KR102019998B1 - Heat stress responsive genes in White Pekin duck, and use thereof - Google Patents

Abstract

The present invention relates to a duck gene corresponding to a high-temperature stress and a use thereof. According to the present invention, differential expression genes are derived by analyzing duck transcripts exposed to high-temperature stress, an expression pattern and functional classification for each pattern of the differential expression genes are confirmed, and main metabolic pathways and gene control forms related to an adaptive response gene cluster for high-temperature stress are confirmed. In addition, the total of 21 genes in which the expression amount is commonly increased in all comparison groups and the total of 7 genes in which the expression amount is decreased in accordance with exposure to high-temperature stress of a duck are confirmed, and a change in relative mRNA expression amount of 2 genes is verified by additionally confirming 2 differential expression genes. Therefore, the total of 30 differential expression genes are used as a biomarker for detecting whether the duct is exposed to high-temperature stress, thereby establishing optimal breeding conditions of the duck to contribute to an increase in productivity, and being used to breed a duck group having high adaptability on high temperature in response to climate warming.

Description

Heat stress responsive genes in White Pekin duck, and use}

The present invention relates to a duck gene and its use in response to high temperature stress.

In recent years, damage to heatwaves of livestock due to abnormal temperatures is increasing year by year, especially poultry, unlike other mammals, is physiologically sweat-free, and the whole body is covered with feathers is known to be vulnerable to heat, severe heat damage. Heatwaves reduce productivity, including slower feed intake, slower growth, delayed shipment age, and reduced meat quality, resulting in increased economic mortality for farmers. In addition, global warming is expected to accelerate the temperature rise of the Korean peninsula in the future. By 2030, it is expected to rise by 2 ℃ from the present, and by 2065 by 4 ℃.

It has been reported that high temperature stress causes oxidative stress caused by free radical production in poultry's body, destroying the structure and function of cells as well as proteins, carbohydrates and fats (Fellenberg, MA et al. American Journal of Food and Nutrition , 1 (2): 12-21, 2013). In addition, high stressed poultry physiologically deplete Na ⁺ , K ⁺ and HCO3 ^- ions in the body, so it is necessary to supply Na ⁺ and K ⁺ ions with Cl ^- ions in order to maintain the optimal state of the chicken body. Reported. Feeding fiber-rich feeds to poultry exposed to high temperatures or feeding chromium and riboflavin has been reported to reduce heat stress. There is a report that it can be weighted and replaced with amino acids such as lysine and methionine or to prepare for high temperature stress by feeding a diet rich in vitamin C.

In order to cope with a decrease in productivity and an increase in mortality of the poultry exposed to high temperature stress as described above, it is necessary to prepare a heat wave countermeasure through the physiological change and gene expression analysis of the poultry exposed to the high temperature stress. Accordingly, the present inventors studied a total of two genes whose expression changes according to the high temperature stress exposure of ducks, and a total of 21 types of genes and expressions that are expressed through the study of gene expression differences and interactions observed before and after the high temperature stress exposure of ducks. The present invention was completed by discovering this decreasing total of seven gene biomarker candidates.

Disclosure of Invention An object of the present invention is to provide a duck gene whose expression level changes in response to high temperature stress and a method for detecting whether the duck is exposed to high temperature stress using the same.

In order to achieve the above object, the present invention is exposed to the high temperature stress of duck including a detection reagent that specifically binds to each one or more genes selected from the group consisting of the genes set forth in SEQ ID NO: 1 and 2 It provides a composition for detection.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

In addition, the present invention is exposed to the high temperature stress of duck, in which the oligonucleotides or complementary strand molecules thereof constituting the nucleic acid sequence of each one or more genes selected from the group consisting of the genes set forth in SEQ ID NOs: 1 and 2 are integrated Provided are a microarray chip for detecting presence.

In addition, the present invention provides a composition for detecting the exposure to high temperature stress of ducks comprising a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 3 to 23.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

In addition, the present invention provides a microarray chip for detecting whether ducks are exposed to high temperature stress, in which oligonucleotides or their complementary strand molecules constituting the nucleic acid sequence of each gene of SEQ ID NOs: 3 to 23 are integrated. to provide.

In addition, the present invention provides a composition for detecting the exposure to high temperature stress of ducks comprising a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 24 to 30.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

In addition, the present invention provides a microarray chip for detecting whether the duck is exposed to high temperature stress in which the oligonucleotides or its complementary strand molecules constituting the nucleic acid sequence of each gene of SEQ ID NOS: 24 to 30 are integrated. to provide.

The present invention derives differential expression genes through analysis of transcripts of ducks exposed to high temperature stress, confirms expression patterns and functional classification of the differential expression genes, and is a major metabolism related to adaptive response gene clusters for high temperature stress. Pathway and gene regulatory forms were identified. In addition, a total of 21 genes in which the expression level is increased and 7 genes in which the expression amount is reduced in common in all comparison groups according to the high-temperature stress exposure of the duck were identified. In addition, the two genes were identified by identifying two differential expression genes. Relative mRNA expression changes were verified. Therefore, by utilizing the total 30 kinds of differential expression genes according to the present invention as a biomarker for detecting the high temperature stress exposure of the duck, to establish the optimum breeding conditions of the duck to contribute to the increase in productivity, and to adapt to the high temperature adaptation to climate warming It can be used to nurture this high duck population.

1 is a graph of the distribution of duck transcripts for each experimental group analyzed by multidimensional scalining (C: control group, 3H: high temperature stress 3 hours exposure group, and 6H: high temperature stress 6 hours exposure group).
FIG. 2 is a volcano plot (A) and Venn diagram (B) for significant differential expression genes following high temperature stress exposure of ducks (C: control, 3H: hot stress 3 hour exposure group, and 6H: group of 6 hours exposure to high temperature stress).
3 is a graph showing the differential expression patterns (A and B) of adaptive response gene clusters and enhanced functional classification (C) of these gene clusters following high temperature stress exposure in ducks.
4 is a graph showing the differential expression patterns (A and B) of chronic response gene clusters and enhanced functional classification (C) of these gene clusters following high temperature stress exposure in ducks.
FIG. 5 is a graph showing differential expression patterns (A and B) of maladaptive response gene clusters and enhanced functional classification of these gene clusters following high temperature stress exposure in ducks.
FIG. 6 is a diagram (A) and a pie chart (B) showing the results of a network analysis of the enhanced function of adaptive response gene clusters following high temperature stress exposure in ducks.
FIG. 7 is a diagram illustrating the gene regulation patterns in neuroactive ligand receptor interaction pathways for adaptive response gene clusters for high temperature stress in ducks.
FIG. 8 is a diagram of gene regulation patterns in type 2 diabetes related pathways for adaptive response gene clusters for high temperature stress in ducks.
9 is a diagram analyzing the gene regulation pattern in the ErbB signaling pathway for the adaptive response gene cluster for high temperature stress in ducks.
10 is a graph of the relative values of UTS2R (A) and PIK3R6 (B) mRNA in the muscle tissue of ducks exposed to high temperature stress.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for detecting the exposure to high temperature stress of a duck comprising a detection reagent that specifically binds to each of at least one gene selected from the group consisting of the genes set forth in SEQ ID NOs: 1 and 2.

The gene may be derived from a white pekin duck, and may have a polynucleotide sequence of each of the genes set forth in SEQ ID NO: 1 or 2, as well as a polynucleotide having a base sequence substantially identical to the polynucleotide and a fragment thereof. It includes. Polynucleotides having substantially the same base sequence may have at least 80%, specifically at least 90%, more specifically at least 95% homology with the polynucleotide of the present invention.

The detection reagent may be any one or more selected from the group consisting of antibodies, antibody fragments, aptamers, primers, probes, and anti-sense nucleotides.

The antibody may be a monoclonal antibody, polyclonal antibody or recombinant antibody. Antibodies can be readily prepared using techniques well known in the art. The antibody fragment may comprise a functional fragment of an antibody molecule. A functional fragment of an antibody molecule refers to a fragment having at least antigen binding function and may be Fab, F (ab '), F (ab') 2, Fv, and the like.

The monoclonal antibodies can be prepared using hybridoma methods or phage antibody library techniques that are well known in the art. In general, hybridoma cells secreting monoclonal antibodies can be made by fusing cancer cells with immune cells isolated from immunologically suitable host animals, such as mice injected with antigenic proteins. These two populations of cell fusions are performed using methods known in the art, such as polyethylene glycol, and cells producing antibodies can be propagated by standard culture methods. Specifically, subcloning may be performed using a limiting dilution method to obtain a uniform cell population, and then hybridoma cells capable of producing an antibody specific for the antigen may be prepared by culturing in large quantities in vitro or in vivo. Antibodies prepared by the above method can be isolated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography and the like.

The polyclonal antibody can be prepared by injecting an immunogen biomarker protein or fragment thereof into an external host according to methods well known in the art. The external host can be a mammal such as a mouse, rat, sheep, rabbit. When the immunogen is injected by intramuscular, intraperitoneal or subcutaneous injection methods, it can be administered with an adjuvant to increase antigenicity. Thereafter, blood may be collected periodically from an external host to obtain serum showing improved titer and specificity for the antigen, from which the antibody may be isolated and purified.

The aptamer is an oligonucleotide molecule having binding activity to a predetermined target molecule, and may be RNA, DNA, modified oligonucleotide, or a mixture thereof, and may be in linear or cyclic form.

The primers are complementary to each one or more genes selected from the group consisting of genes set forth in SEQ ID NOs: 1 and 2 of the present invention, and any primers designed to amplify them may be used.

The probe is a nucleic acid fragment corresponding to short to several hundreds of bases that can form specific binding with DNA or RNA, and can be used to confirm the presence or absence of specific DNA or RNA. The probe may be prepared in the form of oligonucleotide probe, single-stranded DNA probe, double-stranded DNA probe, RNA probe, etc., and may be labeled with biotin, FITC, rhodamine, digoxigenin, or the like, or labeled with radioisotopes. have.

The antisense nucleotides can be those having double or single stranded DNA, double or single stranded RNA, DNA / RNA hybrids, DNA and RNA analogues and base, sugar or backbone modifications.

The detection reagent may further include a ligand that can specifically bind to the detection reagent. The ligand may be a conjugate labeled with a detector such as a chromophore, a fluorescent substance, a radioisotope or a colloid, and a ligand treated with streptavidin or avidin.

The composition for detecting whether the duck is exposed to high temperature stress may include distilled water or a buffer solution to keep their structure stable in addition to the detection reagent as described above.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each one or more genes selected from the group consisting of the genes set forth in SEQ ID NOs: 1 and 2.

The RNA amount measurement of step 2) may be performed according to methods well known in the art, and specifically, by reverse transcription polymerase chain reaction (RT-PCR) or quantitative real-time RT-PCR (RT-PCR). Can be performed.

In the detection method, the expression amount of the gene described in SEQ ID NO: 1 is 1 to 24 hours, 1 to 18 hours, 1 to 12 hours, 1 to 7 hours, 3 to 24 hours, 3 to 18 hours, 3 to 12 hours, 3 to 7 hours, 4 to 24 hours, 4 to 18 hours, 4 to 12 hours, 4 to 7 hours, 5 to 24 hours, 5 to 18 hours, 5 to 12 hours, or 5 to 7 hours May increase and then decrease.

In the detection method, the expression amount of the gene described in SEQ ID NO: 2 is 1 to 24 hours, 1 to 18 hours, 1 to 12 hours, 1 to 7 hours, 3 to 24 hours, 3 to 18 hours, 3 as compared to the control group. For 12 to 12 hours, 3 to 7 hours, 4 to 24 hours, 4 to 18 hours, 4 to 12 hours, 4 to 7 hours, 5 to 24 hours, 5 to 18 hours, 5 to 12 hours, or 5 to 7 hours It may decrease and then increase.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each one or more genes selected from the group consisting of the genes set forth in SEQ ID NOs: 1 and 2.

The kit for detecting whether the duck is exposed to high temperature stress may be prepared by a conventional manufacturing method known to those skilled in the art, and may further include a buffer, a stabilizer, an inactive protein, and the like.

The kit can be used for ultra-fast screening by fluorescence method performed by detecting fluorescence of a fluorescent substance attached as a detector to detect the amount of detection reagent or by radiation method performed by detecting radiation of a radioisotope attached as a detector. Throughput screening (HTS) system, surface plasmon resonance (SPR) method for measuring the plasmon resonance change of the surface in real time without labeling of the detector, or surface plasmon resonance imaging (SPRI) method for imaging and confirming the SPR system can be used.

In addition, the present invention is exposed to the high temperature stress of duck, in which the oligonucleotides or complementary strand molecules thereof constituting the nucleic acid sequence of each one or more genes selected from the group consisting of the genes set forth in SEQ ID NOs: 1 and 2 are integrated Provided are a microarray chip for detecting presence.

The gene may have the characteristics as described above, and the microarray chip may be manufactured by a method known to those skilled in the art. Specifically, the searched gene can be used as a probe to be immobilized on a substrate of a microarray chip. In this case, the fixing may be performed using a micropipetting method using a piezoelectric method or a method using a pin type spotter. The substrate of the microarray chip may be coated with one or more active groups selected from the group consisting of amino-silane, poly-Llysine, and aldehyde. In addition, the substrate may be made of one selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose film.

In a specific embodiment of the present invention, the present inventors derive differential expression genes through transcript analysis of ducks exposed to high temperature stress, in order to discover duck-derived genes that change when exposed to high temperature stress, and expression of the differential expression genes. Patterns and functional classification by pattern were identified and major metabolic pathways and gene regulatory forms related to adaptive response gene clusters for high temperature stress were identified (see FIGS. 1-9). In addition, two genes were found to be increased or decreased or decreased and then increased in response to the high temperature stress exposure of the duck, and the relative mRNA expression changes of the genes were verified (see FIG. 10 and Table 2).

Therefore, by utilizing the two differential expression genes according to the present invention as a biomarker for detecting whether the duck is exposed to high temperature stress, the optimum breeding conditions for the duck are established, contributing to the increase in productivity, and adapting to high temperature in response to climate warming. It can be used to nurture this high duck population.

