 3A (SEQ ID NO. 6):

5'-TAGCGGCCGCAGCAATGCATGCAGGCGCGCCAGAAACGCGTGGGCACCGGTCTGCAGC-3', respectively; complementary strand 3B (SEQ ID NO. 7):

5’-GCTGCAGACCGGTGCCCACGCGTTTCTGGCGCGCCTGCATGCATTGCTGCGG-3’。

putting the three tubes into boiling water, and naturally cooling to room temperature with the boiling water. The DNA fragments were each gel-backed. Then the three DNA fragments are connected together by T4 ligase, and the connection product is glued back to obtain a 3Myc fragment, wherein the fragment is about 160 bp. The pHAGE vector is cut by Not I incision enzyme and is glued back, and finally, the cut pHAGE-fEF1a-IRES-ZsGreen vector and the 3Myc fragment are connected by a GBclonart seamless cloning kit to prepare pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid. The cDNA is taken as a template, and the cDNA is obtained,

with Fbxo38 upstream primer (SEQ ID NO. 8):

5'-TGAGGAAGATTTAGCGATGG GGCCACGAAA GAAAAGTG-3' and

fbxo38 downstream primer (SEQ ID NO. 9):

5’-TGCATGCATT GCTGCTTAAA TGTAGTCATC TTCAACTG-3’；

fbxo38 was amplified and the product was recovered by gel. The pHAGE-fEF1a-3Myc-IRES-ZsGreen plasmid was cut with endonuclease Not I and ligated using GBclonart seamless cloning kit. The plasmid pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen was prepared. After transfection of cells, the Myc-tagged FBXO38 molecule can be expressed intracellularly, ZsGreen indicating positive cells.

pHAGE-fEF1 a-V5-Ub-IRES-ZsGreen: the Ub sequence with a V5 tag at the N-terminal was inserted into the pHAGE vector before IRES-ZsGreen, and used for detecting ubiquitination modification of PD-1 protein in 293FT cells, including Ub WT, UbK48R (changing the lysine at position 48 of Ub to R), UbK63R (changing the lysine at position 63 of Ub to R), and UbKtoR (changing both the lysine at positions 48 and 63 of Ub to R).

MSCV-3Myc-FBXO 38-IRES-ZsGreen: the following primers were used:

fbxo38 upstream primer (SEQ ID NO. 10):

5’-GCGCCGGAATTAGATCTCATGGAACAGAAATTGATAAGTGAGGAAG-3’

fbxo38 downstream primer (SEQ ID NO. 11):

5’-GGGCGGAATTCGTTAACCTTAAATGTAGTCATCTTCAAC-3’

the 3Myc-FBXO38 gene was amplified from pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen plasmid. Simultaneously the MSCV vector was cut with restriction enzyme XhoI and glued back. And ligated using the GBclonart seamless cloning kit. The MSCV-3Myc-FBXO38-IRES-ZsGreen plasmid was prepared. After transfection of cells, the Myc-tagged FBXO38 molecule can be expressed intracellularly, ZsGreen indicating positive cells.

pHAGE-fEF1a-3Myc-FBXO 47-IRES-ZsGreen: the sequence of Fbxo47 with 3 consecutive Myc tags at the N-terminus, preceded by IRES-ZsGreen, was inserted into the pHAGE vector. After transfection of cells, the Myc-tagged FBXO47 molecule can be expressed intracellularly, ZsGreen indicating positive cells.

Plko.1g vector: for generating gene-specific shRNAs, knocking down specific genes in cells. The vector can express GFP protein, is used for indicating positive cells, and can be used for screening. In the subject, the vector was used to generate CD8 in Jurkat and mice⁺Knockdown of Fbxo38 gene in T cells.

psPAX2 and pmd2. g: both of the second generation lentiviral packaging plasmids were used with the pHAGE vector as a three plasmid system to generate lentiviruses. The main elements of psPAX2 include the promoter followed by GAG, POL, TAT, REV sequences, and pmd2.g includes primarily the promoter followed by ENV sequences. In the present invention, psPAX2 and pMD2.G can be lentivirally packaged by transfecting 293FT cell lines with pHAGE vector and PLKO.1G vector.

Introduction to 1.1.6 antibodies

1.1.7 introduction to Experimental animals

Fbxo38 gene conditional knockout mice: fbxo38^flox/floxMice were purchased from Karchi Biotech, Inc. of North China (Beijing CasGene Biotech), and designated as generation F0. After 8 weeks of growth in the F0 mouse, the mice were combined with CD4^creAfter the mice are mated for multiple generations, Fbxo38 of the FBXO38 protein which is specifically knocked out in CD4 and CD8 cells can be obtained^CKOA mouse.

OT-1 mouse C57BL/6-Tg (Tcr α, Tcr β)1100Mjb/J, and Tcr α -V2 and Tcr β -V5 genes are inserted into a mouse transgenic group, so that the transgenic T cell receptor of the mouse can only recognize Ovalbumin 257-264 (OVA)_257-264) Peptide fragment of residue at position to study CD8⁺T cell response to antigen. Like most TCR transgenic mice, these mice are somewhat immunodeficient. The mice were on C57BL/6 background and purchased from

mice。

C57BL/6 mice: purchased directly from Shanghai SLAC, SPF grade, 8-10 weeks for animal testing.

All mice used in the present invention were raised in an SPF environment, and both Fbxo38 conditional knockout mice and OT1 mice were identified by PCR prior to use. In tumor experiments, the age difference between the mice in the control group and the mice in the experimental group is within 2 weeks, and the sexes are consistent.

1.2 Experimental methods

1.2.1 cell experiments

1.2.1.1 transfection of 293FT cells with liposomes

1, carrying out cell passage according to the ratio of 1:4-1:8 1-2 days before cell transfection. Digesting 293FT cells (with the density of 90-100%) for 1 minute by using pancreatin, removing the pancreatin, then quickly adding a DMEM culture medium, resuspending, blowing, beating and uniformly mixing, then passaging to a new 10cm culture dish, blowing and beating by using a pipetting gun for several times, and thoroughly and uniformly mixing to avoid cell agglomeration and crowding.

2, 4h before cell transfection, the solution is changed. When the cell density reached about 50%, the old medium was replaced with new DMEM medium. 6ml of old medium can be pipetted off and 6ml of fresh DMEM medium preheated to 37 ℃ is slowly added and the culture is continued for 4 h.

