KR20140032060A - Rapd primer and method for selecting chinese cabbage having heat stress tolerance - Google Patents

Rapd primer and method for selecting chinese cabbage having heat stress tolerance Download PDF

Info

Publication number
KR20140032060A
KR20140032060A KR1020120098190A KR20120098190A KR20140032060A KR 20140032060 A KR20140032060 A KR 20140032060A KR 1020120098190 A KR1020120098190 A KR 1020120098190A KR 20120098190 A KR20120098190 A KR 20120098190A KR 20140032060 A KR20140032060 A KR 20140032060A
Authority
KR
South Korea
Prior art keywords
seq
chinese cabbage
primer
dna
rapd
Prior art date
Application number
KR1020120098190A
Other languages
Korean (ko)
Other versions
KR101395645B1 (en
Inventor
정상민
아스자드 알리
Original Assignee
동국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 동국대학교 산학협력단 filed Critical 동국대학교 산학협력단
Priority to KR1020120098190A priority Critical patent/KR101395645B1/en
Publication of KR20140032060A publication Critical patent/KR20140032060A/en
Application granted granted Critical
Publication of KR101395645B1 publication Critical patent/KR101395645B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/139Random amplification polymorphism detection [RAPD]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a RAPD primer for selecting Chinese cabbages having high temperature stress tolerance and a selection method of Chinese cabbages having high temperature stress tolerance using the same. A RAPD primer of the present invention can easily select Chinese cabbages having high temperature stress tolerance and is advantageous for developing and breeding Chinese cabbage species having high temperature stress tolerance in a short time and at low costs.

Description

고온 스트레스 저항성 배추의 선별을 위한 RAPD 프라이머 및 이를 이용한 고온 스트레스 저항성 배추의 선별방법{RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance}Technical Field [0001] The present invention relates to a RAPD primer for selecting high temperature stress resistant Chinese cabbage and a method for selecting high temperature stress resistant Chinese cabbage using the RAPD primer and method for selecting Chinese cabbage having heat stress tolerance.

본 발명은 고온 스트레스 저항성 배추의 선별을 위한 RAPD 프라이머 및 이를 이용한 고온 스트레스 저항성 배추의 선별방법에 관한 것이다.The present invention relates to a RAPD primer for screening high temperature stress resistant Chinese cabbage and a method for selecting high temperature stress resistant Chinese cabbage using the same.

배추는 우리나라의 4대 채소작물 중의 하나이고, 연간 230만 톤 생산으로 약 1조원의 시장으로 추정되는 주요 경제작물이다.Cabbage is one of the four major vegetable crops in Korea and is a major economic crop estimated at about 1 trillion won in annual production of 2.3 million tons.

여러 비 생물체에 의한 스트레스(abiotic stress)는 배추작물의 생산력에 가장 큰 제한요인으로 작용할 수 있다. 예를 들어 생육 적정온도보다 낮은 온도에 의한 피해, 반대로 높은 온도에 의한 피해, 수분부족에서 오는 피해, 토양의 과다 염류로 인한 피해 등은 예측이 어려운 재해이므로 이러한 여러 비 생물체에 의한 스트레스 저항력이 높은 품종의 개발이 필요하다. The abiotic stress caused by various non-living organisms may be the greatest limiting factor in the productivity of Chinese cabbage crops. For example, damage caused by temperature lower than the optimum temperature for growth, damage due to high temperature, damage due to lack of water, damage due to excessive salts in the soil and the like are difficult to predict. Development of varieties is necessary.

전통육종 방법을 사용하여 새로운 품종을 개발할 때 원하는 형질을 표현형 검정과정으로 선발하게 된다. 하지만 표현형 검정이 어렵거나 긴 시간을 요구하기도 한다. 또한 선발과정에서 원치 않는 형질도 같이 도입될 수 있다. 그러므로 육종과정에서 선발과 제거는 여러 형질에서 동시에 이루어져야 하지만 많은 표현형의 동시검정은 어려운 과제이다. 이러한 부분에서 분자마커의 개발은 표현형 검정 단계를 마커 확인으로 대신할 수 있다. 따라서 표현형 검정의 단계를 쉽고 빠르게 진행할 수 있는 분자마커의 개발이 품종개발 기술 확립에 필수적이다. When a new breed is developed using the traditional breeding method, the desired trait is selected as a phenotyping test. However, phenotype testing can be difficult or time-consuming. In addition, unwanted traits can be introduced in the selection process. Therefore, selection and elimination in the breeding process should be done simultaneously in different traits, but simultaneous testing of many phenotypes is a difficult task. The development of molecular markers in these areas can replace the phenotyping step with marker validation. Therefore, the development of molecular markers that can easily and quickly carry out the step of phenotyping test is essential for establishing the breeding technology.

배추작물에 있어서 고온 스트레스에 저항성을 가지는 유전자에 위치하거나 또는 가까이 인접한 분자마커의 개발은 전통육종 기술에 분자마커 활용 기술을 접목하여 빠른 시간에 적은 비용으로 품종을 개발할 수 있는 장점을 가지므로 반드시 개발되어야 할 분야이다. The development of molecular markers located in or near to genes resistant to high-temperature stress in Chinese cabbage crops has the advantage of developing varieties at a low cost in a short period of time by incorporating molecular marker utilization techniques into traditional breeding techniques. It is an area that should be.