In addition, the present invention provides a composition for detecting the exposure to high temperature stress of ducks comprising a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 3 to 23.

The gene may be derived from a white Pekin's duck, and includes a polynucleotide having a base sequence substantially identical to that of the polynucleotide, as well as a polynucleotide sequence of each of the genes represented by SEQ ID NOs: 3 to 23, and fragments thereof. do. Polynucleotides having substantially the same base sequence may have at least 80%, specifically at least 90%, more specifically at least 95% homology with the polynucleotide of the present invention.

The detection reagent may be any one or more selected from the group consisting of an antibody, an antibody fragment, an aptamer, a primer, a probe, and an antisense nucleotide, and may have the characteristics as described above.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each of the genes set forth in SEQ ID NOs: 3 to 23.

The RNA amount measurement of step 2) may be performed according to methods well known in the art, and specifically, may be performed by RT-PCR or quantitative real-time RT-PCR.

In the detection method, the expression level of any one or more genes selected from the group of genes set forth in SEQ ID NOs: 3 to 23 may be increased compared to the control group.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each of the genes set forth in SEQ ID NOs: 3 to 23.

The kit for detecting whether the duck is exposed to high temperature stress may have the characteristics as described above, and may detect the amount of the detection reagent by using the detection method as described above.

In addition, the present invention provides a microarray chip for detecting whether ducks are exposed to high temperature stress, in which oligonucleotides or their complementary strand molecules constituting the nucleic acid sequence of each gene of SEQ ID NOs: 3 to 23 are integrated. to provide.

The gene may have the characteristics as described above, the microarray chip may be manufactured by a method known to those skilled in the art, and specifically may be manufactured by the method as described above.

In a specific embodiment of the present invention, the present inventors derive differential expression genes through transcript analysis of ducks exposed to high temperature stress, in order to discover duck-derived genes that change when exposed to high temperature stress, and expression of the differential expression genes. Patterns and functional classification by pattern were identified and major metabolic pathways and gene regulatory forms related to adaptive response gene clusters for high temperature stress were identified (see FIGS. 1-9). In addition, as a result of the high-temperature stress exposure of ducks, a total of 21 differential expression genes, in which the expression level was increased in common in all comparison groups, were identified (see FIG. 2B and Table 3).

Therefore, by utilizing the total 21 species of differential expression gene according to the present invention as a biomarker for detecting the high temperature stress exposure of the duck, to establish the optimum breeding conditions of the duck to contribute to the increase in productivity, and to adapt to the high temperature adaptation to the climate warming It can be used to nurture this high duck population.

In addition, the present invention provides a composition for detecting the exposure to high temperature stress of ducks comprising a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 24 to 30.

The gene may be derived from a white Pekin's duck, and includes a polynucleotide having a base sequence substantially the same as that of the polynucleotide as well as a polynucleotide sequence of each of the genes represented by SEQ ID NOs: 24 to 30, and fragments thereof. do. Polynucleotides having substantially the same base sequence may have at least 80%, specifically at least 90%, more specifically at least 95% homology with the polynucleotide of the present invention.

The detection reagent may be any one or more selected from the group consisting of an antibody, an antibody fragment, an aptamer, a primer, a probe, and an antisense nucleotide, and may have the characteristics as described above.

In addition, the present invention comprises the steps of: 1) separating the RNA from the duck of the experimental group and ducks of the normal control group exposed to high temperature stress, respectively; 2) measuring the amount of RNA using the composition of the RNA of step 1); And 3) comparing the amount of RNA in step 2) with a control to confirm the expression level.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 24 to 30.

The RNA amount measurement of step 2) may be performed according to methods well known in the art, and specifically, may be performed by RT-PCR or quantitative real-time RT-PCR.

In the detection method, the expression level of any one or more genes selected from the group of genes set forth in SEQ ID NOs: 24 to 30 may be reduced compared to the control group.

In addition, the present invention provides a kit for detecting the exposure to high temperature stress of the duck comprising the composition.

The composition may have the features as described above. In one example, the composition may comprise a detection reagent that specifically binds to each of the genes set forth in SEQ ID NO: 24 to 30.

The kit for detecting whether the duck is exposed to high temperature stress may have the characteristics as described above, and may detect the amount of the detection reagent by using the detection method as described above.

In addition, the present invention provides a microarray chip for detecting whether the duck is exposed to high temperature stress in which the oligonucleotides or its complementary strand molecules constituting the nucleic acid sequence of each gene of SEQ ID NOS: 24 to 30 are integrated. to provide.

The gene may have the characteristics as described above, the microarray chip may be manufactured by a method known to those skilled in the art, and specifically may be manufactured by the method as described above.

In a specific embodiment of the present invention, the present inventors derive differential expression genes through transcript analysis of ducks exposed to high temperature stress, in order to discover duck-derived genes that change when exposed to high temperature stress, and expression of the differential expression genes. Patterns and functional classification by pattern were identified and major metabolic pathways and gene regulatory forms related to adaptive response gene clusters for high temperature stress were identified (see FIGS. 1-9). In addition, a total of seven differential expression genes in which the expression level decreases in common in all comparison groups according to the high temperature stress exposure of the duck was confirmed (see FIG. 2B and Table 4).

Therefore, by utilizing the seven differential expression genes according to the present invention as a biomarker for detecting the high temperature stress exposure of the duck, to establish the optimum breeding conditions of the duck to contribute to the increase in productivity, and to adapt to the high temperature adaptation to the climate warming It can be used to nurture this high duck population.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

Example 1 Duck Exposure and Tissue Extraction for High Temperature Stress

A total of nine male white Pekin ducks, three weeks old, were approved by the Animal Experimental Ethics Committee (No. NIAS2016-216). Nine ducks were separated into three groups, each with a control group, 3 hours hot stress exposure group or 6 hours hot stress group. All ducks were adapted for 2 weeks at 25 ° C., 60% humidity conditions, after which the controls were kept at the same conditions and the hot stress exposed group was exposed to 35 ° C. for 3 or 6 hours each. Ducks were sacrificed after the end of the experiment, the chest muscles were extracted, cut into pieces of 1 cm ³ size and stored at -80 ° C.

Experimental Example 1. Confirmation of weight loss and increase in rectum temperature of ducks exposed to high temperature stress

As physical changes to the high temperature stress of ducks, weight and rectal temperature changes were measured. Specifically, the weight and rectal temperature of the control and ducks exposed to high temperature stress were measured before and after the experiment to calculate the change value.

Control High temperature stress
3 hour exposure group High temperature stress
6 hour exposure group P value Weight loss
(Mean ± standard deviation, g) -67.58 ^b ± 19.65 -76.24 ^b ± 15.65 -106.98 ^a ± 13.53 <0.01 Rectal temperature change
(Mean ± standard deviation, ° C) -0.5 ^b ± 0.21 +1.48 ^a ± 0.63 +1.68 ^a ± 0.22 <0.001

In Table 1, a and b are statistically significantly different from each other.

As a result, the duck weight of all groups decreased during the experiment, and unlike the 3 hours exposure group of high temperature stress, the 6 hours exposure group of the high temperature stress significantly reduced the body weight. On the other hand, while the rectal temperature of the control group was slightly decreased, the 3 hours and 6 hours exposure group of hot stress increased significantly compared to the control group (Table 1). This suggests that high temperature stress is induced in ducks when raised under high temperature conditions of 35 ° C.

Experimental Example 2 Derivation of Differential Expression Genes by Transcriptome Analysis of Ducks Exposed to High Temperature Stress

Using the breast muscle tissue of the duck obtained in Example 1, the following experiment was performed to analyze the transcript change according to the high temperature stress exposure of the duck and to derive differentially expressed genes.

2-1. RNA isolation and library construction

Total RNA was extracted from the chest muscle tissue of the duck using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. The amount and purity of the extracted RNA were analyzed using a bioanalyzer (Bioanalyzer 2100, Agilent, USA) and RNA nano lab chip kit (RNA 6000 Nano LabChip Kit, Agilent), where RIN (RNA integrity number) was maintained at 0.8 or higher. It was. Poly-A mRNA was isolated from about 10 μg of total RNA extracted from each sample using poly-T oligo-attached magnetic beads (Invitrogen). The mRNA was purified and cleaved into small pieces using divalent cations at high temperature. Thereafter, mRNA fragments were reverse-transcribed using mRNA sequencing sample preparation kit (mRNA-Seq Sample Preparation Kit, Illumina, USA) to prepare a final complementary DNA (cDNA) library. At this time, the average insertion size of the paired-end library was 300 ± 50 bp.

2-2. RNA sequencing

Paired end sequencing analysis was performed using the cDNA library and the Illumina instrument (HiSeq 2500) to yield a total of 310 million paired end reads with an average of 34.5 million reads and 51.42% GC content per sample. Was created. The paired end leads were filtered using FastQC and Trimmomatic, leaving a total of 320 million leads at an average of 33.6 million leads per sample. It was mapped according to the Tuxedo protocol and aligned to the duck reference genome (BGI_duck_1.0). All possible transcripts were derived using the Reference Guided Transcriptome Assembly (RABT) mode of Cufflinks v 2.2.1. The expression level of the transcript was measured using a mapped read of a known transcript (BGI_duck_1.0), and calculated as a fraction per kilobase of transcript per million mapped reads (FPKM). The FPKM levels were normalized to compare expression profiles between samples. Transcripts with zero FPKM values in at least two subjects in each experimental group and transcripts without significant false discovery rate (FDR) values (q <0.05) in each experimental group were excluded. Then, the FPKM value was calculated as a log2 fold change, and the log2 fold change values of the three (3H / C, 6H / C and 6H / 3H) comparison groups were differentially expressed genes using Cuffdiff. DEGs) were used for the analysis.

2-3. Determination of Transcript Distribution in Ducks Exposed to High Temperature Stress

The transcripts of each experimental group duck derived in Example 2-2 were analyzed by multidimensional scaling, and the distribution of the transcripts of the control group, the high temperature stress 3 hours exposure group and the high temperature stress 6 hours exposure group was measured. , The distribution of transcripts in each group showed a distinct difference (FIG. 1).

2-4. Derivation of Differential Genes in Ducks Exposed to High Temperature Stress

The differential expression genes derived in Example 2-2 were analyzed according to the log2 fold change of the FPKM value and the FDR value, and represented as volcano plots, of which the log2 fold change of the FPKM value was 1 or more and FDR. Genes with values greater than 0.05 were selected as significant differential expression genes (FIG. 2A). The significant differential expression genes were analyzed by three (3H / C, 6H / C, and 6H / 3H) comparison groups, and the number of genes corresponding to each comparison group was represented by a Venn diagram. In general, all genes differentially expressed in the comparison group were identified as a total of 28 genes, 21 up-regulated genes and 7 down-regulated genes (FIG. 2B). Ensembl Gene ID information and log2 fold change values of the 28 kinds of genes and the two differential expression genes are shown in Tables 2 to 4 below.

2 types of differential expression genes whose expression changes according to high temperature stress exposure Ensembl
Gene ID Ensembl
Transcript ID Gene name log2 multiples
Change (3H) log2 multiples
Change (6H) log2 multiples
Change (6H / 3H) SEQ ID NO: ENSAPLG00000001600 ENSAPLT00000001591 UTS2R 1.25 -0.26 -1.51 One ENSAPLG00000015945 ENSAPLT00000016655 PIK3R6 -1.88 -1.16 0.72 2

21 differential expression genes up-regulated by high temperature stress exposure Ensembl
Gene ID Ensembl
Transcript ID relation
Gene name log2 multiples
Change (3H) log2 multiples
Change (6H) log2 multiples
Change (6H / 3H) SEQ ID NO: ENSAPLG00000001007 ENSAPLT00000000991 MOS 1.90 2.92 1.02 3 ENSAPLG00000001984 ENSAPLT00000001979 CCR9 1.35 2.78 1.43 4 ENSAPLG00000002015 ENSAPLT00000002015 1.98 3.14 1.16 5 ENSAPLG00000002247 ENSAPLT00000002250 4.05 5.48 1.43 6 ENSAPLG00000002382 ENSAPLT00000002423 ABCG2 2.55 3.67 1.12 7 ENSAPLG00000003077 ENSAPLT00000003161 1.34 3.41 2.07 8 ENSAPLG00000005338 ENSAPLT00000005556 HSF4 1.47 3.54 2.07 9 ENSAPLG00000005514 ENSAPLT00000005733 GRM4 2.68 4.97 2.29 10 ENSAPLG00000006412 ENSAPLT00000006641 FBXL4 1.16 2.29 1.13 11 ENSAPLG00000007118 ENSAPLT00000007390 ALX4 1.03 2.26 1.22 12 ENSAPLG00000007474 ENSAPLT00000007787 1.81 4.54 2.73 13 ENSAPLG00000011107 ENSAPLT00000011554 1.63 2.74 1.10 14 ENSAPLG00000011331 ENSAPLT00000011830 1.45 2.82 1.37 15 ENSAPLG00000013278 ENSAPLT00000013819 2.11 3.19 1.07 16 ENSAPLG00000013478 ENSAPLT00000014092 1.13 2.14 1.01 17 ENSAPLG00000014155 ENSAPLT00000014735 C2orf82 1.41 2.49 1.07 18 ENSAPLG00000014742 ENSAPLT00000015359 3.34 4.37 1.04 19 ENSAPLG00000015473 ENSAPLT00000016185 PRKG2 3.75 4.97 1.22 20 ENSAPLG00000015634 ENSAPLT00000016294 1.51 2.55 1.04 21 ENSAPLG00000015797 ENSAPLT00000016463 1.04 3.73 2.70 22 ENSAPLG00000016189 ENSAPLT00000016889 KIAA1644 1.68 3.13 1.45 23

7 types of differential expression genes down-regulated by high temperature stress exposure Ensembl
Gene ID Ensembl
Transcript ID relation
Gene name log2 multiples
Change (3H) log2 multiples
Change (6H) log2 multiples
Change (6H / 3H) SEQ ID NO: ENSAPLG00000002305 ENSAPLT00000002306 -1.14 -2.25 -1.11 24 ENSAPLG00000005651 ENSAPLT00000005875 MAT1A -1.90 -3.67 -1.78 25 ENSAPLG00000005854 ENSAPLT00000006051 -1.34 -2.61 -1.27 26 ENSAPLG00000008337 ENSAPLT00000008672 IGSF11 -1.65 -2.70 -1.05 27 ENSAPLG00000009149 ENSAPLT00000009531 LECT1 -1.39 -2.47 -1.08 28 ENSAPLG00000009563 ENSAPLT00000009982 ATP8A2 -1.23 -2.51 -1.28 29 ENSAPLG00000014812 ENSAPLT00000015451 ASB15 -1.13 -2.46 -1.33 30

Through Experimental Examples 2-1 to 2-4, it was confirmed that the transcript showed a change according to the high temperature stress exposure of the duck, and differential expression genes showing a significant difference were derived.