And 3, transfection. According to different experimental purposes, different plasmid transfection amounts are selected, and the amount of the Lipofectamine2000 transfection reagent is correspondingly adjusted.

In general, the amount of Lipofectamine2000 (μ l)/mass of plasmid (μ g) is 2: 1. The specific transfection steps are as follows: adding 250 μ l OPTI-MEM culture medium into 2 Ep tubes of 1.5mL, respectively, adding 10 μ g plasmid into one tube, adding 20 μ l Lipofectamine2000 transfection reagent into the other tube, respectively mixing, and standing for 5 min; then, mixing the two tubes of solution under sterile condition, and standing for 20min at room temperature; then, the mixture was added dropwise to the cell culture medium, followed by gently mixing, and the mixture was placed in a 37 ℃ cell culture chamber to continue the culture. For the PD-1 ubiquitination experiments, the plasmid transfection amount in 10cm dishes was: Myc-Fbxo 3815 μ g, HA-Pd13.5 μ g, V5-Ub 3 μ g, Lipofectamine 200030 μ l; for the PD-1 degradation experiments, the plasmid transfection amount in 6cm dishes was: 384. mu.g of Myc-Fbxo, 11. mu.g of HA-Pd, 200010. mu.l of Lipofectamine.

After 4, 24-72h, the cells successfully transfected express fluorescent protein by observing the positive rate under a fluorescent microscope.

The experimental method is suitable for over-expressing genes in 293FT cells or carrying out lentivirus packaging.

1.2.1.2 Lentiviral systemic infection of Jurkat cell line

Lentiviral packaging was performed as described in 1.2.1.1, and the packaging plasmid and the gene of interest plasmid were transfected into 293FT cell line using Lipofectamine 2000. The mass of the plasmid is typically: 10. mu.g of the plasmid of interest + 7.5. mu.g of psPAX2+ 3. mu.g of pMD2. G.

2, after transfection for 24h, the positive rate should reach more than 80% when observed under a fluorescence microscope. If the molecular weight of the target protein is large, the transfection efficiency may be low.

3, after 48-60h of transfection, virus supernatants were collected. The viral supernatant was carefully placed in a 15ml centrifuge tube, centrifuged at 6000rpm/min for 5 minutes, filtered through a 0.45 μm syringe filter to obtain a lentiviral supernatant, and the lentiviral supernatant was then used directly to infect Jurkat cells. Generally, 1-2X 10mL of virus solution may be added⁶Jurkat T cell, for safety, the supernatant was placed in a culture flask to infect the cells. After 72 hours of infection, significant fluorescence was seen. If the target gene is very large, such as 3500bp gene like Fbxo38, the positive rate is slightly low, generally 30%; in the case of a DNA sequence of only 20bp such as shRNA, the positive rate is generally 100%.

4, the fluid is changed after 72-96h of infection. Centrifuging the virus supernatant according to 500g, suspending the cells by using fresh 1640 culture medium, and continuously culturing for 72-96h to obtain relatively stable positive cells, wherein the positive cells can be sorted by using a flow cytometer.

1.2.1.3 Lentiviral systems infecting mouse Primary cell lines

(1) Virus package

Lentiviral packaging was performed as described above, using Lipofectamine2000 to transfect 293FT cell line, the mass of plasmid was: 10 μ g PLKO.1G +7.5 μ g psPAX2+3 μ g pMD2. G. Each shRNA was transfected into three 10cm dishes for subsequent virus concentration.

2, the virus supernatants were collected as described above, filtered through a 0.45 μm syringe filter, and 3 virus supernatants were placed in a 38ml ultracentrifuge tube, centrifuged at 27000rpm/min for 4 ℃ 2 h. After centrifugation, the supernatant was quickly decanted, 500. mu.l of FBS-free 1640 medium was added along the tube wall, the virus was resuspended, placed at 4 ℃ and used overnight.

(2)CD8⁺T cell culture and infection

1, sorting with magnetic beads

CD8⁺T cells cultured in the following Medium: RPMI-1640+ 10% FBS + 1% PS + IL-7(10ng/ml) + IL-15(100ng/ml) +0.05mM 2-mercaptoethanol, 200 ten thousand cells per well were cultured for 48-72h, and it was observed that the cell volume became large and a small cell mass appeared. One day prior to infection, RereoNectin (1mg/ml, T100B, Takara) diluted in PBS was plated in 24-well plates (cat # 351147, BD), typically 400. mu.l/well, overnight at 4 ℃.

2, counting the cells, and then culturing the CD8⁺T cells were centrifuged, and 200 ten thousand CD8 were collected by centrifugation in 200 ten thousand/15 ml tubes, and after removing the supernatant, 200 ten thousand CD8 were collected by centrifugation with 500ul of concentrated virus supernatant⁺T cells were then added slowly to the RereoNectin-plated wells washed once with PBS, and centrifuged at 37 degrees and 2000g for 60 min.

3, after centrifugation, the cells were plated onto the bottom of 24-well plates, the supernatant was removed directly, and incubation was continued for 3 days with fresh medium containing IL-7 and IL-15.

And 4, detecting the positive rate by using a flow cytometer or a fluorescence microscope. Positive cells may be sorted for GFP expression for subsequent function or the cells may be expanded for use in the ACT model.

During the whole infection, the cells will assume the state of memeryllike when cultured in medium containing IL-7 and IL-15 only, but without activating TCR signal, so that these cells do not express PD-1 protein.

1.2.1.4 retroviral System overexpression of FBXO38 in a mouse Primary cell line

Mouse CD8 using retrovirus MSCV⁺FBXO38 protein is overexpressed in T cells.

(1) Virus package

1, retroviral packaging as described in 1.2.1.1, using Lipofectamine2000 to transfect MSCV-3Myc-FBXO38-IRES-ZsGreen plasmid into plat E cells.

2, after 48 hours of transfection, the virus supernatant was collected, filtered through a 0.45 μm syringe filter, and then concentrated 50-70-fold at room temperature at 3000g centrifugation speed using an ultrafiltration tube (Millipore,100 KD).