한편, 최근 들어 분자생물학 분야의 급진적인 발전과 더불어 식물의 속, 종간 또는 종내 품종간 분류에 분자생물학적인 방법들이 다양하게 사용되고 있다. 이를 위하여 핵산(DNA) 수준에서 유전자원의 다양성(genetic diversity) 연구를 가능케 하는 핵산 지문 분석 방법 및 다양한 DNA 마커들이 개발되고 있다. 분자생물학 수준에서의 DNA 분석에 의한 변종의 감별은 그 변종의 양적수준과 더불어 다수의 특성을 파악하여 알 수 있으며 환경의 영향을 배제할 수 있는 장점이 있다. 그 중에서 RFLP(제한효소 단편 장다형, Restriction Fragment Length Polymorphism)는 일련의 DNA 사슬을 제한효소로 처리했을 때 생기는 DNA 단편들이 개체간의 유전적 조성의 차이 즉, 염기 서열상의 차이에 따라서 그 수나 길이가 서로 다르게 나타난다는 사실에 기초한 것으로써 다양하게 이용되고 있다. 하지만 RFLP는 순도가 높은 DNA가 다량으로 필요하며 시간과 노력과 비용이 많이 소요될 뿐 아니라 시험과정이 복잡하고 방사성 동위원소를 이용해야 하는 단점이 있다. 이러한 문제점을 극복하기 위한 방법으로 기술적으로 단순하고 다형상성(Polymorphism)의 추적이 용이한RAPD(Random Amplified Polymorphic DNA) 방법이 개발되었다. RAPD 방법은 신속하게 결과를 도출하며 적용하기 쉽고 사전에 염기 서열 정보를 가질 필요가 없다. 이를 이용한 기술로서, 대한민국 등록특허 제10-0264743호에 “marker RAPD를 이용한 벼의 유묘 내냉성에 관여하는 양적 형질 유전자 지도(QTL)와 저온저항성 벼품종 선발 방법”이 개시되어 있고, 대한민국 등록특허 제10-0215084호에 “RAPD 표식에 의한 고려인삼의 산지 판별방법 및 그 방법에 사용되는 프라이머”가 개시되어 있으며, 대한민국 등록특허 제10-0764561호에 “RAPD 표지인자를 이용한 양파의 웅성불임회복 유전자판별 방법”이 개시되어 있다. In recent years, along with the radical development of molecular biology, molecular biologic methods have been widely used to classify plants as genus, species, or species. To this end, nucleic acid fingerprint analysis methods and various DNA markers have been developed that enable genetic diversity studies at the DNA level. The discrimination of strains by DNA analysis at the level of molecular biology has the advantage of being able to grasp many characteristics along with the quantitative level of the strains and to exclude the influence of the environment. Among them, RFLP (Restriction Fragment Length Polymorphism) is a technique in which DNA fragments generated when a series of DNA chains are treated with a restriction enzyme have a number or length depending on the difference in genetic composition between individuals, that is, It is based on the fact that it appears differently and is being used variously. However, RFLP requires large amounts of high-purity DNA, is time-consuming, labor-intensive and costly, has a complex test procedure, and has a disadvantage of using radioactive isotopes. To overcome these problems, RAPD (Random Amplified Polymorphic DNA) method, which is technically simple and easy to track polymorphism, has been developed. The RAPD method provides quick results and is easy to apply and does not need to have sequence information in advance. As a technique using this, Korean Patent No. 10-0264743 discloses "quantitative trait gene map (QTL) and low temperature resistant rice varieties selection method involving rice cold seedling resistance using marker RAPD" 10-0215084 discloses " a method for discriminating the origin of Korean ginseng by RAPD marking and a primer used in the method ", and Korean Patent No. 10-0764561 discloses " a male sterile restorative gene Discrimination method "

이에 본 발명자는 고온 스트레스의 저항성을 갖는 배추를 선별하고 육종하기 위하여, 고온 스트레스 저항성을 갖는 배추의 특정 부위를 특이적으로 증폭하는 RAPD 프라이머 서열을 개발함으로써, 본 발명을 완성하게 되었다.Accordingly, the present inventors have completed the present invention by developing a RAPD primer sequence that specifically amplifies a specific region of Chinese cabbage having high-temperature stress resistance, in order to screen and breed Chinese cabbage with high-temperature stress resistance.

본 발명의 목적은 서열번호 14의 염기서열로 구성된 고온 스트레스 저항성 배추 선별용 RAPD(random amplified polymorphic DNAs) 프라이머를 제공하는 것이다.It is an object of the present invention to provide a random amplified polymorphic DNA (RAPD) primer for high temperature stress resistant Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 14.

본 발명의 다른 목적은 상기 프라이머를 포함하는 고온 스트레스 저항성 배추 선별용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for screening a high temperature stress resistant Chinese cabbage comprising the primer.

본 발명의 또 다른 목적은 상기 프라이머를 이용하여 고온 스트레스 저항성 배추를 선별하는 방법을 제공하는 것이다.It is still another object of the present invention to provide a method for screening hot stress-resistant Chinese cabbage using the primer.

본 발명은 서열번호 14의 염기서열로 구성된 고온 스트레스 저항성 배추 선별용 RAPD(random amplified polymorphic DNAs) 프라이머를 제공한다.The present invention provides a random amplified polymorphic DNA (RAPD) primer for high temperature stress resistant Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 14.

