KR20150037204A - A composition for wound healing comprising extracts of arecae pericarpium - Google Patents

Abstract

The present invention relates to a dermatologic drug composition for preventing or healing wound comprising an Arecae Pericarpium extract as an active ingredient and to a method for preparing the same. The composition comprising the Arecae Pericarpium extract as the active ingredient according to the present invention: solves problems of conventional wound healing medicines; promotes secretion of transforming growth factor beta, insulin-like growth factor type 1, and keratinocyte growth factor by promoting activities of fibroblasts; and can be directly applied to wound healing by promoting biosynthesis of fibronectin and collagen, thereby having enhanced wound improving, preventing, or healing effects. Therefore, the composition comprising the Arecae Pericarpium extract according to the present invention can be utilized as the dermatologic drug having less side effects on human body, and enhanced wound improving, preventing, or healing effects.

Description

TECHNICAL FIELD The present invention relates to a composition for wound healing,

The present invention relates to a composition containing a crude extract and a method for producing the same.

The skin consists of three layers such as epidermis, dermis, and subcutaneous fat, and the skin tissue of each layer is composed of various cells and their surroundings which are responsible for various functions of the skin. It is responsible for protecting the body.

When the skin is damaged, the damaged part is infected with bacteria and external toxins, and the defense mechanism of the skin is activated to induce an inflammatory reaction, followed by cell proliferation. At this time, dermis fibroblast fills the damaged skin through activation of skin cell metabolism, and reconstruction of new cells and epilepsy occurs at the wound site.

Wound healing is a complex biological process involving chemotaxis, cell differentiation and replication, synthesis of lipid proteins, and angiogenesis as part of the tissue repair process, which is a tissue response to damaged skin (Front Biosci, 2004). The 'wound' is also commonly referred to as a 'wound'. It is one of the representative substances that regulate the healing process of wound, and it can hear growth factors. They transmit signals for cell interactions such as growth, differentiation, and metabolism throughout the wound healing process and play an important role in the control of wound healing . These growth factors are polypeptides that can be secreted by various active cells at the wound site to stimulate or inhibit cell proliferation, cell migration, or biosynthesis. (TGF-β), platelet-derived growth factor (PDGF), and keratinocytes (TGF-β), which are produced in specific cells and affect the surrounding target cells Growth factor (KGF), keratinocyte growth factor, and insulin-like growth factor type 1.

Steroid ointment and nonsteroidal anti-inflammatory ointment are traditionally distributed in the domestic market. They have the effect of inhibiting the inflammation accompanied by the wound, but they need to be used with caution because they slow down wound healing and inhibit collagen synthesis from fibroblasts during wound healing process. As an alternative to this, moisturizing dressing, which has been commercialized recently, has been used increasingly because it has a merit of helping the wound to be smooth and moving cells smoothly, and adding some growth factors to help healing the wound. However, the moisturizing dressing is inconvenient to use, since it needs to be appropriately changed depending on the degree of occurrence of the sausage. In addition, in the case of ointment which is currently widely used for fine wounds, products using oils for skin regeneration and products utilizing imported medicines such as Centella asiatica are used.

On the other hand, "daebok blood (大腹皮, Arecae Pericarpium)" refers to the peel of betel (Areca catechu Linne) belonging to yajagwa. The vineyard is a large tree about 10-18m long, and the egg-shaped hard fruit is dark blue. When you cut the fruit, it is divided into a round seed (bingata) and a bark surrounding the seed (bingata). Alkaloids such as arecolin, alecidyl, and gubacholine are known to be effective ingredients in the case of bingelas, which are seeds of birch. However, only a limited number of tannins have been known in the case of bamboo seeds (Shinil Sangsang, Oriental Pharmacology, 2005, 548 -549). The efficacy study showed that whitening efficacy and anti-aging efficacy (Korean Patent Laid-Open No. 10-2005-0114269) and the like were found in the case of bingo, but there was almost no study on the efficacy of bupivacaine, there is only a report that it acts on liver damage of rat induced naphthylisothiocyanate (Yakugaku Zasshi, 1993) and digestive system (Vet Hum Toxicol, 2000) and the nervous system (J Biomed Sci, 2001). In addition, prior studies on the efficacy of dandruff blood on the skin include atopic control agents of Korean Patent Laid-Open No. 10-2006-0118809, hair growth agents of Korean Patent Laid-Open No. 10-2008-0032127, and Korean Patent Publication 10-2011-0039403 The sebaceous gland secretion regulator is known.

