KR20140010617A - Primers for distinguishing misgurnus mizolepis and method using the same - Google Patents

Abstract

In a circumstance that a scientific technique to distinguish domestic misgurnus mizolepis from Chinese misgurnus mizolepis is required, provided is a primer for distinguishing domestic misgurnus mizolepis from Chinese misgurnus mizolepis which is not expensive and easy to use using a mutation group site of domestic and Chinese misgurnus mizolepis of cytochrome c oxidae I (COI) gene and D-loop gene of mitochondria DNA. Firstly, separate genomic DNA from domestic and Chinese misgurnus mizolepis, search a mutation group site of domestic and Chinese misgurnus mizolepis which is differentiated from each other by analyzing the base sequence of D-loop and COI genes, and produce a primer which is weirdly combined so that amplification should occur only in domestic misgurnus mizolepis but not in Chinese misgurnus mizolepis. After the developed primer is processed, sorting the country of origin using only PCR and electrophoresis became possible. [Reference numerals] (AA) Domestic misgurnus mizolepis; (BB) Chinese misgurnus mizolepis; (CC) 96nd : produced in 1996 Nakdonggang River, gr : Geumgang River, dj : Dongjingang River, mk : Mankyounggnag River, nd : Nakdonggang River, sj : Seomjingang River, ys : Youngsangang River, hr : Hangang River misgurnus mizolepis

Description

Primer for identifying the origin of loach loach and identification method using same {Primers for distinguishing Misgurnus mizolepis and method using the same}

The present invention relates to a primer for identifying loach origin and a method for identifying same using loach, and more specifically, to identify the origin of domestic loach and Chinese loach using the primer and the primer for identifying the origin of domestic loach and Chinese loach. It relates to a primer for identifying the origin of a loach and an identification method using the same.

Misgurnus mizolepis ) is a small class of freshwater fish belonging to the taxonomy of Order Cypriniformes and Family Cobotidae, inhabiting China, Taiwan and all over Korea. Loach has been used for food along with loach, but domestic production has been decreasing since 2005 due to river pollution and abuse of pesticides. In addition, Chinese loach began to be imported, and from the late 1990s, imports increased dramatically and completely dominated the domestic market. In 2008, loach imports amounted to about 10,500 tons and 45 billion won, but domestic production is only 432 tons. In addition, since some of the domestic production is imported from Chinese loach, stocked as stock seedlings in domestic farms, and raised for three months to sell domestically, actual production of domestic loach is very small. According to the above phenomenon, the loach seedling industry in Korea has reached the level of losing competitiveness.

Recently, due to the change of the world's free trade system, high-rate tariffs are being abolished or lowered, making domestic competitiveness even worse. Moreover, many consumers select domestic fishery products despite the high price according to domestic preferences.Therefore, there are companies that import cheap Chinese loach and make huge profits by misrepresenting their origin and domestically importing them. The damage is still going to consumers. In addition, most of the loach supplied to the market due to the mass import of Chinese loach is made in China, which is artificially introduced into nature through fire prevention, which is highly likely to cause genetic pollution by hybridizing with our loach. It is also highly likely to spread the disease, which can lead to fisheries disruption.

In developed countries, due to the government's active interest in indigenous fish species, in Japan, the rapid PCR-RFLP method of imported and domestic mackerel developed coastal and atlantic ocean identification technology (Futoshi Aranishi, Marine Biotechnology, 2005, Vol. 7, No. 6, pp 571-575), Development of country identification technology for imported fish in Korea through analysis of mtDNA of imported cutlass (Chakraborty et al., Zoological Studies, 2006, Vol. 45, No. 3, pp 419-427) In the case of the United States, the government is making efforts to identify the country of origin under the operation of government agencies, such as managing information in the Foreign Agricultural Service (FAS) under the USDA.

Of course, in Korea, the interest of developing the country of origin identification technology in recent years, and the polynucleotide for determining the origin of the devil and the method of determining the devil's origin using the same (domestic patent application 10-2011-0121083), the fish belonging to the skate family or stingray The method of determining the classification system of the polynucleotide probes, DNA chips and kits related thereto (Korean patent application 10-2006-0073749), and the like has been patented. In addition, origin identification technology using genes has been developed in cutlass (registered patent publication No. 10-1131789), mackerel, octopus, eel, jade dome, etc. The level is inadequate, and there are no studies that have recognized the origin of loach.

To date, only domestic loach and Chinese loach imported from China are used by simple comparative morphological taxonomy due to differences in body length and height. Comparative morphological taxonomy is relatively accurate in the classification of species, but it is relatively inexpensive, such as loach, a small taxa that is difficult to identify, and its morphological characteristics are simple or mutant enough to make it difficult to obtain identification traits. In the case of taxonomic groups, relying only on morphological traits can still lead to serious taxonomic errors and the difficulty of demarcation between the two groups can significantly reduce the accuracy of the classification itself.