또한, 본 발명은 상기 프라이머를 포함하는 고온 스트레스 저항성 배추 선별용 키트를 제공한다.In addition, the present invention provides a high temperature stress resistant Chinese cabbage selection kit comprising the primer.

또한, 본 발명은 상기 프라이머를 이용하여 고온 스트레스 저항성 배추를 선별하는 방법을 제공한다.The present invention also provides a method for selecting a high temperature stress resistant cabbage using the primer.

본 발명의 RAPD 프라이머는 고온 스트레스 저항성 배추를 용이하게 선별할 수 있고, 빠른시간에 적은 비용으로 고온 스트레스 저항성을 갖는 배추 품종을 개발 및 육종할 수 있는 장점이 있다.The RAPD primer of the present invention has an advantage of being able to easily select high temperature stress resistant Chinese cabbage and to develop and breed cabbage varieties having high temperature stress resistance at a low cost in a short time.

도 1은 서열번호 14의 염기서열로 구성된 RAPD 프라이머를 이용하여 PCR을 수행한 후, 전기영동 결과를 확인한 도이다.
도 2는 서열번호 1 내지 14에 의하여 증폭된 서열의 유전자 지도를 나타낸 도이다.
도 3은 서열번호 1 내지 14에 의하여 증폭된 서열이 고온 스트레스 저항성과 연관된 정도를 나타낸 도이다.
FIG. 1 is a view showing the result of electrophoresis after performing PCR using a RAPD primer consisting of the nucleotide sequence of SEQ ID NO: 14.
Fig. 2 is a diagram showing a gene map of the sequence amplified by SEQ ID NOS: 1 to 14. Fig.
3 is a diagram showing the degree to which the sequence amplified by SEQ ID NOS: 1-14 is associated with high temperature stress resistance.

본 발명은 서열번호 14의 염기서열로 구성된 고온 스트레스 저항성 배추 선별용 RAPD(random amplified polymorphic DNAs) 프라이머를 제공한다.The present invention provides a random amplified polymorphic DNA (RAPD) primer for high temperature stress resistant Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 14.

이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명에서는 고온 스트레스 저항성으로 알려진 배추 계통 "92"와 고온 스트레스 감수성으로 알려진 "93" 계통을 교배하여 F1세대 및 F1의 자가수분 세대인 "91" 개체의 F2 집단을 육성하였다. 이 후, 520개의 RAPD 프라이머를 이용하여 92, 93 및 F2 집단에 대하여, PCR을 수행한 후, 전기영동을 하였다. 고온 스트레스 저항성 배추 계통의 "92" 및 F2 집단 중 고온 스트레스 저항성의 표현형을 갖는 배추에서만 나타나는 서열번호 14에 의하여 증폭되는 서열인 Z08_420 부위의 전기영동 밴드를 확인하였다. 상기 밴드의 DNA 서열 분석결과 서열번호 15의 염기서열을 갖는 것을 확인하였다. 또한, 서열번호 1 내지 14에 의해 증폭된 서열과 서열번호 15의 유전자 지도를 작성한 후, 고온 스트레스 저항성과의 연관도를 분석한 결과, 서열번호 14에 의하여 증폭된 서열번호 15의 염기서열이 고온 스트레스 저항성과 연관되어 있는 것을 확인하였다. 따라서, 서열번호 14의 RAPD 프라이머를 이용하여, 고온 스트레스 저항성 배추를 선별할 수 있음을 확인하였다.In the present invention, the "F2" group of "91" individuals, which is the self generation of F1 generation and F1, was breed by crossing the "92" series of Chinese cabbage strain known as "high temperature stress resistance" and the "93" strain known as high temperature stress sensitivity. Thereafter, PCR was performed on the 92, 93, and F2 populations using 520 RAPD primers, followed by electrophoresis. The electrophoretic bands of the Z08_420 region, which is amplified by SEQ. ID. NO. 14, which is present only in the cabbages having a high temperature stress resistance phenotype among the "92" and F2 groups of the high temperature stress resistant cabbage line, were confirmed. As a result of DNA sequence analysis of the band, it was confirmed to have the nucleotide sequence of SEQ ID NO: 15. The sequence amplified by SEQ ID NOs: 1 to 14 and the gene map of SEQ ID NO: 15 were generated and analyzed for their correlation with high temperature stress resistance. As a result, the nucleotide sequence of SEQ ID NO: 15 amplified by SEQ ID NO: And that it is associated with stress resistance. Therefore, it was confirmed that high temperature stress resistant Chinese cabbage can be selected using the RAPD primer of SEQ ID NO: 14.

본 발명의 RAPD란 무작위적으로 합성한 DNA 서열을 의미하고, 이를 프라이머로 사용할 수 있다.The RAPD of the present invention means a randomly synthesized DNA sequence, which can be used as a primer.

본 발명에서 사용하는 용어인 프라이머란 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(DNA 중합효소 또는 역전사 효소) 및 상이한 4가지 dNTP (deoxynucleoside triphosphate)의 존재하에서 DNA 합성을 개시할 수 있다.The term primer used in the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template and has a starting point for template strand copying ≪ / RTI > Primers can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphosphates (dNTPs) at appropriate buffers and temperatures.

프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다. 본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속, 철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

또한, 본 발명의 프라이머 핵산 서열은 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소 (예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자, 화학그룹 (예를 들어, 바이오틴) 등이 있다.In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (eg horseradish peroxidase, alkaline phosphatase), radioisotopes (eg 32 P), fluorescent molecules, chemical groups (eg biotin), and the like. There is this.