Experimental Example 3 Identification of Differential Expression Patterns and Function Classifications of Differential Expression Genes of Ducks Exposed to High Temperature Stress

Analysis of differential expression patterns by clustering analysis on the significant differential expression genes derived from Experimental Example 2, and enhancement of each cluster by functional enrichment analysis and GO (gene ontology) functional clustering analysis Functional classification was confirmed.

Specifically, the clustering analysis uses k-means clustering algorithm of MeV software (MultiExperiment Viewer software), the enhancement analysis uses the Kyoto Encyclopedia of Genes and Genomes (KEGG) path database, and the GO function clustering analysis uses DAVID analysis tool (DAVID Bioinformatics Resources). 6.8 enrichment tool). The genes used for functional analysis were identified as the official genetic symbol for Homo sapiens of the HUGO gene nomenclature, and the ENTREZ gene ID corresponding to the gene symbol was used. Significant values of the enriched pathway were shown with fold enrichment as log 10 P values.

As a result of the clustering analysis, it was classified into 6 clusters of 2 adaptive response gene clusters, 2 chronic response gene clusters, and 2 non-adaptive response gene clusters according to the expression pattern, and the clusters were up-regulated and recovered according to the temperature stress exposure time 349 and 482 genes were included in 1 and down-regulated and recovered cluster 2, respectively, confirming the expression patterns of the most genes among all differential expression genes (FIGS. 3 to 5).

In addition, the analysis of the reinforcement function of each cluster shows that each cluster has enhanced biological functions related to thermal regulation, especially Rap1 signaling pathways and energy homeostasis that are closely related to energy balance control in clusters 1 and 2, which are adaptive response gene clusters Functions related to lipid metabolism, which are important to maintain, have been enhanced (FIGS. 3-5).

Experimental Example 4 Identification of Enhanced KEGG Pathway and Related Gene Regulatory Forms of Adaptive Response Gene Clusters in Ducks Exposed to High Temperature Stress

Network analysis was performed using the ClueGo plug-in of Cytoscape for the enhanced functions of the adaptive response gene cluster to the high temperature stress of the duck derived in Experimental Example 3, and a representative KEGG pathway was derived using Bioconductor and clusterProfiler. Gene regulation forms in the major metabolic pathways were analyzed.

As a result of the network analysis, the pathways such as glycolysis / glycosylation, fatty acid synthesis, neuroactive ligand receptor interactions, myocardial contraction, etc. centered on signal metabolic pathways such as ErbB, Rap1, AMPK, and adipocytokine. It appeared to be connected. In particular, neuroactive ligand receptor interactions, ErbB signaling pathways associated with type 2 diabetes and cancer were statistically significant (p <0.01), which is consistent with the reported activation of stress signaling pathways due to stress. The result is (FIG. 6).

Gene regulation patterns in key metabolic pathways revealed that the SSTR and GRI genes were upregulated and the GPR7 / 8, UTS2R, EDGL, GABR and GHR genes were downregulated in the neuroactive ligand receptor interaction pathway. Meanwhile, PI3K and VDCC genes were upregulated, MafA genes were downregulated in type 2 diabetes-related pathways, and Src and PI3K genes were upregulated in ErbB signaling pathways (FIGS. 7 to 9).

Experimental Example 5 Gene ontology analysis of adaptive response genes of ducks exposed to high temperature stress

GO function clustering analysis was performed on the adaptive response gene clusters for the high temperature stress of ducks derived from Experimental Example 3, and biochemical processes (BP), molecular functions (MF) and cell components. Three categories of cellular components (CC) were analyzed simultaneously.

Top 5 functional GO annotation clusters cluster
number reinforce
score category GO term gene
Number P value Gene name ^a One 2.21 MF Very long-chain fatty acid-CoA ligase activity 4 0.00222 SLC27A6, ACSL4, SLC27A3, ACSBG1 MF Long-chain fatty acid-CoA ligase activity 4 0.00497 BP Long-chain fatty acid metabolic process 4 0.0207 2 1.03 MF Ionotropic glutamate receptor activity 3 0.0639 GRIA2, GRIA1, GRIN3B MF Extracellular glutamate-gated ion channel activity 3 0.0882 BP Ionotropic glutamate receptor signaling pathway 3 0.148 3 0.88 CC Phosphatidylinositol 3-kinase complex 3 0.0547 PIK3C2B, PIK3R5, PIK3R6 BP Phosphatidylinositol biosynthetic process 5 0.0824 BP Phosphatidylinositol phosphorylation 4 0.502 4 0.86 CC Extrinsic component of cytoplasmic side of plasma
membrane 6 0.0383 HCK, ZAP70, TGM3, ERRFI1, SRC, MATK BP Peptidyl-tyrosine autophosphorylation 4 0.104 MF Non-membrane spanning protein tyrosine kinase
activity 4 0.136 MF Protein tyrosine kinase activity 7 0.167 BP Peptidyl-tyrosine phosphorylation 7 0.274 BP Transmembrane receptor protein tyrosine kinase
signaling pathway 5 0.291 5 0.76 MF Microtubule motor activity 6 0.0691 DYNC1I1, KIF25, KIF1A, KIF5C, DYNLRB2, DNAH7 CC Microtubule 13 0.161 BP Microtubule-based movement 5 0.199 CC Kinesin complex 3 0.428

In Table 5, a is a list of genes corresponding to the most significant GO term in the cluster.

As a result of analysis, 4, 3, 3, 6 and 6 genes were identified as genes corresponding to the most significant GO terms in each cluster among the top 5 functional GO annotation clusters with high reinforcement scores (Table 5).

Experimental Example 6. Validation analysis using quantitative real-time polymerase chain reaction (qRT-PCR)

Expression patterns of two differential expression genes, UTS2R and PIK3R6, derived from the adaptive response gene clusters 1 and 2 to the high temperature stress of the duck derived in Experimental Example 3 were verified by qRT-PCR. Single stranded cDNA was synthesized from the total RNA extracted in Experimental Example 2-1 using the cDNA Reverse Transcription Kit (Applied Biosystems, USA) according to the manufacturer's instructions. 1.5 μg of total RNA, primers of the following [Table 6], SYBR Green Realtime PCR Master Mix (Toyobo, Japan) and Real Time PCR System (ABI 7500 Real Time PCR System, Applied Biosystems / Life Technologies, USA) was used to perform qRT-PCR. The C _T value of the target gene was normalized to the value of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and ^quantified by the 2 ^-ΔΔCT method (Livak KJ et al. Methods 25: 402-408, 2001). One-way ANOVA (analysis of variance) was used to compare mRNA expression levels between the experimental groups.

Gene name Sequence (5 '→ 3') size
(bp) assession No. UTS2R forward: CTCTACACCCTGCTCACCAA (SEQ ID NO: 31)
reverse: CGTATGTCTCTGTGCAGTGC (SEQ ID NO: 32) 157 ENSAPLT00000001591.1 ^x PIK3R6 forward: TGATGGTGTGTGCTGTGTTG (SEQ ID NO: 33)
reverse: TGTGCCAGAACTGAGTTTGC (SEQ ID NO: 34) 134 XM_005030660 ^y GAPDH forward: AAGGCTGAGAATGGGAAAC (SEQ ID NO 35)
reverse: TTCAGGGACTTGTCATACTTC (SEQ ID NO: 36) 254 XM_005016745.2 ^y

In Table 6, x is Ensembl and y is a number described in NCBI.