3, the spleens of OT1 mice were removed, ground, red blood cells lysed, and activated for 24 hours in 1640 medium containing 10nM OVA and 10ng/ml IL-2. Activated cells were resuspended in RetroNectin (1mg/ml, T100B, Takara) pre-treated 24-well plates using 1ml of virus medium (including 500ul of concentrated virus, 500ul of fresh complete RPMI-1640 medium and 10. mu.g/ml polybree). Subsequently, the cells were centrifuged at 2500rpm at 37 ℃ for 2 hours, and then cultured in an incubator for 10 hours. Then transfected again as above. After two transfections, cells were resuspended in fresh complete RPMI-1640 medium for culture. GFP positive cells are cells that are over-expressed with FBXO 38. In the above process, there was always 10ng/ml IL-2 in the medium.

1.2.2 animal experiments

1.2.2.1 isolation of CD8+ cells in mouse spleen

1, taking Fbxo38 for about 8-10 weeks^CKOOr C57BL6 mice, cervical dislocation lethal;

sterilizing with 70% ethanol 2, taking out spleen, placing in PBS, mashing whole spleen with forceps, grinding, and sieving with 40 μm nylon filter screen to obtain single cell suspension;

3,500 g for 5min, resuspended to 10 with MACS buffer⁸(iv)/mL, transferred to a 5mL flow tube;

5, 1mL of the cells were added with 15. mu.L of Biotin-labeled negative selection antibody Cocktail (Stem Cell, mouse CD 8)⁺T Cell Isolation Kit, 19852), incubated for 15 minutes at room temperature;

6, adding 30 mu L of Streptavidin cross-linked magnetic beads, and continuously incubating for 5 minutes at room temperature;

7, adding MACS buffer to 3mL volume, then inserting a flow tube into a magnetic pole, and standing for 2 minutes at room temperature;

8, turning over the magnetic pole, pouring the liquid into a new 15mL centrifuge tube, and centrifuging for 10min at 400g and 4 ℃;

9, resuspending in PBS or RPMI-1640 medium, counting, and screening the cells to obtain CD4⁺Or CD8⁺A T cell;

10, taking a small part of cells, and after staining with anti-CD4 or anti-CD8, detecting the purity of the cells by flow staining, wherein the purity is generally more than 90%.

1.2.2.2anti-CD3/CD28 antibody activated mouse CD8+ cells

One day in advance, the antibody was diluted with PBS PH 9.0 to a final concentration of anti-CD3(2 μ g/ml) + anti-CD28(2 μ g/ml). In a 48-well plate, 140. mu.l of PBS is typically added.

Isolation of mouse Primary CD8⁺T cells were counted and resuspended to 4X 10 in RPMI 1640 medium containing 10% FBS +10ng/ml IL-2⁵Perml, add to 48 well plates, 40 million cells per well.

3, 24-96h, collecting the cells, and carrying out surface staining to detect PD-1 expression or internal staining to detect cytokine secretion.

And 4, surface staining and detecting the expression of cell surface molecules. After harvesting the cells, the cells were centrifuged at 400g for 5 minutes at room temperature to remove the supernatant, and 500. mu.l of 4 ℃ precooled PBS was added to the supernatant, followed by centrifugation to remove the supernatant again. After that, the cells were resuspended in a PBS + 0.1% BSA + antibody staining solution and left at 4 ℃ in the dark for 45 minutes. Then, 500. mu.l of PBS was added, and the mixture was centrifuged at 400g 4 ℃ for 5 minutes to remove the supernatant, and then 500. mu.l of PBS was added to resuspend the cells for flow assay.

after the cells are harvested, surface staining is usually performed, for example, CD8 molecules on the cell surface are labeled with anti-CD8, the method is the same as the above method, after the cells are washed once with PBS, 300 mu L of 4% PFA is added, the cells are fixed at room temperature for 10 minutes, then 1500g is centrifuged for 5 minutes, supernatant is removed, 1ml of PBS is added, 1500g is centrifuged once, then PBS + 0.5% BSA + 0.1% Triton X-100+ antibodies (such as IFN-gamma, TNF- α, Granzyme B) are added, 4-degree staining is performed for 2 hours or overnight, 500 mu L of PBS is added, 1500g is centrifuged, supernatant is removed, and 500 mu L of PBS is added for resuspension.

And 6, detecting cell proliferation. In stimulating CD8⁺Before the cells, 0.5 μm viable cell dye CellTracker was used^TMDeep Red fluorescent dye (C34565, Thermo Fisher Scientific) was incubated at 37 ℃ for 20 minutes, then washed three times with PBS, washed off the dye and stimulated. Cells were harvested at various times and proliferation was detected by flow cytometry.

And 7, detecting apoptosis. CD8⁺After the cells, the cells were harvested at different times and the apoptosis was detected using an apoptosis kit (eBioscience)。

1.2.2.3 Induction of murine CTL cells OT1

1, killing the mouse by dislocation of cervical vertebra, sterilizing by 70% ethanol, and taking out the spleen.

2, 5mL of PBS was added to a 6cm dish, and the cell strainer was placed in the dish. The spleen was shredded with forceps, placed on a filter screen, and ground with a syringe plunger until all cells diffused through the screen into PBS.

And 3, adding the obtained cell suspension into a 50mL centrifuge tube, adding 45mL erythrocyte lysate, reversing, uniformly mixing, and standing for 2-3 min. Centrifuge at 500g for 5min and discard the supernatant.

4, resuspend with 50mL PBS, filter with cell strainer (optional), centrifuge at 500g for 5min, and discard the supernatant.

5, resuspend the cells in 30mL1640 medium, add 30. mu.L of 10. mu.g/mL IL-2 (final concentration 10ng/mL), 3. mu.L of 100. mu.M OVA_257-264(final concentration 10nM), mixing, adding into medium-sized culture flask, and culturing in cell culture box.

6, the culture medium turns yellow after three days generally, then the liquid is changed every day, the culture medium is passaged according to the ratio of 1:3, and the cell state is better on the fifth day. Meanwhile, cells can be taken every day for surface staining, and the expression level of PD-1 can be detected.

1.2.2.4 killing assay of CD8+ cells

1, induction of CTL. CTL-induced generation of CTL cells from spleen of OT1 mouse was performed according to the method described in 1.2.2.3, and the cell status was generally tested with CTL cells from the fifth to sixth days, at which time the cell status was good.