본 발명의 RAPD 프라이머에 의하여 증폭된 서열은 서열번호 15의 염기서열인 것을 특징으로 한다.The sequence amplified by the RAPD primer of the present invention is characterized by being the nucleotide sequence of SEQ ID NO:

본 발명의 "선별"은 특정 표현형을 갖는 배추를 선택하는 것을 의미한다.
"Sorting" of the present invention means selecting a Chinese cabbage having a specific phenotype.

또한, 본 발명은 상기 서열번호 14의 염기서열로 구성된 RAPD 프라이머를 포함하는 고온 스트레스 저항성 배추의 선별용 PCR 키트를 제공한다.In addition, the present invention provides a PCR kit for screening high temperature stress resistant Chinese cabbages comprising a RAPD primer consisting of the nucleotide sequence of SEQ ID NO: 14.

상기 고온 스트레스 저항성 배추의 선별용 PCR 키트는 상기의 프라이머 세트 이외에, PCR 키트에 포함되는 통상적인 구성성분을 포함할 수 있다. 상기 키트에 포함되는 통상적인 구성성분은 반응완충액, 중합효소, dNTP(dATP, dCTP, dGTP 및 dTTP) 및 Mg2 +와 같은 조인자 등일 수 있다. 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, E. coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이고, 이는 Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, 및 Pyrococcus furiosus (Pfu)를 포함한다. 상기 중합효소 대부분은 박테리아 그 자체로부터 분리될 수 있고 또는 상업적으로 구입할 수 있다. 또한, 본 발명에 이용되는 중합효소는 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다. 중합 반응을 실시할 때, 반응 용기에 반응에 필요한 성분들을 과량으로 제공하는 것이 바람직하다. 증폭 반응에 필요한 성분들의 과량은, 증폭반응이 성분의 농도에 실질적으로 제한되지 않는 정도의 양을 의미한다.The selection PCR kit for the high-temperature stress-resistant Chinese cabbage may include, in addition to the above-described primer set, conventional components included in the PCR kit. A typical composition included in the kit may joinja the like, such as a reaction buffer and polymerase, dNTP (dATP, dCTP, dGTP and dTTP) and Mg + 2. A variety of DNA polymerases can be used in the amplification step of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu) . Most of these enzymes can be isolated from the bacteria itself or commercially available. In addition, the polymerase used in the present invention can be obtained from cells expressing high levels of the cloning gene encoding the polymerase. When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component.

증폭 반응에 이용되는 모든 효소들은 동일한 반응 조건에서 활성 상태일 수 있다. 사실, 완충액은 모든 효소들이 최적의 반응 조건에 근접하도록 한다. 따라서, 본 발명의 증폭 과정은 반응물의 첨가와 같은 조건의 변화 없이 단일 반응물에서 실시될 수 있다.
All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.

또한, 본 발명은In addition,

1)서열번호 14의 염기서열로 구성된 RAPD 프라이머와 배추로부터 추출한 DNA 시료를 혼합하여 PCR을 수행하는 단계; 및1) performing PCR by mixing RAPD primer composed of the nucleotide sequence of SEQ ID NO: 14 with DNA sample extracted from Chinese cabbage; And

2)상기 1)단계의 증폭된 시료를 전기영동 하는 단계;를 포함하는 고온 저항성 배추의 선별방법을 제공한다.
2) electrophoresis of the amplified sample of step 1).

또한, 본 발명의 서열번호 14의 RAPD 프라이머 서열에 의하여 증폭되는 서열번호 15의 염기서열을 고온 스트레스 저항성 배추를 식별하는 마커로 사용할 수 있다.In addition, the nucleotide sequence of SEQ ID NO: 15 amplified by the RAPD primer sequence of SEQ ID NO: 14 of the present invention can be used as a marker for identifying the high temperature stress resistant Chinese cabbage.

상기 서열번호 15의 염기서열 또는 이의 상보적인 염기서열을 프로브로 이용할 수 있다. 본 발명에서 프로브란 혼성화 프로브를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 이를 이용하여, 배추의 게놈 DNA를 추출하여, 상기 서열번호 15의 염기서열 또는 이의 상보적인 염기서열을 프로브로, 배추의 게놈 DNA와 혼성화 시킬 수 있다. 고온 스트레스 저항성 배추의 경우, 상기 서열번호 15의 염기서열에 의하여 혼성화되는 배추를 고온 스트레스 저항성 배추로 결정할 수 있다.
The base sequence of SEQ ID NO: 15 or its complementary base sequence can be used as a probe. In the present invention, the term " probe " refers to a hybridization probe, which means an oligonucleotide capable of specifically binding to a complementary strand of a nucleic acid. Using this, the genomic DNA of the Chinese cabbage can be extracted, and the base sequence of SEQ ID NO: 15 or its complementary base sequence can be hybridized with the genome DNA of the Chinese cabbage as a probe. In the case of high temperature stress resistant Chinese cabbage, the Chinese cabbage hybridized by the nucleotide sequence of SEQ ID NO: 15 can be determined by high temperature stress resistant Chinese cabbage.

본 발명의 상기 서열번호 15의 염기서열 또는 이의 상보적인 염기서열을 포함하는 마이크로어레이를 제공할 수 있다. 본 발명에 따른 마이크로어레이는 당분야의 당업자에게 알려져 있는 통상적인 방법에 의해 제조될 수 있다.A microarray comprising the nucleotide sequence of SEQ ID NO: 15 of the present invention or a complementary base sequence thereof can be provided. The microarray according to the present invention can be produced by a conventional method known to those skilled in the art.