However, to date, it has been shown that it promotes the secretion of transforming growth factor-beta and insulin-like growth factor and keratinocyte proliferation factor directly acting on wound healing of dairy herbal extracts and at the same time stimulates skin dermal cells to produce biosynthesis of collagen and fibronectin There have been no studies on promoting effects.

Accordingly, a problem to be solved by the present invention is to solve the problems of conventional wound healing agents, promote the activity of dermal fibroblasts, promote secretion of transforming growth factor-beta, insulin-like growth factor and keratinocyte growth factor Prevention or healing of wounds containing actinic bark extract which directly acts on wound healing by promoting biosynthesis of fibronectin and collagen, and a method for producing the composition.

In order to solve the above technical problems, the present invention provides a composition for improving, preventing or healing wounds containing Arecae Pericarpium extract as an active ingredient and a method for producing the composition.

More specifically, the present invention provides a composition for external application for skin for wound healing, prevention or healing, which comprises an extract of the skin to be treated as an active ingredient, and a method for producing the same. The composition according to the present invention is excellent in safety because it contains natural plant extract as an active ingredient and has excellent effects on transforming growth factor-beta1, KGF, keratinocyte growth factor, insulin, (IGF-1, insulin-like growth factor type-1), collagen and fibronectin, thus being used as a cosmetic composition for wound healing or as a pharmaceutical composition for prevention or treatment of wound healing It is possible.

Accordingly, in one aspect, the present invention provides a cosmetic composition for wound healing and a method for producing the composition, which comprises an extract of a skin extract as an active ingredient. In addition, the present invention provides a pharmaceutical composition for preventing or treating wounds and a method for producing the same, which comprises a skin extract of the present invention as an active ingredient. The present invention also provides a method for improving, preventing or curing skin wounds, which comprises applying an effective amount of a skin extract to the skin of a subject in need of wound healing, prevention or healing.

Further, in another aspect, there is provided a method for producing a skin extract having a wound-healing, prevention or healing effect, comprising the step of extracting the skin of the skin using water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof do. More preferably, the lower alcohol having 1 to 4 carbon atoms may be methanol.

In still another embodiment, the present invention provides a method for improving the wound healing, prevention or healing efficacy of a hairy scalp extract comprising the step of extracting the hair from the hair using water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof . ≪ / RTI > More preferably, the lower alcohol having 1 to 4 carbon atoms may be methanol.

The present inventors have found that the administration of the skin extract of the present invention stimulates dermal fibroblasts and promotes the production of transforming growth factor-beta, insulin-like growth factor, keratinocyte growth factor, fibronectin and collagen in fibroblasts, And completed the present invention. Based on the experimental results of the present invention, it is believed that the extract of the present invention is superior to other wound healing substances.

The preparation of the skin extract of the present invention can be carried out by physically pulverizing the dried skin and then washing it with a suitable solvent such as hot water, methanol, ethanol, butanol, chloroform, dichloromethane, hexane, ethyl acetate Or by supercritical extraction, preferably by extraction using hot water, lower alcohols having 1-4 carbon atoms, or a mixed solvent thereof. Most preferably, methanol can be used.

Extraction methods for extracting the seeds are similar to the cold precipitation method and the cold precipitation method in that they leach at a relatively low temperature. However, the leaching method is a leaching method at a temperature of 35-45 ° C., a leaching method at a temperature of 60-120 ° C. , A percolation method using a percolator, a distilled water cooling extraction method, and the like can be used but are not limited to these.

The composition for wound healing, prevention, or healing according to the present invention can be manufactured in the form of pharmaceuticals or cosmetics. Such medicaments and cosmetics may include pharmaceutically acceptable excipients, disintegrants, binders, lubricants, wetting agents, emulsifying agents, suspending agents, and the like. The compositions according to the invention may be used alone or in combination with any convenient vehicle, excipient or the like, and such useable formulations may be single or multiple dose formulations.

The composition according to the present invention may be a solid preparation, a semi-solid preparation or a liquid preparation. Solid preparations include, but are not limited to, powders, granules, tablets, capsules, suppositories, and the like. Solid form preparations may include, but are not limited to, excipients, flavoring agents, binders, preservatives, disintegrants, lubricants, fillers, and the like. Examples of the semi-solid preparation include a cream, a lotion, an emulsifier, a liniment, and the like, but the present invention is not limited thereto, and can be produced by adding a suitable colorant, a flavoring agent, a stabilizer, a tackifier, a surfactant, and the like. Examples of the liquid preparation include water, alcohols, solutions such as solutions of propylene glycol, suspensions, emulsions and the like, but not limited thereto, and they can be prepared by adding appropriate coloring agents, flavoring agents, stabilizers, tackifiers and the like.