2, target cells EL-4 cells were treated with 10nM OVA_257-264Incubation at 37 ℃ for 1 hour; effector CTL cells and target cells were washed twice with killing buffer (phenolfree-RPMI, 2% FBS) and resuspended at 1million/mL and 0.1million/mL, respectively. Adding 100 mu L of target cells into a U-shaped bottom 96-well plate every empty period; the CTL cells diluted in gradient are added according to the ratio of the fixed effector CTL cells to the target cells (10:1,5:1,2.5:1,1.25:1), 250g of the mixture is centrifuged for 4min, the mixture is incubated in an incubator for 4h, 50 mu L of supernatant is collected, LDH released by target cell death is detected by using a Promega kit, and the killing efficiency of the effector CTL cells is calculated. To pairThe illumination holes are arranged according to the requirements of the kit.

1.2.2.5B16F10 and MC38 tumor models

1, B16F10 and MC38 cells. The cells were digested with pancreatin, washed three times with PBS, filtered through a 40 μm filter to give a single cell suspension, and the cell density was adjusted to 3.2 millions/ml. When B16F10 cells are cultured, attention is paid to timely replacing the culture medium to avoid the influence of overlarge cell density on the cell state. In the course of digestion with pancreatin, the digestion time of B16F10 was slightly longer than 293FT, approximately 1.5 minutes, and the digestion time of MC38 cells was relatively short, approximately 45 seconds. Before the mice are inoculated, the cell density of B16F10 and MC38 is controlled to be about 80%, and the cell state is the best at this time, and the tumor formation rate is the highest.

2, B16F10 and MC38 cell transplantation: the tumor cell transplantation experiment is carried out by using mice of 8-10 weeks old, and the concrete operations are as follows: 100 μ L of anesthetized mice were intraperitoneally injected with 3% sodium pentobarbital, and 0.4million B16F10 or 0.5million MC38 single cell suspension was injected subcutaneously into the epidermis of the mouse slightly below the back and near the abdomen, in a volume of 125 μ L. In C57BL/6 background mice, tumor formation was visually observed after 6-8 days following subcutaneous injection of tumor cells.

Tumor measurements and sacrifice. Approximately 8-10 days, tumor size was recorded with a vernier caliper and measured for the long diameter (mm) and wide diameter (mm) of the tumor, expressed as the long diameter multiplied by the wide diameter. Generally, tumors reach 10mm × 10mm around day 13 and 15mm × 15mm around day 18-20. And (3) euthanizing a mouse with the tumor length or width of more than 15mm, or a mouse with the tumor ulceration of more than 10mm, or a mouse with the affected part of the tumor with skin ulceration to secondary infection in the experimental process and the feeding process.

generally, on days 14-16, when the tumor size is around 12mM X12 mM, the cervical vertebrae are dislocated to sacrifice the mouse, sterilized with 70% ethanol, the spleen is removed and cut into small pieces (3mM X3 mM) and resuspended with 10ml of a digestive fluid (5% FBS,20mM Glutamine,50 μ M β -mercaptoethanol,1.6mg/ml Collagenase IV,1.6mg/ml Collagenase I, 0.02% DNase I), placed in a 37 degree rotating bed and rotated for 1.5 hours, it can be seen that the tumor tissue is digested into a cell suspension, leaving only a small amount of fat or decapitated hoof tissue, followed by filtration with a 70 μ M filter to obtain a suspension, followed by density gradient centrifugation with 40% and 70% Percoll, the tumor-infiltrated lymphocytes will be enriched at the interface of 40% and 70% in, after aspiration with a pipette or pipette gun, the lymphocytes are washed with a medium containing equal aliquots of 40% PBS, stained with 84 g of CD-84, and the cells are detected after direct staining with a medium containing CD-84 g CD-84, expressing CD-expressing the tumor-CD-expressing the cell growth factor.

1.2.2.6 Adoptive Cell Therapy (ACT) model

1, 0.4million B16F10-OVA cells were inoculated subcutaneously into C57 mice according to the method described in 1.2.2.5, with at least 15 mice per experimental group.

2, following the procedure of 1.2.1.3 lentivirus systemic infection of mouse primary cell lines, knockdown of the Fbxo38 gene in OT1 background CD8 cells, sorting GFP positive cells and continuing the culture with medium containing IL-7 and IL-15 for three-four days, generally cells can be expanded three times.

3, fourth day after B16F10-OVA cell injection, 1.25 millions/Fbxo 38 knockdown cells were injected in tail vein, and PBS was injected in control group.

4, counting the tumor sizes of the control group and the experimental group at about 8-10 days, and counting once every two days.

5, if it is desired to analyse the phenotype of the transferred OT1CD8T cells, the mice are sacrificed around day 18; if anti-PD-1 in combination with ACT treatment is required, the PD-1 antibody is injected around day 10, the clone number of the PD-1 antibody is J43, 100. mu.g/mouse, once every three days, for a total of four injections.

1.2.2.7RNA-seq, library construction and Credit analysis

1, RNA-seq sample preparation. From three pairs of female Fbxo38^CKOAnd spleen of corresponding littermate wild-type mice

CD8⁺T cells, one fraction lysed directly with TRIZOL and the other fraction stimulated in 48-well plates as described under 1.2.2.2, with antibody concentration anti-CD3 (2. mu.g/ml) + anti-CD28 (2. mu.g/ml), stimulation time 96 hours, and after harvesting the cells were also lysed with TRIZOL. Total RNA was extracted and the quality of RNA was checked by an Agilent Bioanalyzer 2100 and further purified by two kits, RNAclean XP Kit (Cat A63987, Beckman Coulter) and RNase-Free DNase Set (Cat #79254, QIAGEN).

And 2, constructing a library. By using

Construction of a library with the RNA Sample Preparation Kit (Illumina, USA) Kit, and further by

2.0Fluorometer (Life Technologies) and validated byAgilent 2100bioanalyzer (Agilent Technologies) purification, enrichment and quantification of the library.

3, sequencing. Cluster was generated using cBot and sequenced using Illumina HiSeq 2500(Illumina, USA).

And 4, analyzing gene expression. The sequencing reads for each gene were converted to FPKM values and calculated according to the following equation:

1.2.3 Biochemical experiments

1.2.3.1 Co-immunoprecipitation

1, taking at least 10⁷Cells (suitable for Jurkat and 293FT cells), centrifuging at 500g for 5min, discarding supernatant, lysing with Lysis buffer for Co-IP, rotating the shaker at 4 deg.C above 20rpm for half an hour, and allowing cell suspension to become clear and flocculent precipitate to appear. Centrifuging at 4 deg.C and maximum rotation speed for 5min, and picking out flocculent precipitate with 200 μ L gun head. Mixing 30 μ L of supernatant with 4 times of concentrated SDS loading buffer, boiling in 100 deg.C heater for three times for 5min, and reserving for whole cell lysisA liquid sample.