예컨대, 상기 뉴클레오티드는 아미노 실란(amino-silane), 폴리-L-리신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 기판 상에 고정될 수 있다. 또한, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 및 플라스틱으로 이루어진 군에서 선택될 수 있다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법은 파이조 일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅법(micropipetting), 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용할 수 있다.
For example, the nucleotide can be immobilized on a substrate coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde. In addition, the substrate may be selected from the group consisting of a silicon wafer, glass, quartz, metal, and plastic. Methods for immobilizing the polynucleotide on a substrate include micropipetting using a piezo electric method and a method using a pin-type spotter.

이하, 본 발명을 실시 예에 의거하여 보다 구체적으로 설명한다. 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.

실시예Example 1  One 고온 스트레스 저항성 배추 선별을 위한 특이적 Specific for high temperature stress resistant Chinese cabbage 프라이머primer 및 이에 의하여 증폭되는 서열 탐색 And a sequence search amplified thereby

1. 배추 계통 교배1. Chinese cabbage crossing

고온 스트레스 저항성으로 알려진 배추 계통 "92"와 고온 스트레스 감수성으로 알려진 "93" 계통을 교배하여 F1세대 및 F1의 자가수분 세대인 "91" 개체의 F2 집단을 육성하였다. 상기 F2 세대를 이용하여 실험을 진행하였다.
We breed F2 groups of "91" individuals, which are the F1 generations and the self-water generation of F1, by crossing the "93" line known as high temperature stress resistance "92" and the high temperature stress sensitive "93" line. The experiment was conducted using the F2 generation.

2. 각 배추 계통의 2. Each Chinese cabbage line DNADNA 추출 extraction

92, 93 및 91 계통의 F2 개체에서 배추 잎을 채취한 후, 동결건조 후 CTAB(cetyltrimethylammonium bromide) 방법을 이용하여 DNA를 추출하였다. After extracting the Chinese cabbage leaves from F2 plants of 92, 93 and 91 lines, DNA was extracted using CTAB (cetyltrimethylammonium bromide) method after lyophilization.

보다 구체적으로 추출 방법은 분쇄기로 15분 분쇄하였고, 수조에서 65℃로 10분 가열하였다. 5M의 암모늄아세테이트 250㎕를 넣어준 후, 원심분리를 10분동안 실시하였다. 원심 분리 후, 상층액을 취하여 차가운 EtOH를 900㎕ 가하고, 10분 동안 -70℃를 유지시켰다. 이 후, 알코올로 건조시키고, 증류수를 가하였다. 이렇게 추출한 DNA를 분광 측정기를 이용하여 농도를 측정하고, 최종농도를 10ng/㎕로 희석하였다.
More specifically, the extraction method was pulverized by a pulverizer for 15 minutes and heated in a water bath at 65 ° C for 10 minutes. After adding 250 5 of 5M ammonium acetate, centrifugation was carried out for 10 minutes. After centrifugation, the supernatant was taken and 900 쨉 l of cold EtOH was added and kept at -70 째 C for 10 minutes. Thereafter, it was dried with alcohol and distilled water was added. The DNA thus extracted was measured for its concentration using a spectrophotometer, and the final concentration was diluted to 10 ng / μl.

3. 추출한 3. Extracted DNADNA of PCRPCR 증폭 Amplification

당업계에서 통상적인 방법으로 제조한 520 종류의 RAPD(Random amplified polymorphic DNA) 프라이머(A01~Z20)를 이용하여 상기 실시예 1의 2에서 추출한 DNA를 PCR 증폭시켰다. 총량 15㎕(증류수 6.02㎕, dNTP 0.4㎕, Etaq 중합효소 0.08㎕, 10x Etaq 완충용액 1.5㎕, 프라이머 2㎍/㎕, DNA 5㎕)의 용액을 이용하여 PCR을 수행하였다. PCR 수행은 최초 변성을 95℃, 3분간 실시한 후, 변성은 95℃에서 15초, 어닐링 과정은 36℃에서 30초, 신장 과정은 72℃에서 2분 수행하였으며, 50번 반복 수행하였다.
The DNA extracted in 2 of Example 1 was amplified by PCR using 520 kinds of random amplified polymorphic DNA (RAPD) primers (A01 to Z20) prepared by a conventional method in the art. PCR was carried out using a total amount of 15 μl (6.02 μl of distilled water, 0.4 μl of dNTP, 0.08 μl of Etaq polymerase, 1.5 μl of Etaq buffer, 2 μg / μl of primer and 5 μl of DNA). PCR was carried out at 95 ° C for 3 minutes, denaturation at 95 ° C for 15 seconds, annealing at 36 ° C for 30 seconds, and extension at 72 ° C for 2 minutes.