As a result, the relative UTS2R mRNA level was significantly increased compared to the control group in the high-temperature stress 3 hours exposure group, and then recovered to the similar value in the control group in the high-temperature stress 6 hours exposure group again (FIG. 10A). In addition, the relative PIK3R6 mRNA level was significantly decreased compared to the control group in the high-temperature stress 3 hours exposure group, and then recovered again in the high-temperature stress 6 hours exposure group (FIG. 10B). This suggests that duck's UTS2R and PIK3R6 genes are involved in the adaptation to high temperature stress.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Heat stress responsive genes in White Pekin duck, and use <130> 2018P-05-059 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 1143 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000001600 <400> 1 ctaaccgacg agctggagag ccacttctct gcaaccccct acatggtgac agacaccagc 60 gagagcagcc tgttcagaat cagacccaat gcctccacca acgccaccgg ggccggcgtg 120 ccagccgctg gttctatgga ggacatgatt gccatctgca ccatcgggac catcctctcc 180 ctgatgtgtg tgattggggt gaccggcaat gtctacacct tgctggtgat gtgccactac 240 ttgcggtcat ctgcctccat gtatatttac atcatcaacc tcgccctggc agacctcctc 300 taccttctca ccatcccctt catcgttggg acctacttca tccagaaatg gtactttggg 360 gatgttggct gtcgcatcct gttcagtctg gacttcctca ccatgcacgc cagcatcttc 420 acccttacag tcatgagcac agagcgctac tttgctgtgc tgaagcccct tgacacggtg 480 aagaggtcca agagctaccg taaggccatt gctgttgtca tctggctggt atcgctgctg 540 ctcactctcc cgatgctcat catgatccag ctggtgcaaa gggacaacaa aagcatctgc 600 ctgcccacct ggagcaagct gtcctacaaa gtctatctta ccatcctctt tggcaccagc 660 attgtgggcc caggggtaat cattggctac ctctacatcc gactagctaa gatttactgg 720 gtgtcacaaa cagcatcctt caagcagacc aagcggctgc caaaccaaaa ggtgctctat 780 ttaatcttca caatcgtgct ggtgttctgg gcttgcttcc tgcctttctg gatatggcag 840 ctcctcttcc agtattacga atccttccct ctatctccca aggtgatgaa gaacattaat 900 tacctgacaa cctgcctgac ctacagcaac agctgcatca accccttcct ctacaccctg 960 ctcaccaaaa actaccggga gtacctgaag aacaggcagc ggaccctcag cagcagcagt 1020 gggtacttcc aaaggagaaa tcggtttcag aggatttcag ggagatccct gtccacaagc 1080 agccagcact gcacagagac atacgttctt gctcatgctc ctttgggaaa cagcagtgcc 1140 tga 1143 <210> 2 <211> 2328 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000015945 <400> 2 tttgtcactg cagaggtgga gtcggacatc ctgcgccgtg tccgcacgct gctgcgagag 60 ctggacggcc accacccctc ctgccagcat gaccgaggga tgctgcgatg gacattgcac 120 aaaaaaattg accagaatcc cagtagcagc tccatcctgg tcaggatctt ggtgaaagag 180 ctggaaaggg cagagcgagg cgacttccga cattatatca tccccctgct gcacacgctg 240 atgtacaccc tgataaaggc tccctgtatc tccgatgagc tctgcagcag agtgtatgac 300 ttctgcaaga agctgctcac cctgcccaag cctttctgca ccattggttt ggactacgct 360 gtcaggctga agatggaaag ggcagcaccg ggtatgctct accaaagaat ggtgatttcc 420 gagcaaagtc taaaaagcaa cccgtaccct taccaggaaa agattttcat ctttgctgac 480 ccagagctgc tctccgaagc catctgcaac gcgctggtca ccgacacgcg ggcggctcag 540 ctctcccaga gcccacgggt gtgcatgtgc tatgtgatca tccacgccat gcaggcggcc 600 ctgggcgagg gctgcgacct cagcggcttg agaatgagcc tccaggacat gcccatgagc 660 gaggtcgagc actggttcca gcaagtggtg gcagctgtcg agtgcgcggg aagcgaagcg 720 agtgtggacc gcgaacagca cgtggagagg ctggagaaga tttactgtgc cctcctcggc 780 tccttgccac cagtgctctg ctggtgtgat gctcccctgg ggaggctgca ggacatccct 840 ctgcccaacc ccaacatcag cttccacctc tggaaggaag atgaccagct ctggaaggag 900 ctggtgctgt tcatccgccc gctgtcgcag agctgcgagc ccgaccgcct gagccaggac 960 ctggacaact tcgagatcca ggacatcatt tcggagtgcg agtgctgcga gcagacccgc 1020 ttctccgtgc tctccaccga cagcggcatc gagcgggacc tgccgctggc ggccgaggag 1080 cccttcgccc catgcagtgc cgacacggag caatcccggc tccagaggaa gggcggcatt 1140 aagaagaagc catccccgct ggagagcatg gccttcctgc aggccggctg caatggcccc 1200 ggggcgaagc cggcggccaa gccgcagaag aggacaggcg tccccgccaa gcccccggcc 1260 ccgctccaga ggctgcacac tcgcgtggtg ctgctggggg acgaccggct cctggggcgc 1320 ctggcccaag cttaccactc cttgaggtca aggaagcgag aaacgcggcg tgtgttcctg 1380 accccgaggc tgaacctgca gttctactac atcccagttg tgacggggca gcggagcgcg 1440 ccgacagccg cgacccacgc tgctgccggc cccgaggagc tctgcgaggt ggccgggtac 1500 ctgggcagag ccgacccctg gtatgagagc aacatcaaca cgctgtgcca catgatcccc 1560 aagctggcca ccatgccttc ctctccgagc aaacatcttg tgactgatct tttcatcacc 1620 gatgtgatcg cctactacgt ccgcatgggt gcccagcccg tctgcttcca ggtctacgcg 1680 gtgaaggttt tcttcaatga cccagcactg gagccagctg aggacgtctt cctcaccgag 1740 ctgtgtgccc aggttcaaga gagcatctcc cacagagagt taagcctgac caagaagaaa 1800 acaaccctgg agggccctgg catagatctc gcagtaacat acaagaaggt tgtggtgagt 1860 gagcgggcaa aggaggtgtc ggtgtccctg cgctccacag gcctcgtgat gaaggccatc 1920 cctgccgatg aggccgaagc accttcctct tgctgcagct ttcctctttc accttgcctc 1980 aagcacaatc tgttgtgtct gaatgtgaac gtcactgaaa tcattaagat caacaacttg 2040 tcgggacgat ccttctcagc tgtggcaaac aggttgaaaa cgcgtgatat caaaatcagg 2100 agcacagagc agaggccctt cacggtgtgc ctggacaagg acagcagaag aacctacagg 2160 aatgtgatca gtgtggaagt gtcgccctgc ctagagccca gctactgctt gcaaaagaca 2220 aggacaatga aatccagcgt gcacgaagca gaggatgtgg gccttgtgaa gtacatgccc 2280 aagtctctgc tgttgcccat caacacgttt gcaggcgtca tccaatga 2328 <210> 3 <211> 1050 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000001007 <400> 3 atgccatcac ctattccttt taatcacttt cttcctttgg agctctcccc atctgcggac 60 ttgaggccct gcagcagccc cctagttatc cccggcaaag aggggaaggc ctttttggga 120 ggaaccccct cgcccagggt ccgccgcttg cctccgcgcc tggcctggtg ctccatcgac 180 tgggaccagc tctgcctcct gcagcccctg ggctctggag gctttgggtc tgtctacaaa 240 gccacctacc atggtgcgac cgtggctgtg aagcaggtga agaagagcag caaaaaccga 300 ctggcatcac gacagagctt ttgggctgag ctgaacgtcg cctggctgca gcacgagaat 360 gtggtgcgcg tggtggccgc aagcacgtgt gcccctgcca gccagaacag cctgggcacc 420 atcatcatgg agtatgtggg caacatcacc ctgcaccacg ttatttacgg caccggcaag 480 gcgtggaggc agggggagga tgaggaagga gggtgtggca ggaaggctct gagcatggag 540 gaggccgtgg gctatgcctg cgacatcgcc acgggcctgg ccttcctcca cgcgcagggc 600 atcgtgcact tggacctgaa gcctgccaat gtcttcatca cggagcaagg ggtgtgcaag 660 atcggagact tcggctgctc ccagaaactg gaggacggct tgtcccacag cccccacgtt 720 tcccagcacg ggggcaccta cacgcaccgt gcccccgagc tcctcaaggg cgagagggtg 780 acagccaagg cggacatcta ctcctttgcc atcaccctct ggcagatggt catgcgggag 840 cagccctacc tgggcgagcg gcagcatgtg ctctatgccg tggtggccta caacctgcgc 900 ccttccctgg ctgctgccgt tttccacgaa ttgcccatgg gccaaaggct gaggagcatt 960 attagctgct gctggaaggc caacgtggag cagcgcctca gtgctgccca gctgctgccc 1020 agcctcaggg cccttaaggg gagcctctag 1050 <210> 4 <211> 1131 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000001984 <400> 4 aagaccagcc tggattatta caggaacagc acggtgatgt ccctctatgc aaaccccgcc 60 aatgatacgg agctcatgtg tgacagaagg caggtctggc agtttgctcg agccttcctg 120 cctgtatttt tctggctcat cttctctgtg ggcacagtgg gaaacgcctt ggtcgttctc 180 atctactgca aataccgctt caggaggagc atgatggacc gctacctgct gcatctggcc 240 gtcgcagatc tgctcctcct ttttactctc cctttctggg ccaaggctgc ctccgacggc 300 tgggtcttta ggaatttctt gtgcaaagtc gtcaacagca tgtacaagat caacttctat 360 ggctgcatcc tgttcctaac ctgcatcagt tttgacaggt acatcaccat cgtccaggca 420 acgaaagcta aaacgtccaa gcggaggcgg ctcctgcaca acaaacttgt gtgcttggct 480 gtctggctga cgtccatcgg cctgtgcatc cctgagatca tgtacagcca aagcaagcaa 540 gtcggcgaca tgactgtgtg caaaatgatg tacccgccaa acgtcagcat ggtcttcagg 600 gttgctgtcc tggctctgaa agtcacgata ggcttcttcc tcccactcct ggtcatggtt 660 atttgctaca ccctgatcat caacaccctc ctccaagcta aaagatgcca aaagcagaag 720 tcgctgaaga tcatcaccat gatcatcacc gcctttctcc tctctcagtt cccatacaac 780 atcgttttgc tggtcaagac catcaacaca tacaccgggg tggtgtacag ctgctgggcc 840 accaacgggc tggacattgg cctgcaggtc acccagagca tcgccttcct ccacagctgc 900 ctcaacccct tcctctacgt cttcgctggt gagcgcttca ggacggcgct ggcccggctc 960 gtgcggaggc cgaggggcca ggagcagtgc tcctccgtgt gcgacagcca ggagcacagc 1020 tccaactggt ccttcgccat gctggggcgg cggcgggtga ggagctcgct caccctcagc 1080 acccatttga cctcctccat tgttcctgcc tcatgccaag tcttcgtcta a 1131 <210> 5 <211> 408 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG 00000002015 <400> 5 cgaagacaac aatgtcattt gcctccttct gcctgcacga tgtggagcgt caggctgctg 60 ctacagaaag ccctcgttct tctgcacgtc accgcgagcg ttgtcgtcgg caaaacactg 120 atggtgctgt tccccaacac catgaaaagg cacatcctaa aacaaggcga gaagagcaga 180 atgaaccaga accccaagtt cagctacgag aactggggcc cgaccttctt cagcttccag 240 tatttactct tcgtgctgaa ggtgaagtgg aagaggctgg aggacgaagc ctacgaggga 300 cggcctgctc ccaacacacc agtggtgaca tcccaggggg acatccggca cctcttcgac 360 ttcatgcgag gtaaccggcc tttaatcctg aattttggaa gttgcacc 408 <210> 6 <211> 537 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000002247 <400> 6 tatccagacc ccggagcaag gatgaccaca gtgctgccga gcctggtgct ggccctgctc 60 tgcctgctga gggcaggtgc cgaggtccct gtgcagctgg acttcaacat ggggaagttt 120 gcagggaggt ggcacatcac agctgccatt tccaactgcc ccgtgttcct gagcatgaag 180 gacaagatga agtcgtccat tgccaccatc agcttcacgc cggaggggca cctggctatg 240 gaggctatct tccccctgcc agaagaatgc aaaaaggttg agctgctctt ccagaagagt 300 gggcaggcag ggcactacac cagcacagaa aatcaacaaa aaacggacct gcgcgtgatg 360 gatacagact acaagcacta cgccatcgtg nnnnnnnnnn nncaccctgg ccccctcact 420 caccttgggt gtctggctgc agcaagggag ccagatgtga gcccccagtt cctgcagaag 480 tttaaagcgc tcttccacac tgtgggcctg actgaggaca tgctggccat cctgcca 537 <210> 7 <211> 1992 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000002382 <400> 7 agaggaaaaa tggcaggagg ccagtcctac ataaacattc agatgtcaga gtcgagcaca 60 aatggcatcc caagcagcaa gctctctcca gacccggcag accagggagg aagcacacta 120 actttccaca acatctccta cagtgtgaag gtgaagccca ggttcctgtg ctgtagaaaa 180 acagcgagca aagaagtttt gagagatctc aatggcatca tgagaccagg actgaatgca 240 attttggggc ccactggcag tggtaaatct tcgctgctcg acattttggc tgcaaggaaa 300 gaccctcacg ggctttctgg tgacattttg atcaacggag ctcctcagcc tgccaacttt 360 aaatgtacct ctggatacgt agtgcaggat gatgtggtga tggggaccct gaccatcaga 420 gaaaacttcc agttctcagc agcactccgt ttgccaaact ctgtgaagga gcaggacaga 480 aacgaacgag ttaatcagat catcaaggag ctgggtttga gcaaagtggc ggactccaag 540 gttggcaccc agttcactcg tggggtgtcc gggggagagc ggaaaaggac caatatcggg 600 atggagctca tcacagatcc caccatcctc tttttggatg agccaaccac tggactggat 660 gccagcaccg ctaacgccgt cctgctgcta ctgaaaagga tggcaaagca aggaaaaaca 720 atcatcttct ccatccacca gccacggtac tccatattcc ggctgtttga cagcttgaca 780 ctcctggctg cggggcggat gctgtaccat ggccccgctc agcaggccat cacctacttc 840 caatctatcg gctacgagtg cgagccctac aacaatcctg ccgacttctt cctggacatc 900 atcaacgggg actccacggc ggtgatggtg aacaagacca acgaagacaa ctcagcagag 960 agcattgaag aacacattga atacaacaca accttggctg agaagttagc agaaaaatac 1020 tgcaactcca cctactacca agaaacaaaa gcaatactag agaatatttc tttggggaat 1080 acaaagaaaa