For example, powders can be prepared by simple mixing of the active ingredient of the present invention with suitable pharmaceutically acceptable excipients such as lactose, starch, microcrystalline cellulose and the like. The granules may contain the active ingredient of the present invention; Suitable excipients which are pharmaceutically acceptable; And a suitable pharmaceutically acceptable binder such as polyvinylpyrrolidone or hydroxypropylcellulose, followed by wet granulation using a solvent such as water, ethanol or isopropanol or dry granulation using a compressive force . Further, the tablet may be prepared by mixing the above granule with a suitable pharmaceutically acceptable salt such as magnesium stearate and then tableting it using a tablet machine. For example, the external preparation for skin may be a pharmaceutically acceptable base such as vaseline or stearyl alcohol; Suitable pharmaceutically acceptable surfactants such as polysorbate, sorbitan sesquioleate, and the like; A suitable pharmaceutically acceptable humectant such as glycerin; A suitable pharmaceutically acceptable solvent; And a conventional external preparation for skin preparation in which a flavoring agent, a coloring agent, a stabilizer, a tackifier and the like are homogeneously mixed.

The cosmetic composition containing a skin extract of the present invention is prepared and used in formulations such as cosmetics, essences, oils, creams, powders, packs, foundations, make-up bases and sticks, . Such a cosmetic composition can also be applied in various forms such as a liquid, a cream, a paste and a solid, and can be produced by a conventional cosmetic preparation method.

For example, the composition of the present invention may be prepared as a softening agent using a carbomer, butylene glycol, glycerin, PEG, ethanol, polyoxyethylene hydrogenated castor oil, triethanolamine, purified water or the like, Alcohol, glyceryl stearate / phage-100 stearate, polysorbate 60, sorbitan sesquioleate, cetyl octanoate, squalane, apricot kernel oil, butylen glycol, carbomer, Preservative, purified water, arginine, etc., but the present invention is not limited to such a formulation.

In the composition according to the present invention, the content of the skin extract is preferably 0.0001 to 10% by weight based on the total weight of the composition.

To achieve the object of the present invention, preventing, ameliorating, or healing a skin wound, the inventive skin extract of the present invention may be administered from about 0.01 mg / kg to about 10 g / kg daily, g / kg is preferred. However, the dosage may vary depending on the administration route and formulation, the patient's condition (age, sex, weight, etc.), the severity of the condition being treated, the purity and content of the skin extract, For convenience, the total daily dose may be divided as needed and divided into several doses throughout the day.

The composition according to the present invention may contain other wound healing ingredients or the like which can give a synergistic effect to the main effect within a range that does not impair the intended main effect of the present invention. Such components include, for example, Centella asiatica or situational extract.

The composition containing the skin extract of the present invention as an active ingredient solves the problems of the conventional wound healing agent and accelerates the activity of the skin dermal fibroblast to produce the transforming growth factor-beta, insulin-like growth factor, keratinocyte growth factor Promotes secretion, promotes fibronectin and collagen biosynthesis, and acts directly on wound healing, exerting an excellent effect on wound healing, prevention, or healing. Accordingly, the composition containing the skin extract of the present invention can be used as an external preparation for skin, which has few side effects on the human body and has excellent wound healing, prevention, or healing effects.

BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate exemplary embodiments of the invention and, together with the description of the invention, It should not be construed as limited.
FIG. 1 shows the results of evaluating the effect of the present invention on gene expression of KGF and IGF-1 in fibroblasts.
FIG. 2 shows the results of evaluating the effect of the extract of the present invention on the production of collagen in fibroblasts.
FIG. 3 shows the results of evaluating the effect of the extract of the present invention on cell migration to heal scratch wounds in fibroblasts.
Fig. 4 shows the results of evaluation of the effects of the extract of the present invention on wound healing through animal experiments.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

[ Example ] Bloom  Extract preparation and wound healing efficacy evaluation method

< Bloom  Extract preparation>

3 kg of the dressing was pulverized to a size of 100 mesh using a pulverizer, and then about 30 L of methanol (about 1:10 weight / volume) was added thereto, followed by cold extraction for 5 days and concentration under reduced pressure using a rotary evaporator 195 g).