4. 전기영동 분석 4. Electrophoretic analysis

520 종류의 RAPD 프라이머를 이용하여 증폭한 시료를 각각, 에티디움 브로마이드(1.5 μg/mL)가 포함된 1.5% 아가로오스겔을 이용한 전기영동을 수행하였다. 이 중, 밴드가 명확하고 다형성을 보이는 프라이머 세트를 선택하였고, 이의 서열을 하기의 표 1에 나타내었다. 이하의 QTL 분석에서 가장 고온 스트레스와 연관된 것으로 나타난 서열번호 14의 프라이머로 증폭한 경우의 전기 영동 분석 결과를 도 1에 나타내었다.Samples amplified using 520 RAPD primers were subjected to electrophoresis using 1.5% agarose gel containing ethidium bromide (1.5 μg / mL). Of these, primer sets with clear bands and showing polymorphism were selected and their sequences are shown in Table 1 below. FIG. 1 shows the results of electrophoresis analysis when amplified with the primer of SEQ ID NO: 14, which is associated with the highest temperature stress in the QTL analysis below.

A12A12 TCGGCGATAGTCGGCGATAG 서열번호1SEQ ID NO: 1 C13C13 AAGCCTCGTCAAGCCTCGTC 서열번호2SEQ ID NO: 2 E11E11 GAGTCTCAGGGAGTCTCAGG 서열번호3SEQ ID NO: 3 F03F03 CCTGATCACCCCTGATCACC 서열번호4SEQ ID NO: 4 J05J05 CTCCATGGGGCTCCATGGGG 서열번호5SEQ ID NO: 5 K03K03 CCAGCTTAGGCCAGCTTAGG 서열번호6SEQ ID NO: 6 N16N16 AAGCGACCTGAAGCGACCTG 서열번호7SEQ ID NO: 7 M04M04 GGCGGTTGTCGGCGGTTGTC 서열번호8SEQ ID NO: 8 P14P14 CCAGCCGAACCCAGCCGAAC 서열번호9SEQ ID NO: 9 Q14Q14 GGACGCTTCAGGACGCTTCA 서열번호10SEQ ID NO: 10 Q15Q15 GGGTAACGTGGGGTAACGTG 서열번호11SEQ ID NO: 11 R12R12 ACAGGTGCGTACAGGTGCGT 서열번호12SEQ ID NO: 12 X01X01 CTGGGCACGACTGGGCACGA 서열번호13SEQ ID NO: 13 Z08Z08 GGGTGGGTAAGGGTGGGTAA 서열번호14SEQ ID NO: 14

도 1에 나타낸 바와 같이, 고온 스트레스 저항성을 갖는 92 개체와 F2 세대 중 고온 스트레스에 대해 저항성을 보이는 개체에서만 나타난 DNA 밴드 부위를 확인하였다. 상기 밴드 부위를 Z08_420이라고 하고, 이의 염기서열을 서열번호 15에 나타내었다. 따라서, 상기 서열번호 14의 프라이머는 고온 스트레스 저항성 배추를 선별하는데 사용할 수 있다는 것을 확인하였고, 이에 의하여 증폭된 서열은 고온 스트레스 저항성과 연관된 서열임을 확인하였다.
As shown in Fig. 1, 92 DNA probes with high-temperature stress resistance and DNA bands showing only resistance to high temperature stress among F2 generations were identified. The band region is designated as Z08_420, and its nucleotide sequence is shown in SEQ ID NO: Therefore, it was confirmed that the primer of SEQ ID NO: 14 can be used for screening high-temperature stress-resistant Chinese cabbage, whereby the amplified sequence is a sequence associated with high-temperature stress resistance.

실시예Example 2  2 유전자 지도 작성 및 Genetic mapping and QTLQTL 분석 analysis

상기 표 1의 RAPD 프라이머로 증폭된 서열에 대하여 Joinmap 4.0 (Van Ooijen, 2006)프로그램을 사용하여 연관 분석을 통한 유전자 지도를 작성하였고,Genomic maps were generated by association analysis using the Joinmap 4.0 (Van Ooijen, 2006) program for the sequences amplified by the RAPD primers shown in Table 1,

MAPQTL 5.0 (Van Ooijen, 2004)프로그램의 multiple QTL model 방법으로Z08_420과 고온에 대한 스트레스 저항성(내서성)과의 연관정도를 분석하였다.MAPQTL 5.0 (Van Ooijen, 2004) program was used to analyze the relationship between Z08_420 and stress resistance to high temperature.

상기의 유전자 지도는 도 2에 나타내었고, 배추의 내서성 표현형과 연관정도를 도 3에 나타내었다.The gene map is shown in FIG. 2, and the degree of association with the endogenous expression pattern of Chinese cabbage is shown in FIG.

도 2에 나타난 바와 같이, 서열번호 15의 Z08_420은 서열번호 10, 11의 Q14 및 Q15로 증폭된 서열(Q14_590 및 Q15_483)의 사이에 존재한다.As shown in Fig. 2, Z08_420 of SEQ ID NO: 15 is present between the sequences amplified by Q14 and Q15 of SEQ ID NOs: 10 and 11 (Q14_590 and Q15_483).

또한, 도 3에 나타난 바와 같이, 서열번호 15와 배추의 내서성과 연관정도가 가장 우수하였고, 서열번호 15와 유전적으로 가까운 거리에 존재하는 Q14_590 및 Q15_483이 내서성 표현형과 연관정도가 우수하였다.In addition, as shown in Fig. 3, the correlation between SEQ ID NO: 15 and the cabbage was highest, and Q14_590 and Q15_483, which are genetically close to SEQ ID NO: 15, were highly correlated with the endogenous phenotype.

따라서, 서열번호 15의 Z08_420을 검출함으로써, 고온 스트레스 저항성이 있는 배추를 선별할 수 있음을 확인하였다. Thus, by detecting Z08_420 of SEQ ID NO: 15, it was confirmed that Chinese cabbage with high temperature stress resistance can be selected.