2, adding 40 μ L Protein G Sepharose beads to the residual supernatant, incubating for 2h at 4 ℃ with a rotary shaker, and removing non-specific binding Protein. Centrifuging at 4 deg.C for 5min at 400G, taking out supernatant, adding 1.5-3 μ G antibody, incubating at 4 deg.C for 12h with rotary shaker, adding 60 μ L Protein G Sepharose beads, and incubating for 4 h.

After centrifugation at 400g for 5min at 3, 4 ℃ the supernatant was removed and washed 3 times with 1mL of 0.5% NP-40 in IP lysate. The supernatant was aspirated off with a spatula tip, mixed with 30. mu.L SDS loading buffer, and boiled in a 100 ℃ heater with shaking once every 5min for a total of three times. Centrifuging at the maximum speed for 5min, sucking the lysate into a new EP tube by using a flat gun head, and using the lysate for a Western Blot experiment.

1.2.3.2293 detection of PD-1 ubiquitination in FT cells

1, plasmids of PD-1, FBXO38, Ub were transfected in 293FT cells, cells were harvested after 36h, 293FT cells were blown out of a 10cm dish directly with PBS, centrifuged at 500g, the supernatant removed and washed once with PBS.

2, 100ul Lysis Buffer for inactivation 1 was used to lyse the cells, and the cells were squirted to a viscous state with a pipette tip, vortex3-5 times, incubated on a 100 ℃ sample cooker for 10 minutes, and then cooled on ice for about 10 minutes.

3, 900. mu.l of lysine Buffer for inactivation 2 was added to dilute the SDS concentration to 0.1%, facilitating the subsequent immunoprecipitation experiment. After these treatments, the sample formed a compact mass, which was subsequently broken up using an ultrasonicator to form a uniform looking emulsion, and placed in a 4 degree rotary table for 1 h.

Centrifugation was carried out at 4, 4 ℃ top rotation speed for 10 minutes to remove the precipitate, the supernatant was retained, and IP was carried out using an antibody against anti-HA at a concentration of 4. mu.g/ml, and a part of the supernatant was retained as a whole cell lysis sample.

The rest of the steps refer to the method of co-immunoprecipitation of 1.2.3.1.

1.3 statistical analysis method of test

All experiments were performed in at least 3 independent replicates (some mouse tumor experiments were performed in duplicate). All data are expressed as mean and standard deviation or standard error (mean ± SD or mean ± SEM). Defining a P value less than 0.05 as a significant difference, specifically: p < 0.05; p < 0.01; p < 0.001; n.s.p > -0.05 with no significant difference.

Experimental data for n-3: if the variances of the two groups of samples are not significantly different, using two-tailedunpaired t-test to carry out difference detection; if there is a significant difference in the variance between the two sets of samples, the difference is measured using two-tailed unpaired t-test with Welch's correction.

For experimental data with n >3, it was first tested whether the data fit a normal distribution using Kolmogorov-Smirnov test: if the positive distribution is met and the variance is not significantly different, using two-tailed unpaired t-test to carry out difference detection; if the positive Tai distribution is met and the variance is significantly different, performing difference detection by using two-tailed unpaired t-testwith Welch's correction; if not, a Mann-Whitneytest was used for the differential test.

For the human samples in a and e in fig. 3.4.1, Kolmogorov-Smirnov test was first used to test whether the data fit to a normal distribution: if the positive-too-distribution is met, performing difference detection by using the paired t-test; if too positive distribution is not met, the variance test is performed using Wilcoxon matched-pairs signed rank test.

Mouse tumor growth curves were analyzed for significance using the two-way ANOVA test; the survival curves were analyzed for significance using the log-rank (Mantel-Cox) test.

1.4 results of the experiment

1.4.1 ubiquitination modification of PD-1 following T cell activation

The invention directly uses PD-1 antibody (EH12.1, BD) to immunoprecipitate PD-1 protein in activated human Peripheral Blood Mononuclear Cells (PBMC) and Jurkat cell lines, and then uses specific antibody of ubiquitin to carry out immunoblot detection, and finds that PD-1 has obvious ubiquitination modification in human PBMC and Jurkat cell lines and also has dynamic change of ubiquitination modification in Jurkat cell lines (figure 1. a-c). Wherein PBMC cells are isolated from human bloodSpecific method for cell is described in Lymphoprep (STEMCELL Co., Ltd.)^TMKit was isolated from Density Gradient Medium for the Isolation of Mononuclear Cells (Catalog # 07801).

According to the invention, a proteasome degradation pathway inhibitor MG132 or a lysosome degradation pathway inhibitor NH4Cl and BFA are added into a mouse CTL cell culture medium expressing PD-1, and only MG132 can cause accumulation of PD-1, while NH4Cl and BFA have no influence on expression of PD-1 (figure 1. d-i). In order to ensure that the MG132 and NH4Cl, BFA concentrations are sufficient to inhibit both the proteasomal and lysosomal degradation pathways, the present invention detected ERK1/2 protein and p62 protein, respectively, as positive controls for the proteasomal degradation pathway and the lysosomal degradation pathway, respectively. The invention discovers that ERK1/2 protein and p62 protein are accumulated in the same cell. Therefore, the above data suggest that the PD-1 protein is in CD8⁺There are significant dynamic changes following induced expression, and ubiquitination modification and proteasome-dependent degradation of PD-1 may be important mechanisms therein.