< Efficacy Evaluation Method>

Hereinafter, the efficacy of the extracts according to the present invention was evaluated as follows.

(1) Conversion growth factor- Beta 1 , Fibronectin  And collagen synthesis promoting efficacy evaluation ( ELSIA )

Human skin fibroblasts, which had been preincubated with 10% fetal bovine serum (DMEM), were added to a 24-well plate at a concentration of 2 x 10 ⁵ cells / ml and cultured in a CO ₂ incubator (37 ° C, 5% CO ₂ ) For 18 hours. (Collagen type I), transforming growth factor-beta 1 (TGF-beta 1), and the like were cultured for 48 hours. And fibronectin were analyzed quantitatively. Conversion growth factor-beta was assessed using the DuoSet ELISA kit (R & D system, USA), Fibronectin EIA Kit (Takara, Japan) for fibronectin quantitation and Procollagen type 1 EIA kit (TakaRa, Japan) Respectively.

(2) Evaluation of promoting activity of collagen synthesis Western blot )

Human fibroblasts pre-cultured with a cell culture medium supplemented with 10% fetal bovine serum were added to a 6-well plate at a concentration of 2 x ¹⁰ cells / ml and cultured in a CO ₂ incubator for 18 hours. After removing the medium and diluting the culture medium without addition of fetal bovine serum, the cells were incubated for 48 hours. After the cells were lysed, SDS-PAGE electrophoresis, PVDF membrane transfer, antibody binding process, .

(3) Hypercellular cell proliferation factor ( KGF ), Insulin-like growth factor -One( IGF -1) Evaluation of gene expression promoting activity RT -PCR)

Human fibroblasts, which had been preincubated with a cell culture medium supplemented with 10% fetal bovine serum, were added to a 100 mm cell culture dish at a concentration of 2 x ¹⁰ cells / ml and cultured in a CO ₂ incubator for 18 hours. The medium was removed, and the diluted sample without the fetal bovine serum was added. After culturing for 24 hours, the cells were lysed to separate the RNA. After 2 μg of RNA was reacted with M-MLV reverse transcriptase, reverse transcriptase polymerase chain reaction (PCR) was performed using the following primers and electrophoresis was carried out. Respectively.

Primers Size KGF Forward (5 '- &gt; 3') ACACACAACGGAGGGGAAAT 552 Reverse (5 '- &gt; 3') GCCATAGGAAGAAAGTGGGC IGF-1 Forward (5 '- &gt; 3') GATTCTCCTGCCTCAGCCTC 224 Reverse (5 '- &gt; 3') TAAGAGGGAACACATGGGCA Cyclophilin Forward (5 '- &gt; 3') CAGCCACCCAACGTTTACTT 309 Reverse (5 '- &gt; 3') GAACTGGCTGCCATTGGTAT

(4) Cell migration promotion experiment cell migration assay )

A scratch wound was applied to the dermal fibroblast cell layer with a yellow tip to make voids. The extract was added to a medium containing no serum and incubated for 24 hours. The cell group containing the extract and the control cell group were scratched The effect of the extract was evaluated by photographed on an inverted microscope to determine the extent of cell migration to heal.

(5) Wound healing effect (animal experiment)

The ointment preparations of Test Example 1 and Test Example 1 were comparatively evaluated for wound healing effects. For comparison of wound healing effects, three New Zealand white rabbits of the same species and the same age were purchased. Experiments were performed by removing rabbit hair from both ears using a razor, making 3 wounds each using a 6 mm biopsy punch, disinfecting wounds using hydrogen peroxide water, The formulation of Example 1 was applied for 1 day each day for 14 days. The results were photographed at 0, 3, 3, 7, and 14 days after the initiation of the experiment. Examples of prescription ointment for external use containing the skin extract of the present invention are the same as those of Test Example 1 and Test Example 2.