또한, 서열번호 15의 염기서열은 고온 스트레스 저항성 배추에서 특이적으로 검출되는 바, 이를 고온 스트레스 저항성 배추에 대한 프로브로 이용할 수 있음을 확인하였다.
In addition, the nucleotide sequence of SEQ ID NO: 15 was specifically detected in hot stress-resistant Chinese cabbage, and it was confirmed that it can be used as a probe for hot stress-resistant Chinese cabbage.

<110> Dongguk University Industry-Academic Cooperation Foundation <120> RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance <130> P-1.84 <160> 15 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is A 12 RAPD primer <400> 1 tcggcgatag 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is C 13 RAPD primer <400> 2 aagcctcgtc 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is E11 RAPD primer <400> 3 gagtctcagg 10 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is F03 RAPD primer <400> 4 cctgatcacc 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is J05 RAPD primer <400> 5 ctccatgggg 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is K03 RAPD primer <400> 6 ccagcttagg 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is N16 RAPD primer <400> 7 aagcgacctg 10 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is M04 RAPD primer <400> 8 ggcggttgtc 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is P14 RAPD primer <400> 9 ccagccgaac 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Q14 RAPD primer <400> 10 ggacgcttca 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Q15 RAPD primer <400> 11 gggtaacgtg 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is R12 RAPD primer <400> 12 acaggtgcgt 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is X01 RAPD primer <400> 13 ctgggcacga 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Z08 RAPD primer for selecting Chinese Cabbage having heat stress tolerance <400> 14 gggtgggtaa 10 <210> 15 <211> 397 <212> DNA <213> Artificial Sequence <220> <223> it is DNA sequence amplified by Z08 RAPD primer <400> 15 cctgtcatag ttagctaccc acatggtgaa tgcgtgcttt gggattcctc ctttgaacca 60 aacgacatct acccaatctt taagctcttc ccgcggccgc agcacctccc atgtggttga 120 cgacctgaaa gtatgtaacg gagaatcacc agctatccat tcataatcat cattcacatc 180 aacaggaaga ggcaaactaa tagtagtaag ataagtatgg agttcaactt ccttttggga 240 tcttgggtga ggcagcgacc aaacagagtc atttattgcg tcagccacca cagcattctt 300 ccttatcctc agagatcttg gcccagcact accaatgtgt tcgattaact gaccgagggg 360 cgtccatacg tcgaaccaga aactggctct cctccca 397 <110> Dongguk University Industry-Academic Cooperation Foundation <120> RAPD primer and method for selecting Chinese Cabbage having heat          stress tolerance <130> P-1.84 <160> 15 <170> Kopatentin 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is A 12 RAPD primer <400> 1 tcggcgatag 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is C 13 RAPD primer <400> 2 aagcctcgtc 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is E11 RAPD primer <400> 3 gagtctcagg 10 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is F03 RAPD primer <400> 4 cctgatcacc 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is J05 RAPD primer <400> 5 ctccatgggg 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is K03 RAPD primer <400> 6 ccagcttagg 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is N16 RAPD primer <400> 7 aagcgacctg 10 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is M04 RAPD primer <400> 8 ggcggttgtc 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is P14 RAPD primer <400> 9 ccagccgaac 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Q14 RAPD primer <400> 10 ggacgcttca 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Q15 RAPD primer <400> 11 gggtaacgtg 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is R12 RAPD primer <400> 12 acaggtgcgt 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is X01 RAPD primer <400> 13 ctgggcacga 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> it is Z08 RAPD primer for selecting Chinese Cabbage having heat          stress tolerance <400> 14 gggtgggtaa 10 <210> 15 <211> 397 <212> DNA <213> Artificial Sequence <220> <223> it is DNA sequence amplified by Z08 RAPD primer <400> 15 cctgtcatag ttagctaccc acatggtgaa tgcgtgcttt gggattcctc ctttgaacca 60 aacgacatct acccaatctt taagctcttc ccgcggccgc agcacctccc atgtggttga 120 cgacctgaaa gtatgtaacg gagaatcacc agctatccat tcataatcat cattcacatc 180 aacaggaaga ggcaaactaa tagtagtaag ataagtatgg agttcaactt ccttttggga 240 tcttgggtga ggcagcgacc aaacagagtc atttattgcg tcagccacca cagcattctt 300 ccttatcctc agagatcttg gcccagcact accaatgtgt tcgattaact gaccgagggg 360 cgtccatacg tcgaaccaga aactggctct cctccca 397

Claims (6)