1.4.2FBXO38 specific regulation of PD-1 expression in Jurkat cell line

The invention uses lipo2000 to over-express Fbxo38 in 293FT cells, uses a lentivirus packaging system to infect Jurkat cells, and uses pHAGE-fEF1a-3Myc-FBXO38-IRES-ZsGreen to over-express Fbxo38 in Jurkat cells. It was demonstrated by co-immunoprecipitation experiments in 293FT cells and Jurkat cell lines that Myc-FBXO38 could interact with HA-PD-1 and that exogenously overexpressed Myc-FBXO38 could also interact with endogenously induced expressed PD-1 (FIG. 2. a-d). Myc-FBXO47 also interacted with HA-PD-1 in 293FT cells (FIG. 2. e). In order to examine the effect of FBXO38 and FBXO47 on PD-1 stability, the present invention over-expressed FBXO38 and FBXO47 genes in Jurkat cell lines using pHAGE-fEF1a-3Myc-FBX 38-IRES-ZsGreen and pHAGE-fEF1a-3Myc-FBX 47-IRES-ZsGreen, respectively, found that the over-expression did not affect the expression level of CD3 on the surface of Jurkat cell lines, but after anti-CD3 stimulation, the expression level of PD-1 was significantly lower in FBXO38 over-expressed Jurkat cells than in the control group, whereas PD-1 was not affected in fbXO47 over-expressed Jurkat cells (fig. 2.f-i), these data suggest that fbXO38 and fb 47 both interact with PD-1, and that the effect of fbXO38 may be more important. Further, the present invention successfully knockdown the Fbxo38 gene with shRNA in Jurkat cell line with significantly reduced levels of both transcript and protein, while the cell surface expression of CD3 was unaffected (fig. 2. j-l). After anti-CD3 stimulation, PD-1 expression was significantly higher in the Fbxo38 knock-down group than in the control group, and there was no significant difference in the transcript levels between the two groups (FIG. 2. m-n). Further, the present invention using antibody IP co-immunoprecipitated with PD-1 and detecting the knockdown of Fbxo38 using western blot significantly increased the PD-1 protein level (FIG. 2. o). In combination with co-immunoprecipitation experiments and overexpression and knock-down experiments in Jurkat cells, FBXO38 is considered a key protein for modulating PD-1 stability.

The DNA nucleotide sequence for coding the shRNA is 5 'GACTTCCTTTGTATCAGCTTA 3' (SEQ ID NO. 12).

1.4.3FBXO38 catalyzes PD-1 to carry out polyubiquitination modification of K-48 type and promotes degradation

The invention firstly over-expresses Myc-Fbxo38, HA-Pd1 and V5-Ub in 293FT cells, and finds that FBXO38 can promote ubiquitination of PD-1, and after two lysines of PD-1 intracellular segment are all mutated into R, ubiquitination signal of PD-1 is completely disappeared, which indicates that FBXO38 can catalyze ubiquitination of PD-1 at the two sites (FIG. 3. a). In Jurkat cell line with Fbxo38 overexpressed and knocked-down, the present inventors found that Fbxo38 could significantly affect ubiquitination modification of endogenous PD-1 (fig. 3. b-c). The invention compares ubiquitination signals of wild-type PD-1 and Ktor with mutations of K210R, K233R and both K mutations respectively, and finds that the mutation of K210R does not affect ubiquitination signals of PD-1, while K233R and Ktor mutations can hardly detect ubiquitination modification of PD-1, which indicates that FBXO38 catalyzes ubiquitination modification at the K233 site of PD-1 (FIG. 3. d). FBXO38 belongs to the F-box E3 ligase family, which has an important F-box domain, and after deletion of the F-box according to the present invention, it was found that the ability of FBXO38 to catalyze the ubiquitination modification of PD-1 was significantly affected (fig. 3. E). The invention transfects different V5-Ub mutations into 293FT cells, and finds that after K-48R mutation, the ubiquitination signal of PD-1 is obviously influenced, but the signal of K63R is hardly influenced, which indicates that FBXO38 also catalyzes PD-1 to generate K-48 type polyubiquitination modification (figure 3. f). Finally, the protein synthesis inhibitor CHX is used for blocking protein synthesis, the protein stability of PD-1 is detected, and FBXO38 can be found to remarkably promote the degradation of PD-1. Both PD-1 become more stable if either the two lysines of PD-1 are mutated to R or the F-box domain of FBXO38 is deleted (FIG. 3. g-i). Therefore, the above data indicate that FBXO38 can catalyze K-48 type polyubiquitination modification at the K233 site of PD-1 and promote PD-1 degradation.

1.4.4 Effect of Fbxo38 knockout on T cell development

The invention adopts Fbxo38 conditional knockout mice (Fbxo 38) with C57 background^CKO) (FIG. 4 a).

The invention firstly adopts the flow cytometry to detect the influence of Fbxo38 gene knockout on the development of mouse T cells. In the thymus, CD4 and CD8 cells develop at Fbxo38^CKOThere were no significant differences in mice compared to the control group, including DN (CD 4)^-CD8^-)、DP(CD4⁺CD8⁺)、CD4SP(CD4⁺CD8^-) And CD8SP (CD 4)^-CD8⁺) There were also no significant differences in the stages DN1, DN2, DN3 and DN4 of DN cells (fig. 4. b-c). The ratio of CD4 and CD8 cells in peripheral spleen and lymph nodes is Fbxo38^CKOThere was no significant difference in mice compared to the control group, and most of CD4 and CD8 cells remained

Status, central memory (CD 44)^hiCD62L^hi) And effector/effector memory (CD 44)^hiCD62L^lo) The cells also did not differ significantly (FIG. 4. d-i). Therefore, these data indicate that Fbxo38 gene knock-out does not affect T cell development and peripheral immune homeostasis.

1.4.5 Effect of Fbxo38 knockout on T cell activation, proliferation and apoptosis

The invention adopts the flow cytometry technology to detect Fbxo38^CKOAnd CD8 in control mice⁺Expression of CD3 and CD28 on the surface of T cells, it was found that Fbxo38 knock-out did not affect the expression of CD3 and CD28 (fig. 5. a). anti-CD3 and anti-CD28 stimulatedThen, Fbxo38^CKOAnd control group CD8⁺The expression level of the activating molecule CD44 on the surface of T cells was comparable (fig. 5. b). Meanwhile, the invention also detects CD8 by using the flow cytometry technology⁺after T-cell activation, the ability to secrete cytokines was found to be not significantly affected at both 72h and 96h secretion of IFN-. gamma.TNF-. alpha.and granzymB (FIG. 5. d).

1.4.6 Effect of Fbxo38 knockout on T cell proliferation and apoptosis

The invention further uses Celltracker staining and flow cytometry to detect WT and CKO CD8⁺Proliferation of T cells following in vitro activation, WT and CKO CD8 were detected using Annexin V and Propidium Iodide (PI) staining and flow cytometry⁺T cell apoptosis, and Fbxo38 knock-out did not affect CD8⁺Proliferation and apoptosis of T cells (fig. 6).