caaaagcatt tttcagacaa attacatata ccaactcttt ctgtcaccag 1140 ctgaagtggg tgtccaggcg cacattcaaa aatatggtag gaaaccctca agcttccata 1200 gctcaggtgg ttgttacagc tttcctggga ctggttgtag gtgccatttt ctttggactt 1260 aaaaacgaca ccgctggcct ccagaacaga gttggtgcca tgttctttct gaccaccaac 1320 cagtgcttca gcagtatttc agctattgaa ctctttgttg tggaaaagaa gatatttata 1380 catgagtata tcagcgggta ctacggaaca gctgcatatt tcatctcaaa gctgatggct 1440 gatttgatac ccgttaggac tttaccaagc atcatcttca cctgcataac atacttcatg 1500 ttaggtttga agccgacagc agaagccttc tttataatgc tgtttaccct tacgatggtg 1560 tcctacacag ccacttccat ggctctcgcc atcgcaacag gacacgatgt ggtcgctgta 1620 gccaacctat tcatgactat cacatttgtt tttatgatta ttttctctgg gttgctggta 1680 aatctcacga gcatcatgtc ctggctttcc tggctcaagt actttagcat ccctcgatat 1740 ggaatgacag cattacaaat taatgaactg tctggtctga acttttgcac caacaacaca 1800 gggtttcctg gcatggataa ctctcagcca acaatcccga tgtggtgtac tggagaccag 1860 tatcttaaaa gtcaaggcat tgacgtgagt acctggggcc tgtggcagaa tcacgtggct 1920 cttgcctgca tgacagtaat attccttgca atttcatacc tgaaactccg cttcatgaag 1980 aagttttctt aa 1992 <210> 8 <211> 1485 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000003077 <400> 8 atggagctcc tgggactgac tactatcatc ttgctggtct gcatctcatg tcttcttctc 60 tttgcagcat ggagaaggat atcacgaaca gagaaggagc ctccaggtcc tatgtccctc 120 cccgtcattg gaaacgtgtt ccagctgaac ccgtggaact tggctgaaag cttgaaggag 180 ctcagcaaga agtatggtcc tgtcttcaca atacatttag gcccccaaaa ggttgtggtg 240 ctgtatggct atgaagctgt gaaagaagcc ctgatcgatc aggcagataa cttcagcgga 300 agaggaaatc tgccattgct taaaaaactc tttgaaggca caggcattgt aaccagcaat 360 ggggagacct ggaggcagct ccgacgattt gccctcacca ctctgcgtga ctttgggatg 420 gggaagaaga gtatcgaggc acgaatccag gaggaagctg gttttctggt ggagaggctc 480 aggaacacac acgagaaacc ttttgaccct agcagtttct taatccatgc tgtttccaac 540 atcatctgct ctattgtctt tggggatcgg tttgattatg aggacaagaa atttctaact 600 ttaattcagt tgatggaaga aaataacagg cttcagaaca gcgtacagac acagatatac 660 aatttcatcc caaatatcat ggaccgttta cctggacccc ataagacact cattaaaaat 720 attgacaatg taaatcaatt tatttctgaa atagtaacag cgcaccagga atctctggat 780 cccagttgtc ctcgagattt tattgatgct ttcatcaaca aaatggaaca ggagaaaggg 840 aaaagtcact cagaattcac cgttgatacc ttgaccagaa ccacgctcga cttgttcctt 900 gcaggaacag ggacaaccag caatgccctg agatatggac ttctgatact ccaaaaacac 960 ccagatattg aagagaaaat gcagcaggag attgaccgtg tgattggccg agaccgaagt 1020 ccttgcatgg cagaccgaag ccagatgccc tacacagatg ctgtgattca tgaaatccag 1080 agattcattg atttccttcc acttaatgtc ccacatgctg tgaccaaaga caccaagttc 1140 agagactatt ttatccccaa ggacactatg atattcccta tgctgtctcc catcctaaaa 1200 gacagcaagg aatttccaaa tcctgaaaaa tttgacccag gacacttcct gaatccaaac 1260 ggtaccttta aaaagagtga ctacttcatg ccattttctg caggaaaacg catctgtgca 1320 ggcgaaggcc tggcccggat ggagatattc atatttctaa catccattct gcagaacttt 1380 actttgaaac ctgttgtgga tcggaaggac attgacactt ccccaataat caccagtctg 1440 gcaaatgtgc cccgatctta ccaggtcggt tttgttcccc gttag 1485 <210> 9 <211> 1308 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000005338 <400> 9 atggatgggt actccagcaa tgttccggcc ttcctcacca agctctggac gctggtggaa 60 gatcccgaaa cgaatcacct catctgctgg agtacgaatg gcaccagctt ccatgtgttc 120 gaccagggac ggtttgccaa agaggtgctg cccaagtatt tcaaacacaa caacatggcc 180 agtttcgtcc ggcagctgaa catgtatggc ttcaggaagg tggtgaacat cgagcaaggg 240 gggctcgtca agcccgagcg ggacgacacc gagttccagc acctctgctt cctgcagggc 300 catgagcacc tcctggagca catcaagagg aaggtgtcgg tagtgaaaag tgaggagacc 360 aagatgcgcc aggaggacct cagcaggttg ctatatgagg tacagatact gagaagtcag 420 caggagaaca tggagtgtca agtgcaggac atgaagcagc aaaatgaagt tctttggcga 480 gaagttgttt ctctccggca gaaccactca cagcagcaga aggtgatcaa caagctgatt 540 cagtttctgt ttggccagct ccaatcaaac cctagcggcg ctgggataaa gaggaagctg 600 cctctgatgc tcgacaatgg gttggcagct ccacaagtgt ccaagttcag ccgacatttg 660 cctacggacc ccctccacga cccctatttc atacagtcgc catcgacaga acctgcctct 720 tgcttaaaca gccctgcaat cgttggagga cccatcatat ctgatgttac ggaaacatca 780 ccatccaaca tcataaatat gcagtcccct tctgataatg acagggagaa gtgcctcatg 840 ctgatcaaag aagagccagt gagccctgga gtgaaagcca gcaccgagcc tgacgtgcca 900 ggctgcaggg cctgccccga gccccctgtg ctcccagtcg ccatggttca gtctgtgctg 960 gaaggcaaag gcagctgtgg ggcagtgccc ccagggacct cgcagccacc ggagagaaga 1020 ggcagaagag cactgctgga caggccccag gagagtgaga gctgtcagag catgcacatc 1080 agccacggga acaggaagag gctttctgca gtgaggggca tttgccccag aacagatatt 1140 tcagacccct tggagggcac cgactggagt ttggaagggg tgcagctgct gctgcggagc 1200 cagcagtacg gcctggagcc tgccagcctc ctggacgtct ttaatcccaa tttatctatg 1260 agtgagtgga atttggctga aatggaagcc agtctgtccc cggtaaga 1308 <210> 10 <211> 2634 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000005514 <400> 10 agaaggaccc gaacctctgc ttgggcaaac tccatccgca tcgacgggga catcacgctc 60 ggggggctct tccccgtgca cggccggggc gcggagggca aagcctgcgg ggagctgaag 120 aaggagaagg gcatccaccg cctggaggcc atgctcttcg ccctggaccg catcaacaac 180 gaccccgacc tgctccccaa catcaccctg ggcgcccgca tcctggacac gtgctcgcgg 240 gacacgcacg ccctggagca gtcgctgacc ttcgtgcaag ccctgatcga gaaggacagc 300 accgaggtgc ccggcggccc ccccatcatc accaagcccg agcgggtggt cggcgtcatc 360 ggcgcctcag gcagctccgt ctccatcatg gtggccaaca tcctgcggct cttcaagatc 420 ccccagatca gctatgcatc aaccgccccg gacctgagtg acaacagccg ctacgacttc 480 ttctcccgcg tcgtcccgtc cgacacctac caggcccaag ccatggtgga catcgtcaaa 540 gccctcaagt ggaactacgt ctccaccttg gcctccgagg gcagctacgg ggagagtggc 600 gtggaggcct tcatccagaa gtccagggag gacgngacca catgctgctg ctgcactggc 660 aaaatcccaa aggaggggaa gccgggagag ttcgacaaga tcatccgccg cctcctggag 720 acctcccacg cgagggccgt catcatcttc gctaacgaag acgacatcag gagggtgctg 780 gaggcagcca aaagggcgaa ccagacagga catttcatct ggatgggctc ggacagctgg 840 ggctccaaaa tcgccccggt gctgcacctg gaggaggtgg ccgagggctc cgtcaccatc 900 ctgcccaagc gggtctctgt caaaggtttc gaccgctact tctccagcag gacgctggac 960 aacaaccgcc gaaacatctg gtttgctgag ttttgggagg aaaacttcca ctgcaagctg 1020 agccggcacg cgctgaagaa gggcagcagc atcaagaagt gcaccaacag ggagcggatc 1080 ggccaggact cctcgtacga gcaggagggc aaggtgcagt tcgtcatcga cgccgtctac 1140 gccatggggc acgctctgca caacatgcac aagaacctgt gtcctggcaa ggtggggctg 1200 tgccccagga tggacccggt ggacggcgtg gagctgctca agtacatccg caacgtcaac 1260 ttctcaggca ttgctgggac tccggtgacc ttcaatgaga acggagacgc gccggggcgt 1320 tacgacatct accagtacca gatcaggaac tccactcctg agtacaaagt catcgggcaa 1380 tggaccgacc acctccacct gaaggtggag aacatgctgt ggcccggggg cgggagccag 1440 ctccccagct ccatctgcag cctgccctgc aagccaggcg agaggaagaa gctggtgaag 1500 ggcatcccct gctgctggca ctgcgagcgc tgcgacggct accagtacca gctggatgag 1560 ttccactgca agaggtgcca cttcaacgag cgccccaacg agaaccacac tagctgcacg 1620 cccatcccca tcatcaagct ggagtggagc tcgccctggg ccgtggtgcc cgtcttcatc 1680 gccatcgtgg gcatcatcgc caccctcttc gtggtggtca ccttcgtgcg ctacaacgat 1740 acgcccatcg tcaaggcgtc ggggcgggag ctcagctacg tcctgttgac gggcatcttc 1800 ctctgctatg ccaccacctt cctcatgatc gccgagcccg acctgagcac ctgctccttg 1860 cgccgcatct tcctcgggct cggcatgagc atcagctacg ccgccctgct caccaagacc 1920 aaccgcatct accgcatctt cgagcagggc aagaagtcgg tgagtgctcc ccggttcatc 1980 agccccgctt cccagctggt catcaccttc agcctcatct cgctgcagct cgtgggtgtc 2040 tgcatctggt tcatcgtgga cccgtcccac tctgtcattg actacgagga ccagcggact 2100 acaaaccccc actttgctcg gggcatcctc aaatgtgaca tttcggacct ctccctcatc 2160 tgtttgcttg ggtacagcat gcttctcatg gtcacctgca ctgtgtatgc tattaagacc 2220 cgcggggtcc cggagacctt taacgaagcc aaacccattg ggttcaccat gtacactact 2280 tgcattgtgt ggttagcctt catccctata ttttttggga cgtcgcagtc ggcagaaaag 2340 atgtacatcc agaccacgac gctcaccatc tcggtgagtc tgagtgcctc cgtgtccctg 2400 ggcatgctct acatgcccaa ggtgtacatc atcctcttcc acccggagca gaacgtcccc 2460 aagcgcaagc ggagcaaggc ggtggtgacg gcagccacca tgtccaacaa gttctcccag 2520 aagggaggct tccgccccaa cggggaggcc aaatcagagc tgtgcgaaaa tctggaaaca 2580 caagcgctgg ctaccaaaca gacctacgtc agctacagca accacgcaat ttaa 2634 <210> 11 <211> 1863 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000006412 <400> 11 atgtcaccag tgtttcccat gttaacagtg ctgagcatgt tttactatat gtgccttcgg 60 cgccgagcta ggacagctac gagaggagag atgaatagcc gaagggctat tgaatcgaac 120 acccgggcct tacctatcaa tgttgaaata gttcagtatg ccaaagaagt gttggatttc 180 agctcccatt atggtagtga aaacagcatg tcatatacca tgtggaattt agcaggtata 240 ccaaacgtgt accctagctc cggtgacttt actcagacgg ctgtgtttcg aacttacggg 300 acctggtggg atcactgtcc tagtgctcga ctgcccttca agaggacgcc cacttccttc 360 tgcagccagg actatgtaga actcgctttt gaggagcaag tttatcccac cgcagtgcac 420 attctggaaa cataccatcc cggagctgta gttcggattt tggcatgctc tgcaaatcct 480 tactcacaaa acccaccagc tgaagtaaga tgggaaatcc tttggtctga ggcacctaca 540 aaagtgagtg gtccccaggc tcggcagttc acaccttgta tcaaacaaat aaacttcccc 600 acgaacttaa ttcgactgga agtgaacagt tctcttctag attattacac tgaattagat 660 gcagtagtac tacatggtgt gaaagagaaa cccgtgcttt cactgaagac ttcaatgatt 720 gatatgactg atattgatga agatgaggat gaagagaagt atggctgtgg aatggacgct 780 cttaacaaac agttcagcgt tgttaccctc agggaatggc cgactaatgg gtattttgac 840 aaactgcctt atgagctcat ccagttgatt ttgagtcacc ttacagtacc agacctgtgt 900 agactagcac aaacttgtaa gctactgtat caacattgct gcgatcctct gcagtacatt 960 catctcagtt tacaacctta ctgggcgaga attaatgaca cgtctctgga atacctacag 1020 tctcgctgca ctctcatcca gtggctgaat ttatcttgga ctggaaacag gggagccatt 1080 tctgtttctg gatttagcag gttcttaaaa gtttgtggct ctgaactcgt tcgtcttgag 1140 ttgtcttgtg gccatttcct gaatgaaaca tgtttggagg tcattactga aacgtgtcca 1200 aatcttcagg aattaaatct tgcatcatgt gataaaatac cacctcaggc tttcaaccac 1260 atagccaaag tgggcagcct aaagcgtctc attctttacc gaacaaaagt ggagcaaaca 1320 gccctgctta gtatcctgaa cttctgctcg gagcttcagc acctcagcct gggcagctgc 1380 gtcatgattg aagactatga tcttatagca agcatgatgg gagcaaaatg taaaaaactt 1440 cgcagtctgg atctgtggag atgtaaaaac ataactgaaa atggaatagc agaactggct 1500 tcaggctgcc agcttttgga agaacttgat cttggctggt gccctacatt acagagcagt 1560 acaggctgtt ttgcaaacct tgcacgtaaa ctcccgaact tacaaaagct ctttcttacg 1620 gccaacaggt ctgtgtgtga cacagacatt gaagagcttg cagctaactg tactcattta 1680 cggcagctag atatattggg gacaaggatg gtaagccctg catctttaag aaaattgctg 1740 gaatcttgta aagatctttc tttacttgat gtgtccttct gttcacagat tgataataga 1800 gttgtcctag aactgaatgc caactttcct aacgtgttca taaaaaagag tttcacccag 1860 tga 1863 <210> 12 <211> 960 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000007118 <400> 12 atgaatgctg atacttgtgt ttcttattgt gatccggctg ccatggattc ctactacaac 60 gcagcctccc agggcacaga aggctcctcg ccttttaggg catttcaagc aagtgacaag 120 ttcagcccta ctttcctggc cagcaaagga caaggctttg gtgacagcag cgctaagtgc 180 cggagccgct acagccagca ggaatgtcag tccctggatg gcagcgtgca ggctcccagc 240 tccgccgggg ctccggcctc ctttaacaaa taccctcacc tctacatgca gcgaggcccc 300 tgctgcaaga