Composition Test Example 1
(weight%) Test Example 2
(weight%) Comparative Example 1
(weight%) - Rice extract (5%)
- diethyl sebacate
- Writers
- polyoxyethylene oleyl ether phosphate
- Sodium benzoate
-vaseline 0.5
8
5
6
Suitable amount
to 100 5
8
5
6
Suitable amount
to 100 -
8
5
6
Suitable amount
to 100

[ Experimental Example ] Bloom  Evaluation results of wound healing efficacy of extract

<Conversion Growth Factor - Beta 1 ( TGF -β1) Synthesis Promotion Evaluation ( ELISA )>

Concentrated extracts showed the effect of promoting the conversion growth factor - beta 1 production in human skin fibroblasts in a concentration dependent manner. The results are shown in Table 3 below.

sample density TGF-β1 (pg / ml) Fold Induction Control group - 31.3 ± 4.2 100% Bloom extract 50 / 44.4 ± 5.9 141.9% 10 / 34.8 ± 5.1 111.2%

As shown in Table 3 above, the extract of the present invention promoted the production of the transforming growth factor-beta1, which plays a key role in wound healing.

< Hypercellular cell proliferation factor Insulin-like growth factor -1 gene expression promoting activity evaluation>

Experimental results As shown in FIG. 1, the test group supplemented with the bacterium extract showed superior effects on the hypercellular cell growth factor and insulin-like growth factor-1 gene expression in human dermal fibroblasts, and thus it was found to be useful for wound healing.

< Fibronectin  Evaluation of synthesis promoting efficacy ( ELISA )>

The results of the experiment are shown in Table 4 below. The results are shown in Table 4 below.

sample density Fibronectin (pg / ml) Fold Induction Control group - 2311 ± 156 100% Bloom extract 50 / 3315 ± 210 143.4% 10 / 3027 ± 176 131.0%

< Collagen synthesis promotion evaluation ( Western Blot )>

The extracts of the seeds of the skin increased the production of type I collagen in a dose dependent manner in fibroblasts derived from human skin. The results are shown in Fig. From these results, it can be seen that the skin extract of the present invention is useful for wound healing.

Evaluation of promoting collagen synthesis ELISA )>

In order to improve the reliability of the experimental results, the effect of the extract of the present invention on the stimulation of type I collagen production in fibroblasts was evaluated by ELISA, another experimental method for accelerating collagen synthesis, and the results are shown in Table 5 below.

sample Collagen (ng / ml) Fold Induction Positive control group
(Retinoic acid) Control group 227 ± 17 100% 0.5 uM 310 ± 19 136.6% 0.1 uM 269 ± 19 118.6% Bloom extract Control group 319 ± 24 100% 50 [mu] g / ml 489 ± 33 153.3% 10 [mu] g / ml 380 ± 31 119.1%

As shown in the above Table 5, the skin-derived extracts of the present invention were superior to the positive control in the production of type 1 collagen in fibroblasts derived from human skin, and showed a concentration-dependent effect. This result is in agreement with the results of the experiment of the Western blot method of the previous experiment. From these results, it can be understood that the present invention is useful for wound healing.

&Lt; Evaluation of cell migration promoting effect &

Experimental Results As shown in FIG. 3, the experimental group treated with the extract of the bark extract showed the effect of rapidly recovering the scratch wound in a concentration-dependent manner compared to the control cells, and confirmed that the bark extract had an excellent wound healing promoting effect.

<Wound healing efficacy evaluation (animal experiment)>

Experimental Results As shown in Fig. 4, Test Examples 1 and 2 including the bark extract showed an excellent wound healing effect at a significant level from the third day of the experiment. From these results, similar to the previous in vitro test results, it was confirmed in animal experiments that the bark extract had an excellent wound healing promoting effect.

Claims (9)

A composition for external application for skin for wound healing, prevention or healing, which comprises an extract of Arecae Pericarpium as an active ingredient. The composition for external application for wound healing, prevention or healing according to claim 1, wherein the skin extract is extracted using water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. The composition according to claim 2, wherein the lower alcohol having 1 to 4 carbon atoms is methanol. The composition for external application for wound healing, prevention or healing according to claim 1, wherein the composition for external application for wound healing, prevention or healing is a pharmaceutical composition for preventing or treating wounds. The composition according to claim 1, wherein the composition for external application for skin for wound healing, prevention or healing is a cosmetic composition for wound healing. A method for producing a skin extract having a wound-healing, prevention or healing effect, comprising the step of extracting the skin of the skin using water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. 7. The method according to claim 6, wherein the lower alcohol having 1 to 4 carbon atoms is methanol. A method for improving the wound healing, prevention, or healing efficacy of a hairy dressing comprising the step of extracting hairy hair using water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. 9. The method of claim 8, wherein the lower alcohol having 1 to 4 carbon atoms is methanol.

Images