1.4.7Fbxo38 knockout on CD8⁺Effect of T cell transcriptome

The invention adopts RNA-seq to analyze WT and CKO CD8⁺T cells in

And the gene transcription level in the activated state, three pairs of Fbxo38 were selected^CKOAnd control mice, isolated CD8⁺T cells are stimulated by anti-CD3 and anti-CD28, expression changes of a plurality of cell surface molecules, cytokines, activating molecules and transcription factors are detected through RNA-Seq, and Fbxo38 knockout also does not influence CD8⁺Expression of these functional molecules in T cells. However, CD8⁺Following T cell activation, protein levels of PD-1 were in Fbxo38 knock-out CD8⁺There was a significant increase in T cells. In contrast, there was no difference in the expression level of the other immunosuppressive molecule, LAG-3. In these experiments, FBXO38 was shown to be PD-1 as the primary target in CD8+ T cells, and FBXO38 knockout mice had normal activation capacity in the absence of activation of the PD-1 pathway (fig. 7 a).

1.4.8 Effect of Fbxo38 knock-out on PD-1

The invention uses flow cytometry to detect WT and Fbxo38^CKOMouseCD8⁺、CD4⁺Expression levels of PD-1 on the surface of T cells and Treg cells. Fbxo38 after stimulation with anti-CD3 and anti-CD28^CKOCD8 in comparison to WT⁺And CD4⁺PD-1 levels on the surface of T cells were significantly high (FIG. 8. a-b). Meanwhile, the invention also detects Tregs (CD 4) in mouse spleen by using flow cytometry⁺CD25⁺) The PD-1 level of the cells, Fbxo38 was found^CKOPD-1 levels were significantly increased in tregs compared to WT (fig. 8. c). Taken together, the knockout of Fbxo38 resulted in a significant increase in PD-1 expression levels in T cells.

1.4.9Fbxo38 knock-out affects T cell anti-tumor immunity

The invention utilizes a tumor model to research FBXO38 on CD8 under physiological conditions⁺The function of the anti-tumor immunity of the T cells. The B16F10 cell highly expresses a PD-L1 molecule, and the discovery means that the PD-1-PD-L1 pathway is continuously activated in a B16F10 model, and the PD-1 pathway plays an important role in tumor immune escape of the model. B16F10 is a very malignant tumor model, and the tumor growth speed is fast. However, Fbxo38 was compared with control mice^CKOTumors grew faster and survived in mice (FIG. 9. a-b). Further analysis of tumor-infiltrated T-cell findings (fig. 9.c), more than 90% of tumor-infiltrated CD8⁺T cells were all CD44 positive, meaning that they were antigen activated, whereas Fbxo38^CKOCD8 in mouse⁺T cells have higher PD-1 expression level, lower proliferation capacity (Ki67 expression) and defects of cytokine secretion function (IFN-gamma, TNF- α and GranzymB), CD4⁺、CD8⁺And the proportion of Treg cells was not affected (fig. 9. d-j).

1.4.10Fbxo38 knock-out affects T cell anti-tumor immunity

The present invention uses the MC38 model, also found Fbxo38^CKOCD8 in mouse⁺T cells had higher PD-1 expression levels and tumors grew faster (FIG. 10. a-f). These data demonstrate that FBXO38 protein can influence CD8 by modulating the expression of PD-1⁺Function of T cells.

1.4.11Fbxo38 knockdown did not affect activation of T cells

The invention uses shRNA in OT1CD8 in vitro⁺Fbxo38 gene was knocked down in T cells, and CD8 of Fbxo38 knocked down group and control group was observed⁺PD-1 levels of T cells. Through screening, two specific shRNAs of Fbxo38 are selected, and endogenous Fbxo38 can be effectively knocked down through qPCR and immunoblot verification (figure 11. a-b). Fbxo38 knockout CD8⁺Like T cells, the knockdown of Fbxo38 did not affect the expression of CD3 and CD28 molecules on the cell surface (fig. 11. c). Furthermore, the present invention examined the effect of Fbxo38 knockdown on the TCR signaling pathway and found that phosphorylation including CD3, PLC-and ERK phosphorylation was not affected by Fbxo38 knockdown, nor was the secretion of the T cell activating molecule CD69 and the cytokine IFN-, (fig. 11. d-g).

The DNA nucleotide sequence for coding the shRNA is as follows:

5’GTGGATGCGACTGGTTGATAT 3’(SEQ ID NO.13)

5’CGTAATCGTAACGGAGCATTT 3’(SEQ ID NO.14)

1.4.12Fbxo38 knockdown up expression of PD-1 and affects CD8⁺Killing ability of T cells

PD-1 levels were flow-assayed after T-cell activation with anti-CD3 and anti-CD28 antibodies and significantly increased PD-1 expression levels were found in Fbxo 38-knockdown group of cells (FIG. 12.a), which is consistent with Fbxo 38-knocked-out CD8⁺T cell phenotypes were consistent. To investigate whether high expression of PD-1 would affect CD8⁺T cell function, the present invention selects OT1CD8 with EL-4 cells as target cells⁺T cell killing system. EL-4 cells highly express PD-L1, in OT1CD8⁺The PD-1 pathway was activated efficiently when T cells were killed (fig. 12. b). Compared with a control group, the killing capacity of cells in the Fbxo38 knock-down group is obviously influenced; at the same time, anti-PD-1 can completely recover the functional defect (FIG. 12. c). Further verifying that FBXO38 regulates CD8⁺PD-1 levels in T cells, Fbxo38 was overexpressed in OVA-activated CTLs with retroviral MSCV and PD-1 levels were found to be significantly reduced (fig. 12. d-f). These data suggest that PD-1 is the primary target of FBXO 38.