서열번호 14의 염기서열로 구성된 고온 스트레스 저항성 배추 선별용 RAPD(random amplified polymorphic DNAs) 프라이머.A random amplified polymorphic DNA (RAPD) primer for high temperature stress resistant Chinese cabbage comprising the nucleotide sequence of SEQ ID NO: 14. 제1항에 있어서, 상기 서열번호 14의 염기서열에 의하여 증폭되는 염기서열은 서열번호 15의 염기서열인 것을 특징으로 하는, 고온 스트레스 저항성 배추 선별용 RAPD 프라이머.The RAPD primer according to claim 1, wherein the base sequence amplified by the nucleotide sequence of SEQ ID NO: 14 is the nucleotide sequence of SEQ ID NO: 15. 제1항의 RAPD 프라이머를 포함하는 고온 저항성 배추 선별용 PCR 키트A high temperature resistant Chinese cabbage selection PCR kit comprising the RAPD primer of claim 1 1)서열번호 14의 염기서열로 구성된 RAPD 프라이머와 배추로부터 추출한 DNA 시료를 혼합하여 PCR을 수행하는 단계; 및
2)상기 1)단계의 증폭된 시료를 전기영동하는 단계;를 포함하는 고온 저항성 배추의 선별방법.
1) performing PCR by mixing RAPD primer composed of the nucleotide sequence of SEQ ID NO: 14 with DNA sample extracted from Chinese cabbage; And
2) electrophoresing the amplified sample of step 1).
서열번호 15의 염기서열 또는 이의 상보적인 염기서열로 구성된 고온 스트레스 저항성 배추 선별용 프로브.A high temperature stress resistant Chinese cabbage screening probe comprising a nucleotide sequence of SEQ ID NO: 15 or a complementary base sequence thereof. 제5항에 있어서, 상기 서열번호 15의 염기서열은 서열번호 14의 염기서열로 구성된 프라이머에 의하여 증폭되는 염기서열인 것을 특징으로 하는, 고온 스트레스 저항성 배추 선별용 프로브.
The high-temperature stress resistant Chinese cabbage screening probe according to claim 5, wherein the base sequence of SEQ ID NO: 15 is a base sequence amplified by a primer consisting of the base sequence of SEQ ID NO: 14.
KR1020120098190A 2012-09-05 2012-09-05 RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance KR101395645B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120098190A KR101395645B1 (en) 2012-09-05 2012-09-05 RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120098190A KR101395645B1 (en) 2012-09-05 2012-09-05 RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance

Publications (2)

Publication Number Publication Date
KR20140032060A true KR20140032060A (en) 2014-03-14
KR101395645B1 KR101395645B1 (en) 2014-05-19

Family

ID=50643779

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120098190A KR101395645B1 (en) 2012-09-05 2012-09-05 RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance

Country Status (1)

Country Link
KR (1) KR101395645B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102019998B1 (en) * 2018-06-19 2019-09-10 대한민국 Heat stress responsive genes in White Pekin duck, and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100264743B1 (en) * 1998-02-06 2002-09-17 손재근 Map QTL related to cold tolerance at seedling stage of rice using RAPD marker and selection method of cold tolerant rice variety

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102019998B1 (en) * 2018-06-19 2019-09-10 대한민국 Heat stress responsive genes in White Pekin duck, and use thereof

Also Published As

Publication number Publication date
KR101395645B1 (en) 2014-05-19

Similar Documents

Publication Publication Date Title
Ribaut et al. Use of STSs and SSRs as rapid and reliable preselection tools in a marker-assisted selection-backcross scheme
CN106480228B (en) The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3
KR101883117B1 (en) SNP marker for selecting tomato cultivars resistant to tomato Bacterial wilt and use thereof
KR101979218B1 (en) Composition for determining bud mutation cultivar of Fuji apple
KR101748366B1 (en) Molecular marker for selecting tomato leaf mold resistant and selection method using the same molecular marker
JP2009100653A (en) Polynucleotide containing single nucleotide polymorphism (snp), snp marker used for discriminating species of rice and comprising the polynucleotide, and method for discriminating species of rice by the snp analysis
KR20180055075A (en) Single nucleotide polymorphism marker for selecting bacterial wilt-resistant or sensitive pepper cultivar and uses thereof
KR101395645B1 (en) RAPD primer and method for selecting Chinese Cabbage having heat stress tolerance
KR101955074B1 (en) Snp markers for discrimination of raphanus sativus
KR102458440B1 (en) Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set
KR101826732B1 (en) Method and Kit for identifying variety of Chrysanthemum using single nucleotide polymorphism markers
KR101803678B1 (en) Primer sets for detecting Dyella thiooxydans ATSB10 and uses thereof
JP2013000066A (en) Method for identifying tree species of interspecific hybrid of eucalyptus
KR101714764B1 (en) Molecular marker for discrimination of Alexandre melon F1 cultivars and use thereof
KR101739754B1 (en) SNP primer set for origin identification of sesame, method for origin identification of sesame using the same and kit comprising the same
KR102296889B1 (en) Molecular marker for selecting Gray leaf spot resistant or susceptible tomato cultivar and selection method using the same molecular marker
CN109161605B (en) Development and application of SNP molecular marker of rice blast resistance gene Pi1
KR101492989B1 (en) PCR primer set related to heat stress tolerance in Chinese cabbage using HRM analysis
KR101481734B1 (en) Microsatellite marker of Korean Astragalus mongholicus and primer set for amplifying the same
KR101864858B1 (en) Composition for the differentiation of Angelica sinensis oliv. Diels, Levisticum officinale and Angelica acutiloba Kitag lines and use thereof
KR100842429B1 (en) Ssr primer derived from lawn grass and use thereof
KR100769367B1 (en) Ssr primer derived from common millet and use thereof
KR101673293B1 (en) Primer sets for determining identity of rice, method of determining identity of rice using the same and kit using the same
KR101464247B1 (en) Single nucleotide polymorphism marker for selecting fusarium wilt-resistant or sensitive cabbage cultivar and uses thereof
KR102604102B1 (en) Marker derived from complete sequencing of chloroplast genome of Paeonia genus, primer set for discrimination of Paeonia genus and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180502

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190430

Year of fee payment: 6