cccccccgga gagcaacctc aagctgcagg agagcagcgg ccacaacgga 360 gctctgcagg tcccctgcta cggtaaagag agcggcctgg gagaggccga cttgcagcca 420 agcgccgacc cttcgggcat ggacagcagc tacctcagcg tgaaggaggc cggggtgaaa 480 gtcccccagg acagggccag cacggacctc cccagcccca tggacaaggc ggactcggag 540 agcaacaagg gcaaaaagcg gaggaaccgc accaccttca ccagctacca gctggaggag 600 ctggagaagg tcttccagaa gacccactac ccggacgtct acgccaggga gcagctagcc 660 atgaggacag acctcaccga ggctcgagtg caggtgtggt tccagaaccg gcgagcgaaa 720 tggcgcaagc gggagcggtt cggccagatg cagcaggtcc ggacccactt ctccaccgcc 780 tacgagctgc ccctgctcac ccgcgctgag aactacgccc aggtgagtgc gtgccctgcc 840 ccgctccctc tgcccgtctg cccatcgctg tttcgcgagc cggaccgcaa gacctccagc 900 atcgctgccc tgcggatgaa ggcgaaggag cacagcgccg cgatctcctg ggcgacatga 960                                                                          960 <210> 13 <211> 1752 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000007474 <400> 13 cgactgtggc aggtcctaga cccatcatgg gcagaccctc gcatcctctc agccttgctc 60 tgcggttcag ctgcagccat tgtgctgctg aaacggctgg ggcacaggag gatccagcag 120 aagatggaag aggcacggag agcacgggat ctggccctgg aacaaatgga gaaggcagct 180 cgcaggttta aacgagagaa cccaggcacc cagactgcac acatcctctc gctgcccatg 240 gtggagctgg cggagaagct gaaggagggg tccttgtccc cggagagcgt cctctactcc 300 tacatgggca aagctttgga ggtgactcag gaggtgaact gtgtgataga cttcattcat 360 ggctgtgagg atcagctcca gaaagtgaag aagcagaagg agaaggggct gctctatggc 420 attcccgtca gcatcaagga ccacattaac tgcaagggcc acgtctcctc tggtgggctg 480 gtgaagcttc tgggccaagt gaaggaagaa gacagtgtca tcgtccgggt tctaaagagc 540 cagggggcaa ttcccttcgt gaaaaccaac atccctcaga caatgataaa ctatgactgc 600 agcaatctga ttttcggcca gaccctgaac cccctcaacc accagaagac ccccggaggc 660 tcctcaggag gagagggagc tctgatcgca gggggaggct ccatcctggg catcggctca 720 gatgtggctg gcagcatccg cctgccgtcc agcttctgcg ggctgtgcgg gctcaaaccc 780 acaggcaaca ggatcagcaa actgggtgtg gtttctccta tcacaggaat gtactcagtg 840 acagggacgc tggggccgat ggcgagagat gtggacagcc tggccctctg catgaaggca 900 ctgctctgtg atgagatgtt ccggctggat cccaccttgc cccccatccc ctttgatgac 960 gaggtttaca ccagttcaaa gccactccgg attgggtatt atgaaggaga tggctacttc 1020 cagccctcac ccagcatgaa acgggccatc caggagacca gaaagctcct ccaggaagca 1080 gggcatacgc ttgttccctt tgcaccgccc aagattgact acgtggtaga tgagctgttc 1140 accagaggga ttttctcgga tggtgctgct cacctggtgg actgcttcaa aggagacatc 1200 gtggatccca acctcaaatc ccagttcaat acttacaggc ttcctgctct ggtgaaaagg 1260 atcttggcta tcattttgaa acccatatac ccacgaattg ctcgggacct caacgctctc 1320 tgtggagtgg ggtctgccaa aaacctctgg gatcagcatg cagcagtagc ggtttaccgt 1380 actgaattca ttgctaaatg gagaaagcaa agactggatg tgattctctg tcctgcactg 1440 ggtccagcct ttaaccatgg ctatgctggg aagctgtttg ctgcaacctc ctataccaac 1500 ttatacaatg tcttaaactt ccctgctgga gtggtgcctg tcagcacagt cacaaaagct 1560 gatgaagaag aactgaagca ttaccgaggg cactacgggg acccttggga taagaggctg 1620 aaagaggctg tggaaggagc tgtggggctg cctgtggctg tccaatgtgt ggctttgccg 1680 tggcaggagg agctctgcct gcggttcatg aaggaggtgg agacactttc ccgtggcagg 1740 agaaatgtgt ga 1752 <210> 14 <211> 981 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000011107 <400> 14 tgcccggaga acagcaacta cacctcttgc ggcagcacct gccccgctac ctgcaacaac 60 gccgcgatgc cggccgactg cggtgcctcg acctgcgtgg agacctgcga gtgccaggag 120 ggcttcgtgt tggacgctgg caagtgcatc ccccaggccg agtgcggctg tgtctttgag 180 ggccgcctct acgggctcgg cgaggagttt tggggtgaca acacctgcac gaagcgttgc 240 gtctgcgacg cggccacgcg gacggccgtg tgccgcaagg ccagctgcca tgcccgggag 300 gagtgccggg tagagcaggg catccaggat tgctacccca ccagctatgg gaactgcacg 360 gcctacggca ccactcacta caaggacttt gacggcggga ggttcatctt ccagggcacg 420 tgcgtctacc aattcaccgg gttgtgcaag aagacccaag acttggtgga tttccaggtg 480 ctggtgcaga acggccagca caacaaccaa cttctgtcct ccatcgctct cgtcaaggtc 540 aaagtctacg ggaaaagcat tgtgatcagc cagaaggacc ccaacaaaat cactgtcaac 600 aaccagttgg ccaacttacc ataccaccac aagaggaaga tctcggtcta cagaagtgcg 660 caggacgcgg tggtggagac cgacttcggc ctcaccgtca cctacgactg gcagagccaa 720 gtcaccgtgg tggtgcctgg catttacgcg gatgccctgt gtggcctctg cgggaactac 780 aacggggacg tgagtgatga catgatgatg aaggacggtc aaacgacgct aaaccccgac 840 gccctcgggg agagctggaa ggtggctgac gtcccgggtt gcatggagct gtcgaaggag 900 caatgtccca ccttgctgga ggccacgaag cagcaggagg tcgcagagaa gggttgtggg 960 ctcatctcaa aagtggacgg g 981 <210> 15 <211> 1416 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000011331 <400> 15 atgaagcttt gtcagtccat catggacatg gatatgccag attacgtcga ctccttggac 60 tcctcttata ccatgctaga atttgaaaac cttcgggtgc ttccgaacaa cactgagacc 120 atcccagccg aatcagcaaa caccaacgtg cttgccaatg gcatcggctc cctctgctcc 180 atctgcgggg accgggcgac cggcaaacac tacggggcat ccagctgcga tggctgcaaa 240 ggcttcttca ggaggagcgt ccgcaagaac cacgtctatt cctgcaggtt cagccgacag 300 tgtgtgatag acaaagacaa gaggaaccag tgcaggtact gcaggctgaa gaagtgcttc 360 agagctggga tgaagaagga agctgtgcag aacgagcggg acaggatcag catccgccgg 420 agcagctacg aggacaacgg ctcgctgtcc atcaacaatg tgctgaccca ggccgaggcc 480 atggcacagc agtacgcgtc gctgagcccg gtgcacagcg cggacattgc catgaagaag 540 gttgcgacaa tcaacgacgt gtgcgagtcc atgaaacagc agctcctggt gctagtggag 600 tgggcaaaat acatcccggc attttgtgag ctgccgctgg atgaccaggt cgccttgctc 660 agagcccacg caggggaaca cctgctcctg ggggtagcca agcgatccat accgtacact 720 gattttctat tactagggaa tgacttcatc atccccatgc actgcccgga gctggaaatt 780 gctcgtgtgg ccaccaggat cttggacgag ctggtgaagc ccttgcggga catccagatt 840 gatgacaatg aatacgcttg ccttaaagcc ataatcttct ttgacccaga ctgcaaaggc 900 ctgagtgagc ccgggaaggt gaagaatatg cgattccagg tccaagtcaa cctggaggac 960 tacatcaacg accgccagta cgactcccgg ggccggttca gtgacatcct cctcctgctg 1020 cccccgctgc agagcatcac ctggcagatg atagagcagg tccagttcgt gaagctcttt 1080 ggcgtggcga ggattgacag cttgctgcag gagatgctgc tgggaggatc caccatcgac 1140 ctccaatacc agtccggacc tcccaacctc aacatggaac agctgccagg acacgtcctc 1200 ccaagcaaca tgaggcattt atccactgta gtagcaaaca gattatgcta ttcccctcct 1260 aggcctcatt acaacccagc atctcctgaa ccatcccttc catctccttc tacaagcaca 1320 ggcagtgaag actataaact aggccctagc gcaggcccca gcgctgtagc gcagctcttg 1380 cctcagacag ttatacccaa gcaggagatt ttatag 1416 <210> 16 <211> 2052 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000013278 <400> 16 gtgaacgggg tgctgaccct gctcccggtg agcctggagg acggcaggat ggagctcttc 60 cagagcgggc tcaggctcac cgccgtgctg gagaccgatt tcggcctccg ggtgacgtac 120 gactggaact ggtacctgtt gatcgagctc cccagtagtt actacaagca cacctgcggc 180 ctctgcggca atttcaacct caagccggag gacgacgtcc cccagcaggg cgacaacctc 240 gtcgcttcca tcgtggcttg ggccaaaggc tggaaagtcc ccgacgacga cccgttttgc 300 tgggatttct gtgaaggcga ctgccccgtg tgcgaggagg agaagaagga gctgtacagt 360 ggcaaccagt actgtggcct gatcaaaaaa agcttccagg ggcccttcaa ggcttgccac 420 gaggtggtca aacccgggga tttcttccgc aattgcctct acgacgtgtg catgagcgac 480 ggggcgaaaa gcatcctctg caagacgctg gaggcttatg catccacctg caaaaagcaa 540 ggggccgtgg tgcacgactg gaggacaccg tcgggctgct cattaccctg cccggaaaac 600 agccactacg aagcttgtgg caacgcctgc ccggccactt gcaccaaccg ggacgcgccc 660 tcctcttgca cccagccctg cgtggagacc tgtgcttgca acccgggcta cgtcctcagc 720 ggtggccagt gcgtggcggt ggccgaccac tgcggttgca cccgcgacgg ccgctactac 780 caagccggcg aggaattttg ggacgacgag acctgccatt cccggtgcag gtgcgacccg 840 gttttgggca tggtggtgtg caaggaggcc agctgcaagg cgggcgagca gtgcgccgtg 900 gtgaagggcg tgcggcgctg cgtggccaag ggtcgctcca tctgcgtggc caccggggac 960 ccccactaca ccaccttcga cgggcgccgc tacgacttca tgggcacctg cgtctaccag 1020 ttcgctgccc tctgctccga agaccccacc cttgtcccct tcgtggtcac ggtggagaac 1080 aacaaccggg gcagccgcgt ggtctcctac accaaggagg tcaccttgaa ggtctacaac 1140 atgaccctca gcctcagcca agcagacccc cagaagctca aggtcaacgg gatcctggtg 1200 gacctcccct tcagccacgg cacccagctc cgcgcctaca tcagcggcgt ccacggcttc 1260 atcaagaccg acttcgacgt catcgtcacc ttcgactggc acagctacgc cagggtcatc 1320 ctccccagca cctactcgcg ctccgtctgc gggctctgcg gcaacgccga cgggaacccc 1380 gaggacgact tcgctttgcc cgacggcacc tcggccagcg acgaggtcca attcgccgac 1440 gcctggaagg tggccgacgt ccccggctgc tctgccggct gcaccaagga ttgccaagtc 1500 tgcagcgagg cggagaagcg cgcctaccgc ggcgacaagc actgcggggt gctggtgaag 1560 aagcaaggtc ccttcgccgc ctgccacggc gccatcgacc cctgcctctt cgacacttgc 1620 ctctacaagg ggcaccagga aaccgtctgc agcgccgtca gcgcctacgt caccgcctgc 1680 cagagccagg ggattcgcgt cgagccgtgg cgcacggccg ccttctgcat tctgcagagt 1740 tttcacacca ttatctgcag agacacttgc atttttctaa gaatcagcct ctccgctggc 1800 agcagctgca ccagcaaatg cttcgagggc tgccagtgcg acgagggctt cgtcttcaac 1860 gggggcgagt gcgtccccat ggagtcctgc gggtgcatgc accgcggccg cttcttcgag 1920 atcgccgaga ccatcctctc tgccgactgc agcgagaggt gcacgtgccg ggcggcgggc 1980 ggcatgctgt gccaaccggc cggctgcccc ttcggccaag tctgcggcac gcgcgacggc 2040 gtccgcgggt gc 2052 <210> 17 <211> 981 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000013478 <400> 17 atgtcctgga ttgctgacac ctatgccagt acaataggac actatgatat taacgcacat 60 gcatgtgtaa ctggcaaacc catcagccag ggtgggatcc acgggcgtat atctgcaacc 120 ggtcgtggtc tcttccacgg gattgaaaat ttcatcaatg aggcatcgta tatgagtata 180 ttaggaatga ctccgggatt tggggataaa acatttgctg ttcagggatt tggtaacgtg 240 ggcttgcatt ctatgagata cctgcatcgg tttggagcaa aatgtgttgc tgttggagaa 300 tttaatggtt ccatctggaa tcctgatggg attgacccaa aggaactaga agattacaaa 360 ttgcaacatg ggacaatcat gggcttccct aaagcacaga tactggaggg cagtattctg 420 gaaacagact gtgacattct catccctgct gccagcgaaa agcagttgac taaggccaat 480 gctcacaagg tcaaagcaaa aattattgct gagggtgcca atgggcctac gactcctgaa 540 gctgacaaaa tcttcttgga gaggaatatc atggttattc ctgatcttta cctgaatgca 600 ggtggggtaa cagtatccta ttttgagtgg ctgaaaaact tgaaccatgt cagctatggt 660 cgcctgactt ttaaatatga aagggattca aactaccact tgctcatgtc tgtccaggaa 720 agcttggaga gaaaatttgg gaaacatggt ggaactatac cagttgtgcc tacagcagaa 780 tttcaggata ggatatcagg tgcatctgag aaggacattg tccactctgg gctggcttat 840 acaatggagc gttctgctcg gcaaatcatg cggactgcca tgaagtacaa cttgggtctg 900 gacctgagaa cagctgccta tgtcaatgca attgagaaag tcttcaaagt ctacaatgag 960 gctggcctga cctttacata a 981 <210> 18 <211> 315 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000014155 <400> 18 atggtcggtg cttgtctccc agcagagtac ccgcagggcc cggtccccac gctgtggaat 60 gagccgcctg agctgccctc cggagccggc cccttcgatg ccgccaccac caccgcccgg 120 ctctcagacg ccaccgcctt ccccccgtac acctccgagc tggagcctga ggacaccacc 180 cacctgcacc gcctggacac tggggacggc tcgctggggc ctggagctat tggtgccatt 240 gtcatcgcct ccctcctggg aacatctgtg cttgtggcct tggttgtcat cacgctgaga 300 aagttctctg cctcc 315 <210> 19 <211> 819 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000014742 <400> 19 ccagggggaa tgccgtccta catgggaatt aaacagggca gggaggaacc attcgggttg 60 tttatcgatc gcaccagcac cagctgcgac gaatcccttt ttctccgacc agccaccaga 120 gggagcctcg gcctggattt ggcaaccgca