1.4.13FBXO38 endogenously regulates the antitumor ability of CD8+ T cells

The present invention was studied using Adoptive T cell therapy (Adoptive Transfer Model) for the B16F10 tumor Model. In this model, the invention utilizes shRNA in OT1CD8 in vitro⁺Knockdown of Fbxo38 gene in T cells (shRNA used identical to that used in 1.4.11), sorting and expansion of these cells, followed by injection into tumor-bearing mice (B16F10-OVA), observation of CD8 in Fbxo38 knockdown and control groups⁺Tumor control ability of T cells (fig. 13. a). In the invention, unstimulated cells of the Fbxo38 knocked-down group and the control group are back-infused into a B16F10-OVA tumor-bearing mouse, and the proportion of the cells of the Fbxo38 knocked-down group and the expression level of Ki67 in inguinal lymph node (draining lymphadode) of the mouse are obviously lower than those of the control group, while the expression level of PD-1 is obviously higher than that of the control group; in the mesenteric lymph node (non-draining lympode), the proportion of the two groups of cells was comparable, indicating that the Fbxo38 knockdown did not affect T cell migration into secondary lymphoid organs (fig. 13. b-e). Therefore, the control ability of the Fbxo38 knockdown group cells on tumors was significantly lower than that of the control group, and the survival of the mice was also shorter (fig. 13.f-g), which is consistent with that of Fbxo38 conditional knockout mice. Finally, the invention researches the control condition of the combined treatment of anti-PD-1 and ACT on tumors, and finds that the combined treatment has better effect than that of the single treatment of ACT in the Fbxo38 knockdown and control groups, and the sizes and survival periods of the tumors of the two groups of mice have no obvious difference after the combined treatment (figure 13.h-i), which shows that the anti-PD-1 can recover the functional defects caused by the Fbxo38 knockdown. These data in combination with Fbxo38 knock-down conditional knockout data illustrate that: FBXO38 can regulate CD8 by specifically regulating expression level of PD-1⁺Anti-tumor immune function of T cells.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

Function and application of <120> PD-1 ubiquitination agonist

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>231

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgcagatct ttgtgaagac cctcactggc aaaaccatca cccttgaggt cgagcccagt 60

gacaccattg agaatgtcaa agccaaaatt caagacaagg agggtatccc acctgaccag 120

cagcgtctga tatttgccgg caaacagctg gaggatggcc gcactctctc agactacaac 180

atccagaaag agtccaccct gcacctggtg ttgcgcctcc gcggtggata a 231

<210>2

<211>49

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

caggtgtcgt gaagcatgga acagaaattg ataagtgagg aagatttag 49

<210>3

<211>54

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ttgctctaaa tcttcctcac ttatcaattt ctgttccatg cttcacgaca cctg 54

<210>4

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

agcaaaagct catttctgaa gaggacttgg aacagaaatt gataagtgag gaagatt 57

<210>5

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccgctaaatc ttcctcactt atcaatttct gttccaagtc ctcttcagaa atgagctt 58

<210>6

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tagcggccgc agcaatgcat gcaggcgcgc cagaaacgcg tgggcaccgg tctgcagc 58

<210>7

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gctgcagacc ggtgcccacg cgtttctggc gcgcctgcat gcattgctgc gg 52

<210>8

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tgaggaagat ttagcgatgg ggccacgaaa gaaaagtg 38

<210>9

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tgcatgcatt gctgcttaaa tgtagtcatc ttcaactg 38

<210>10

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gcgccggaat tagatctcat ggaacagaaa ttgataagtg aggaag 46

<210>11

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gggcggaatt cgttaacctt aaatgtagtc atcttcaac 39

<210>12

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gacttccttt gtatcagctt a 21

<210>13

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gtggatgcga ctggttgata t 21

<210>14

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

cgtaatcgta acggagcatt t 21

Claims

Use of a PD-1 ubiquitinated agonist in the preparation of a PD-1 degradant or in the preparation of a medicament for the immunotherapy of tumors.
2. Use according to claim 1, further comprising one or more of the following features:

a. the PD-1 ubiquitination agonist is a molecule having a promoting effect on PD-1 ubiquitination;

b. the PD-1 ubiquitination agonist is selected from lentivirus or retrovirus packaged plasmid, carbohydrate, lipid, small molecule compound, RNA, polypeptide or protein;

c. the PD-1 ubiquitination agonist is an FBXO38 agonist.
3. Use according to claim 2, further comprising one or more of the following features:

d. in feature c, the FBXO38 agonist is a molecule having a promoting effect on FBXO 38;

e. in feature c, the FBXO38 agonist is selected from a molecule capable of increasing the expression or activity of FBXO 38.
4. Use according to claim 3, characterized in that in characteristic e the molecule capable of increasing the expression or activity of FBXO38 is selected from the group consisting of lentivirus or retrovirus packaged plasmids, carbohydrates, lipids, small molecule compounds, RNA, polypeptides or proteins.
5. An immunotherapeutic agent for tumor comprising an effective amount of a PD-1 ubiquitination agonist.
Use of FBXO38 as an effect target for screening a medicament for the immunotherapy of tumor or for the treatment of autoimmune diseases.
7. A method for screening a tumor immunotherapy drug, comprising: and (3) verifying whether the medicament to be screened can enhance PD-1 ubiquitination and/or has a promoting effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for tumor immunotherapy.
8. The method of screening for an immunotherapeutic agent for tumor according to claim 7, wherein the method comprises one or more of:

1) acting the drug to be screened on the in vitro cell expressing PD-1 to determine whether the PD-1 in the cell is ubiquitinated and enhanced;

2) the drug to be screened is applied to the in vitro cell expressing FBXO38 to determine whether the cell has the activity enhancement or the expression up-regulation of FBXO 38.
9. The method of screening for an immunotherapeutic agent for tumor according to claim 8, wherein the method comprises one or more of:

a. the method for determining the enhancement of ubiquitination comprises the following steps: detecting by western blot or mass spectrum technology;

b. the method for determining whether FBXO38 has increased viability or upregulated expression in cells is: real-time quantitative PCR and/or Western Blot detection, or mass spectrometric detection.
10.A method for screening a therapeutic agent for an autoimmune disease, comprising: and (3) verifying whether the medicament to be screened can reduce PD-1 ubiquitination and/or has a suppression effect on FBXO38, and if so, determining the medicament to be screened as a candidate medicament for treating the autoimmune disease.
11. The method of screening for an autoimmune disease treatment drug according to claim 10, wherein the method comprises one or more of:

1) acting the drug to be screened on the in vitro cell expressing PD-1 to determine whether the PD-1 in the cell is subjected to ubiquitination attenuation;

2) the drug to be screened is applied to in vitro cells expressing FBXO38 to determine whether there is reduced viability or reduced expression of FBXO38 in the cells.
12. The method of screening for an autoimmune disease treatment drug according to claim 11, wherein the method comprises one or more of:

a. the method for determining the reduction of ubiquitination comprises the following steps: detecting by western blot or mass spectrum technology;

b methods to determine whether FBXO38 has decreased viability or decreased expression in a cell are: real-time quantitative PCR and/or Western Blot detection, or mass spectrometric detection.