gtcgatgtga ctttattgga ttcgagaccc 180 accaggataa aaacaggact tattggacca gttattgtta ataaggaacc tgtgggagct 240 ttgttaatag ggagatcgtc tgccaccatg aatggattac aaatattaac tggacttatt 300 gacaaggatt actttgggga aatacaaatt atggtttctg caatgtttcc tccaattcat 360 gtgccgaaag gcacaaaaat agcacagttg atcccattgc ctcatcttgc tgaatcatta 420 gcatcggaat ctgcaaagca tcgaggactg ggagcatttg gctccacggg aaaagtggct 480 ttgttgacac ttggtatgcg acacagacca cgacaaaaag tcactgtgtg tttaaaggat 540 gagaaaatac agattgaggc attgttggac actggtgctg atgtatctat aatcagcaca 600 aaggattggc cctcacattg gcctacattt gagtctaatg ccacagtttc gggagtagga 660 ggtatgactc ttgctcgtcg gtcaccagtg ctacaatgga caataggtga taaggtggta 720 caatgcagtg tctccatctt atcactacct gaaggagtac aagcgctggt agggcgagat 780 atccttgccc aaatgggagc aattctcacg acagatcat 819 <210> 20 <211> 2268 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000015473 <400> 20 atggggaact tgtcaatgaa acccaagcac ctgagacagc cagatagaca cgtagcaaac 60 ctctctattg gttgtgctgg caacagggtg gttgaactgg aaaaggagct gaaaagaaaa 120 gatgaagagt tacaagaagg tcaaagtctt gttgctgagc ttcaggagca gctggctatg 180 cagactaagg tcatagcaga actcaccaag gaacttcaga gcaagtgtat acagctgaac 240 aagctgcagg atgttattaa tactcaagga gaacactctc ttcagccttc tccatttaga 300 gcaactccaa agaatcaagt ctctgctgac aggaggaaag gagctaagga aggtgtatct 360 gcagagccaa caacacagct gtatgatttg agcaagcaag ctaagttttc ctttgaaaaa 420 tcaagagtcc aaaaggattt cagtgagaag aagctcatca cagacgccct gaataaaaat 480 cagttcttga agagactgga gcctcagcaa atccgagata tggtggaatg tatgtatgaa 540 aggactttcc agcaggggag ttatgtcacc agacagggag agccaggcaa tcacattttt 600 gtgctcaaag agggcagact ggaagtcttt cagcagaata aactcctctc ctcaatacct 660 gtgtggacag catttggtga actagccatt ttatacaact gcacacggac agcttctgtg 720 aaagcaatca ccgatgtaaa aacatgggca ttggacagag aagtgtttca aaacatcatg 780 agagtgacag cacagacaag gcaagaacag tacagaagct ttcttagaag tgtgtctctc 840 ctaaaaaatt tacctgagga taaactaacc aagatcatgg actgcctgga ggtggagtac 900 tatgacaagg gagattatgt tattcgggaa ggagaagaag gaaatacctt ctttataata 960 gcaaaaggaa aggtgatagt tacccagagt actgcagatc actcacagcc tcagctgatc 1020 aaaagtctac ataaaggaga ttacttcgga gaaaaggctc tcattagtga tgacgtcaga 1080 tcagcaaacg ttattgcaga tgaatatgat gtggagtgcc ttgttataga tagagagaca 1140 tttaatcaaa ccgttggaac ttatgaggag ctccaaacct accttgaagg ctatgtggct 1200 aacctgaccc gggctgatga aaagcgacat gcaaaaagaa gatccttctg tggacagtcg 1260 accaaagagg tgactttgga gatgatacag ctgcaggaga aagtagccca gttctcttct 1320 tccccattcc agaatttaga agttgtcaca actctcggtg ttggtgggtt cggaagggtt 1380 gagcttgtta aagtgaaaaa tgagaacatc gcttttgcaa tgaagtgtat aaagaagaaa 1440 catgtagtgg acaccaaaca gcaagaacat atctattctg aaaagagaat tctcgaacag 1500 atatgttctc cattcattgt gaaactgtat cgtacattca aggatagtaa gtacgtatac 1560 atgctactgg aggcttgcct tggaggcgaa ttgtggagct tactgagaga cagaggcagc 1620 tttgatgaac ccactaccaa gttctgtgtt gggtgtgtga cagaagcttt ggactatcta 1680 catcacatag gaattgtcta cagggacctg aagccagaaa atttaatttt ggatgctgaa 1740 ggatacataa aattggttga ttttggattt gcaaagaaga tcgggtcagg acagaaaacc 1800 tggacatttt gtggaacccc tgagtatgtt gccccagaag tcattctgag taaaggccat 1860 gacttcagtg tggatttttg gtcccttggg attcttgtgt acgaactcct tactggcagt 1920 ccaccgttct ccggggctga tcaaatggtg acatataatt tgattctcaa agggattgaa 1980 aaactggact ttcctaaaat aataacaagg cggcctgagg atttgatccg cagactttgc 2040 aggcaaaacc ctacagaaag attaggcaat ctgaggaatg gaattaatga catcaagaag 2100 cacaggtggt tgaatggttt taactgggat ggtctgaaag tgaggaaatt aacatcacct 2160 ttaaaaagag agttgtctgg accaactgac tacagctact ttgatagcta tccacctgaa 2220 gagggaaccc ctccagatga actttcaggc tgggacaagg atttctga 2268 <210> 21 <211> 1143 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000015634 <400> 21 gacaggtggc tgacctgcag gtccctgccc ccgggagctc tggagaggat cgtcgacgac 60 gttgcggacc gctgccgcgt cccttggttt gcgggggccg tgaagatcaa cgtcagcctc 120 gttccgccgc tcgtgctgct gcccgtcttc ctccacgtcg cagctctgca cttcctgctg 180 ggactggtcg tcctgacttc tcttcccgtg gtggtgctgt ggtattacta cctcacccac 240 aggaggaagg agcggactct cttcttcttg agcctgggac tcttctcctt gggctacatg 300 tactatgtct ttctccagga ggtggttccc cgaggccagg tggggcattc ccaagtggtg 360 ctcctcacct ctgggttagt tctcatgctt gcagccttgt tacgagccaa gaaagacccc 420 ggctaccttc ccatcccagc aggcgatgcc aagtcatcgc atcaggattt tcccaacaag 480 aaccttcgag ggagctccaa cgggctccac ggagtcgcta cggcaggagc tgccagcggc 540 cgtgctgtga atggggaggc caaaggctac tccagagcct cagccgaggg gccagaaggt 600 gtgagaaagg actggtgtgc gaaatgccag ctggtcaggc cagcccgagc ggggcactgc 660 cggctttgtg gcaggtgtgt gaggagactg gatcatcact gtgtctggat taacagctgt 720 gtaggggagc agaaccacca agcattcatc cttgcgctct ccttcttcat gctcacctct 780 gtgtatggga ttacactgac cctggacacc gtctgtaggg gacgaaccct gttcgtggcg 840 ttgttctact gccctggggc ctattctgac tacagctctg ctctgtcgtt cacctgcgtg 900 tggtactgtg ccattgtaac agctggcatg ggatacatcc tcctcatcca gctgttgaac 960 atcagctaca acgtgacgga gagggaagct cggctggctc tgcgcgacaa caccgggcgc 1020 aggctcctgg gcgggttagt gatagacact ggccagtaca acaggggctt tctatgcaac 1080 tggggccact tcctgagtct ggggtctccc cctccgctgc gctctgccga agacatcgtc 1140 tga 1143 <210> 22 <211> 210 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000015797 <400> 22 aaaaactctc ttttttcccc ctcagcctcc accgcccggc acctgtacct gcgcggcggc 60 gccggcgtgg gctccatgac caagatctac ggcgggcggc agcgcaacgg nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnngcg tgctgcaggc gctcgagggg 180 ctcaagatgg tggagaagga ccaggacggg 210 <210> 23 <211> 567 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000016189 <400> 23 atgacaagtt gtggccaaca gtccttgaat gtgctaatgg ttctgctttc attgctcttg 60 tcagcagtat tgtctgcaca ttttcgggtc tgcgagccat atacagacta caaaggtcgc 120 taccacttcg gttttcactg cccccgtctt tctgacaata aatcttacat cttttgctgt 180 caccataaca acacagtatt taaatactgc tgcaatgaga cagaatttca gactgttatg 240 cagatgaact taacagggaa tgcagatgga tatatgcata acaactacag tgcactgtta 300 ggggtgtgga tctatggctt ttttgtggtg atattgctgg tactggacct tttatattac 360 tcttcaatga actatgatat ttgcaaactt tacctggcac ggtggggaat ccagggaaag 420 tggatgacac aaggacagag ccaatggatt aaccctgctc aggatccaag ccaagtacag 480 acacagcctc aaacgtcaca gacagtacat actttaaaag gagatgcttt aagcccacct 540 ctggtatctt ttcagagtac atctgcc 567 <210> 24 <211> 495 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000002305 <400> 24 tgcggcaggc gcatgttccc caccttccag gtgaagatat tcggcatgga ccccatggct 60 gactacatgc tcctcatgga ttttgtccct gtggatgaca agcgataccg gcaagtaccc 120 cgctcctgcc tgccgggaca agnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnactaccac 180 ccggactccc cggccaaagg ggcgcagtgg atgaagcaga tcgtttcctt cgataagctc 240 aaactgacca acaacttgct ggacgacaac gggcatatca ttttgaactc catgcacaga 300 taccagccgc gttttcacgt ggtctacgtg gacccccgga aagacagcga gaaatacgcg 360 gaggagaact tcaaaacctt cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn naccgcctac 420 cagaaccacc ggatcacgca gctgaagatc gccagcaacc cttttgccaa gggattcaga 480 gactgcgacc ctgag 495 <210> 25 <211> 1191 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000005651 <400> 25 atgaatggac cagtggatgg tttatgtgac tacacgctgg atgatgaagg ggctttcatg 60 ttcacatcgg agtcagtagg agaagggcat ccagataaaa tctgtgatca aatcagtgat 120 gctgtactag atgcccatct caagcaggac ccaaatgcca aggttgcttg tgagacagta 180 tgcaaaacag ggatggtgtt gctctgtggg gagatcacat ctcgtgctat tgtggattat 240 caacgagttg tccgagatgc aattagacac attggctatg atgattcagc taaaggcttt 300 gactacaaga cttgtaatgt tttagtggca ctggaacagc agtcacccga tattgcccag 360 ggtgttcatc tacacaggga tgaagaagat gttggtgctg gagatcaggg tttgatgttt 420 ggttatgcaa cggatgagac agaggaatgt atgcctctaa caattattct tgctcataaa 480 ctgaatgcca ggttagcaga gctgaggcgc aatggagagc ttccttggct gaggcctgac 540 tctaagacac aggtcactgt gcagtatatc cagcagaatg gagcagtcat cccagtgcgc 600 gttcatacca ttgtgatatc tgtacaacat gatgaaacca tttcgctgga gaacatgcgc 660 aaaaccctga aggatcgtgt aattcaagcc gtggtccctg caaaatactt ggatgagaga 720 actatttatc accttcagcc tagtggacgt tttgttattg gaggacctca gggtgacgct 780 ggtgttactg gtagaaagat cattgtggat acttacggtg gctggggagc ccacggaggt 840 ggtgcctttt ctggaaaaga ctatacaaag gtggaccgat cagcagcata tgcagcccgt 900 tgggtggcca agtcccttgt gaaagctgag ctctgtcgcc gtgttctggt tcaggtgtct 960 tatgccatag gagtagctca accactgtcc atttcactat tcacttatgg aacttcacaa 1020 agaacagaga aagaactgct ggacattgtg cacaaaaact ttgatcttcg gcctggagtc 1080 attgtcaggg atttagacct aaaaaagccc atttaccaga aaactgcatg ttatggtcac 1140 tttggaagaa acgaattctc atgggaagtg cctaaaaaac ttgtattttg a 1191 <210> 26 <211> 1506 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000005854 <400> 26 cgcttcccac ccaccaaacc cggccgtgcc agcgcgcccg ctgtccccaa gctgtcccca 60 tcggcacatc aggaggctgc acccaaaggt cccccggggc tggggatggc tgcaggtgac 120 ccagagcagc ctcccaccac cccggggtac cccatctcac cggcggcaca caggcagcgg 180 ccgggaccac cagggctgcc ggtgagtggt ggaggtgatg gagagggatg ggtgggcagt 240 ggggggtgcc ctgggagacg cgggctggca gggcccaaag gagacaaggg ataccctgga 300 gccatggggc ggatgggacc cccgggggac ccgggaccca tgggcatccc cggcatcagg 360 aaacctggag cccctggccc tccaggacac ccggggaaag caggagtgcc ggggccatcg 420 ggagagccgg gggagccggg cgagaagggc caacgggggt acacggggct gccaggagag 480 cagggcctgc agggcttccg aggggaccgg gggctggctg gagagaaggg ggaagagggc 540 ttcttgggtg accctggacc agttggtgag aaaggagaga agggggtgaa gggggtgaga 600 ggagaaagcg gcccgccggg tcctgcaggg gctccgggga tgtcaggtct gaagggcgcg 660 atgggcttcc agggccctgc agggccggag ggagaaggtg gcccagcggg tgctgctggc 720 cctgccggcc ccccgggaga gccgggccag ccgggctcct gctgctctca ccccgtccct 780 tccttgctct ctccccaggg agagatgggt cctcctggct tgcccggccc ccagggccct 840 aagggtcacc cagttcaggg catcccctcc agcacagctg gggcctcagc ccaccccaaa 900 acctgcacag aggctgggat gggggcaaaa atcccttccg cgcctggacc acagggcctg 960 caggggcgtc gcggcccccc tggcctgggg ggcacccagg cgctggctgg gatggagggg 1020 tcctctggtc ccaaaggaga caccggtcca gagggggttc ttgggctgag gggacagctg 1080 ggacaggagg gccctgggtt gcatttttgt gtctctctcg aggggtttat tggcctgccg 1140 ggttcaaaag gcacccaagc cggccccggg gggcggcagg agcccgggga cccgagaggg 1200 cagccatccc tcagcccgtt gcctcgcttc acacccgcag cactgcctgg cccccaccga 1260 ctcccaaaag gcaaggcgca gcccggccgc cccctcctca cctccccgca gggggaagaa 1320 ggccagatcg gcccggcggg gctgaacagc agcgaaggaa gccgaggacc cgatggccca 1380 aagggaactc caggaccacg gggagccagg ggccgcgtgg gccagcgcgg gctggttgga 1440 gtcccaggac tgcccggctc gcgaggcatg ccaggagcag aaggcgcaga aggaaagcct 1500 ggtaca 1506 <210> 27 <211> 1269 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000008337 <400> 27 caaactggga gtccttcttg tgaaatactt aaactgggtg ttcttttctt tctaggtatg 60 gtgtgtcctc tggaggtgtc agtcagttca gggagtatcc aggttgcccg aggccagaca 120 gcagtattgc cctgcacctt caccactaat gctgctctca ctaaccttaa tgtcatctgg 180 atggtcactc ctctttctaa tgccaaccag cctgaacagg ttattcttta ccaagggggt 240 cagatctttg gtggtgcacc ccagttctat gggcgagtgg ggtttgctgt gacaatgcca 300 accaccagtg cctccatctt catcaacaac acacagctat cagacactgg cacgtaccag 360 tgtttggtca acaatcttcc tgaccgaggc agcaggaata ttggagtcat tggactgacc 420 gtcttggttc ctccttctgc cccgctttgc agaatccagg ggtccctgga cgtgggcagc 480 gatatcacac tgacctgcag ctcggaagaa ggcatccccc ggccaacata cctctgggag 540 aaactggaca atgttcccaa gttgccccca actgccacac aagaccaagt ccagggcact 600 gtcactctcc gaaatatcag cactgtgtcc tcaggtcttt accaatgtgt ggcttcaaat 660 gccattggaa ccagcacttg ccttctggac ctacaagtca ttgcacccca cccctggagc 720 atcggcctga ttgctggagc agtggccaca ggtgctgtcg tgcttgttgt ctgcattgtg 780 ttggtggcca tagcactgtt ttactggaaa aataaacaca aagaggaaga agaagaagag 840 attcccaatg agataaggga ggatgacctg ccacccaaat gctcctccgc tgccaagaca 900 ttccatgctg acgcatcctc atcggagaac gacaccctca cctcctccaa cacctacaac 960 agccgctact ggaatgaccc caaggccaac catgccacag actccttcac ccgcttcagc 1020 aacagcaacg acgcccgcca gccccccttc tcccgctcag ggagcacgag tgctcgccct 1080 gtctacgcca acggcggcca cccctccccg gctgccccta agacgctgnc ccggagcaat 1140 ggctccgtca gcaggaagcc tcggcttccg cagacccgct cctacgccgt cagccaggcc 1200 acgctggagc ggatcggggc cgttcctgtc atggtgcctg cccagagccg ggctggctcc 1260 cttgtgtag 1269 <210> 28 <211> 1044 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000009149 <400> 28 aaggtgccca tcgccagagc ggggcccgag gatgtggagc agtgcctgcc gcccgcgtac 60 acggtggcag cgccccctcc ggggccaggg cggctgctga aggcaggggc tgcggtgctc 120 atcgccgggg ccctcctgct cctggccggg gccatcggcg ccttctactt ctggaaagcc 180 accgagcggc aggtgtacaa tgttcactat accatgagca ttaatgggaa agtacaagac 240 ggatcgatgg aaatagatgc tggcaacaac ttggagacat tcaaaacggg aagcgggagc 300 gaggaggctg ttgaagtcca tgattttcag atcggcataa ccggcatccg ctttgccgaa 360 ggggagaagt gttacatcaa agcccagcca aaggctcacg tccccgaggt ggatgctatg 420 accaaggcga gcctctcctc cgacctggaa gatgaaatca tgccggtgag atttgatgaa 480 aactccctta tctgggtggc tgcggatgaa cctatcaagc acaatggctt cctgagcccc 540 aaaattttag agctctgtgg cgatcttccg attttctggc ttcgacctac gtatcccaaa 600 gataaacaac gggaaaggag agaaatgaag agaaacaaac gccaatcaga accaaccttt 660 aacgcaaaag acttggaagc tgctgttgaa gaggcgaaca ccaggccacc caccacccag 720 ctgaccccag agctggatca gcagtcgaat gaaaccaggc cggtgggaca ggagaccgat 780 gtcggaccag agagcgacca aacgctcaat cccgacaacc catacaatca actggaaggg 840 gaagggatgg ctttcgaccc catgctggat cacctaggcg tgtgctgcat cgagtgcagg 900 cggagctaca cgcagtgcca gaggatttgc gagcccctcc tgggctacta cccctacccc 960 tactgctacc agggcgggag ggtgatctgc cggatcatca tgccctgcaa ctggtggatt 1020 gcgcgcatgc tgggcagggt gtag 1044 <210> 29 <211> 2997 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG 00000009563 <400> 29 ttctgtcata atccctcctg cagcacagcc aagtacagcg tggtgacttt tctacctcga 60 ttcctgtatg agcagataag aaaagctgca aatgcattct tcctcttcat tgccttactg 120 cagcaaattc cagatgtctc tccaacagga agatatacca ccttggtgcc attgctattt 180 attctaactg ttgctggcat caaagaaatc atagaagact ataaaaggca taaggcagac 240 agtgcggtga ataaaaagaa aacattagtt ctaagaaatg ggatgtggca gaacattata 300 tggaaagagg tagcagtagg cgatattgtg aaggtcacca atgggcagca tcttccagca 360 gacatgatca ttctatcttc cagtgaacct caagccatgt gctatatcga aacagccaat 420 ctcgatgggg agacaaatct taaaatacga cagggattgt ctcaaactgc tagtctgcag 480 tcaagagaag aactgatgaa ggtatctggg aggattgagt gcgaagggcc gaaccgccat 540 ctctacgact tcactgggaa cttgcgctta gatggtcaaa gcccagttcc tgttggtcca 600 gaccagatct tgctaagagg tgcacagctg aggaacactc aatgggtctt gggtattgtc 660 gtgtatacag gacatgatac aaaactcatg cagaattcaa ccaaagcacc tctgaagaga 720 tcaaacgtgg agaaagtaac caacgtgcag atcctggttt tgttctgtat tctcctgacc 780 atggcccttg tgagctctgt aggtgcctta ttgtggaaca gaacacacgg cgaggtcgtc 840 tggtaccttg gctccaacag aatgctgtct gtcaactttg gatacaatct gctgacattt 900 ataatcctgt acaacaacct tattccaatc agtcttctgg tgacgttgga agttgtcaaa 960 tttactcagg ctctttttat aaattgggac atagatatgt actatcctga gacagacaca 1020 cctgcaatgg ccagaacctc aaaccttaat gaggaacttg ggcaggtaaa atacctgttt 1080 tctgataaaa caggtactct aacatgtaat atcatgaact tcaagaaatg cagtattgct 1140 ggagtgacat atggtcactt tccagagttg gaaagagaac gttcatcaga agactttagc 1200 cagctacctc ctcccaccag tgagtcatgt gaatttgatg acccaagact actgcaaaac 1260 atcgaaaatg accatcccac agctgtgcac atacaggagt tcctcactct gctggccgtg 1320 tgtcacactg ttgttcccga gagacaagga aataaaataa tctaccaagc gtcctctcca 1380 gatgaagggg ctttagtgaa aggagcaaag aaacttggtt atgtcttcac aggaaggact 1440 ccacactcag ttatcattga tgcgctggga aaagaaaaaa cctttgaaat tcttaacgtg 1500 ctggagttct ccagtagtaa caggaagaga atgtcagtga ttgttcgaac tccaggagga 1560 caactccggc tctactgcaa aggggctgac aacgtcattt tcgagaggct ttcaaaagat 1620 tctcagtata tggagcaaac actgtgccat cttgaatact tcgccacaga aggtctgagg 1680 actttgtgca ttgcttatgc agatctgtca gaaaattctt acagagagtg gctgaacatc 1740 tacaatgaaa ccagtacgct tttgaaagac agagctcaga agctggaaga atgctatgag 1800 atcattgaga aggatttact gcttcttgga gctacagcta ttgaagaccg cctgcaagca 1860 ggtgttccag aaacaatagc cacgctgatg aaggctgaaa ttaaaatctg gattctgaca 1920 ggggacaaac aggaaacagc tatcaacata gcagggtact cgtgcagact catttcacag 1980 agcatgtctc tcatcctggt caatgaggat tctctagacg caacaagggc ttctttgact 2040 cagcattgta ccagtctggg ggagtcgctg ggcaaggaaa atgacattgc tctgattatt 2100 gatggccata cgctgaagta tgccctttcg tttgaaatca ggcagagctt tctggacttg 2160 gcactctcct gtaaagcggt catttgttgc agagtatctc ctctacagaa gtctgaaata 2220 gtagacatgg taaagaaaca cgtgaatgcc ataacacttg ccattgggga tggtgccaac 2280 gatgtaggaa tgatccagac agctcacgtc ggcgtcggga tcagtggcaa cgagggcatg 2340 caggcaacca attgctcgga ttatgctatt gcacagtttt cctacttgga gaagctgttg 2400 ctggtccatg gagcttggag ttacaatcga gttaccaagt gcatactata ctgcttctac 2460 aagaatgtgg tgttgtatat tattgagctt tggtttgctt tcgttaatgg attttctggg 2520 cagatcttat ttgagcgatg gtgcattggt ctgtataacg tgattttcac agcattgcca 2580 cccttcactc tgggaatttt tgagcgatcc tgcactcaag atagcatgct tagatttcca 2640 cagctataca aaaccactca aaatgcagat gggttcaaca caagggtttt ctggggtcac 2700 tgcatcaatg ccctggtcca ttccatcatt ctcttctggt ttccaatgaa agtgctggag 2760 catgatgctg tattcacaaa tggacaggga attgactatt tatttgttgg gaacatagtt 2820 tacacttatg ttgtagtcac tgtttgtctg aaagctggtt tggaaacaac tgcgtggaca 2880 agattcagtc acctggcggt ctggggaagc atgctgctct ggctggtctt ctttggcatc 2940 tactcggcca tctggcccac gttccccatg gcacccgata tgctcgggca ggtcagt 2997 <210> 30 <211> 1776 <212> DNA <213> Unknown <220> <223> Anas platyrhynchos domesticus ENSAPLG00000014812 <400> 30 atggcggatg aaagcgaaga tttggctgaa gatctgctca ccgaatatgc catacagctt 60 agcattcaag aatcaaacgc agccaagcca ccagtgtctt ccaattacaa tgacagtttt 120 gtaccaccta gtgaggaaaa taggaaaatt gtagcagcca taaagcaagg tcaagtattt 180 gggctccaag accttgtgaa acagaaatat gctttggatg aagctgatga aagaggctgg 240 tttccactgc atgaggctgc agctcagcca attcaacaaa tacttgaaat cattttagat 300 gcatcttata aagcaatgtg ggaatacaaa acgtgtgatg gagaaacacc actaactttg 360 gcagcaaaag ctggctttgt ggaaaatgta cgagcattgc tggagaaagg tgtttggccc 420 aacacaaaaa atgacaaagg agaaactcca cttcttattg ctgtaaaaag gggctctttt 480 gaaatggcat ccactctgat aaaacacaac tgtagcatcc accagccgtg cgtaaaacgt 540 tggtcagcaa tgcatgaagc tgcaaagcag ggacgcaaag atattgtttc tcttcttctg 600 aaaaatggtg gaaatgtgaa ccttaaggat ggatatggag taacaccatt aggtgttgct 660 gctgaacacg gtcactgtga tgtgctggaa catcttattc ataaaggtgg agacgtcgag 720 gccttagcag atgatggtgc atcaatactg tttgaagcag ccggaggagg taatccagac 780 tgcattgcac ttcttttgga atatggagga agtggcaatg tgcctaataa ggcaggactg 840 cttcccatac acaaagcagc ttatgagggc cattacctgg tcctgaagta tctcattcca 900 gtcacatccc aaaatgcaat ccagaaaagt gggttaagcc ctgttcactc agctgcagat 960 ggtcagaatt cgcagtgtct agagctcctc attgaaagtg gttttgatgt caatactctc 1020 ttggctgagc acatttcaaa tagttacgat gatgaaagga aaactgcact ttattttgct 1080 gtttcaaaca atgacattct ttgcaccgaa attttactga aagctggtgc aaatccaaac 1140 aaggatcctt taaactgtct tcttgtggca gtgagagctg gtaatcatga aatagtaagg 1200 ctgctcctat cttatggagc aaacgtcaat tgctacttta tgctggttaa tgatacgcat 1260 ttccccagtg ccattcagta tgccttgaac gatgaagtga tgctgaggct gttgctgaat 1320 catggatata atgtggagat gtgttttgac tgtatgcatc aagatatctt tggaaattct 1380 tttgtgtggt caactccaga ggaagagatt ctcccaggat ggacttcttc tgtaataaag 1440 gataatccat tctgtgactt tattgctgtt ccttggttga aacacttagc gggcaaagtt 1500 gttcgtgttt ttatagatta catggattat gtccctctgt gcacaaaaat taagtttgtc 1560 ctagaaacac agaaggaatg gccagagatt cgtcaaatat tggataatcc tcgcccattg 1620 aaacatcttt gtcgcctgaa aatacgtaaa ctcatggggt tgaggaggct ccagaaactg 1680 tcatctatga agaagtttcc acttccaccg gttctcaaga actatatcct atataaagaa 1740 tatgatctgt atggaaaaga gatacattta gagtag 1776 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UTS2R forward <400> 31 ctctacaccc tgctcaccaa 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UTS2R reverse <400> 32 cgtatgtctc tgtgcagtgc 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIK3R6 forward <400> 33 tgatggtgtg tgctgtgttg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIK3R6 reverse <400> 34 tgtgccagaa ctgagtttgc 20 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward <400> 35 aaggctgaga atgggaaac 19 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse <400> 36 ttcagggact tgtcatactt c 21

Claims (19)

Composition for detecting the exposure to high temperature stress of ducks comprising a detection reagent that specifically binds to the gene of SEQ ID NO: 1.
The duck's exposure to high temperature stress according to claim 1, wherein the detection reagent is at least one selected from the group consisting of antibodies, antibody fragments, aptamers, primers, probes, and anti-sense nucleotides. Composition for detecting whether or not.
1) separating RNA from the ducks of the experimental group exposed to the high temperature stress and the ducks of the normal control group, respectively;
2) measuring the amount of RNA using the composition of claim 1, using the RNA of step 1); And
3) comparing the amount of RNA in step 2) with the control group to determine the expression level, duck or not exposed to high temperature stress.
The method according to claim 3, wherein the expression level of the gene represented by SEQ ID NO: 1 increases or decreases for 1 to 7 hours as compared to the control group.
delete Kit for detecting the exposure to high temperature stress of the duck comprising the composition of claim 1.
A microarray chip for detecting whether ducks are exposed to high temperature stress, in which an oligonucleotide or a complementary strand molecule constituting the nucleic acid sequence of the gene of SEQ ID NO: 1 is integrated.

delete delete delete delete delete delete delete delete delete delete delete delete

Images