In order to solve this problem of comparative morphological classification, molecular system analysis using molecular systemology that infers the lineage of a gene by analyzing the nucleotide sequence of a living organism has recently been recognized as one of the most powerful biological lineage tracking methods. It is widely used. Such molecular system analysis has the advantage of being able to accurately identify and analyze lineages, which has attracted a lot of attention as the concept of DNA taxonomy has been raised by related researchers, and molecular markers can be used to distinguish various species or lines already. Technology is being developed.

Therefore, in the present invention, to identify the origin of domestic and Chinese loach, we tried to develop a rapid, simple and accurate primer for identifying loach origin.

An object of the present invention has been proposed to solve the problems caused by the import of Chinese loach as described above, the domestic and Chinese loach, the origin of the identification between each other and the method of identifying the origin of domestic loach and Chinese loach using the primer In providing.

In order to achieve the above object, the present invention has developed a primer for identifying loach origin by using population-specific mutation sites of domestic loach and Chinese loach searched within D-loop gene or CO I gene of loach.

In addition, the present invention comprises the steps of separating genomic DNA of loach; Binding the DNA to a loach origin identifying primer; The origin identification method of loach has been developed, comprising the step of identifying loach origin according to the binding.

The method for identifying the origin of domestic and Chinese loach according to the present invention uses molecular biological techniques, and can reduce the taxonomic error that may occur when relying only on existing morphological traits. In addition, since domestic and Chinese loach can be identified through a single PCR amplification and electrophoresis, it is quick, easy and accurate, and has the advantage of maximizing efficiency and practicality of origin identification.

According to the present invention, if the origin of the loach is quickly and accurately identified, the distribution path of the loach made in China becomes transparent, thereby improving the awareness of the consumer's right to know and the use of aquatic products. In addition, the quality of domestic loach will be naturally progressed for cost competition, and it will be a basic development for accurate identification and protection of native fish species in Korea.

1 is an electrophoretic photograph of a multiplex PCR product obtained using the primer of the present invention.
96nd: Nakdong River from 1996, gr: Geum River, dj: Dongjin River, mk: Mangyeong River, nd: Nakdong River, sj: Seomjin River, ys: Yeongsan River, hr: Han River Mudfish

Hereinafter, the present invention will be described in detail with reference to embodiments of the present invention.

Example 1 Genomic DNA Extraction from Loach Fin Tissue

As a material for developing primers, Chinese loach was collected from aquaculture in Qingdao, China in May 2009, purchased from Shanghai market in December 2009, and imported from Lianyungang in March 2011. Ten animals were used, and five Korean loach were collected from the 1996 Nakdong River donated by Pukyong National University and five from the Nakdong River in 2010. Genomic DNA extraction was performed by cutting the tail fin of each individual by about 1 cm ² and extracting it using a conventional phenol extraction method.

Example 2 Amplification of D-loop and CO I Genes of Loach Mitochondrial DNA

First, in order to amplify the D-loop gene and CO I gene of the loach mitochondrial DNA, primers for amplifying the D-loop gene and the CO I gene of loach regardless of origin were prepared. After the primers have downloaded the genetic information of the various fish species available in GenBank, they were multi-sequenced using ClustalW of BioEdit 7.0.1 and prepared based on the highly conserved nucleotide sequence information. Primer sequences used for amplification of D-loop and CO I genes in loach are shown in Table 1.

Primer Information for Amplifying Loach D-loop and CO I Genes Name of the primer The primer sequence (5'-3 ') Primer Length (mer) D-loop F
D-loop R GCATCGGWCTTGTAATCCGA
TGCGGAGRCTTGCATGTGTA 20
20 CO I F
CO I R GCGTCTYTGGATTTGCAATC
CCAACKGTGAACATGTGATG 20
20

PCR reaction with 20µl AccuPower 1μl of each genomic DNA extracted from Example 1 and 1μl of 10 pmole primer were added to PCR Premix Kit (Bioneer, Korea), and then subjected to an initial heat denaturation reaction at 94 ° C. for 4 minutes, followed by 94 ° C. for 30 seconds. , 55 ° C 30 seconds, 72 ° C 1 minute circulation reaction was carried out 35 times. Finally, the stretch reaction was performed at 72 ° C. for 7 minutes, and the success of the PCR reaction was confirmed by electrophoresis on a 1.5% agarose gel stained with GelRed (Invitrogen, USA).

The method of extracting genomic DNA of loach as described in Examples 1 and 2, or the method of amplifying D-loop gene or CO I gene in mitochondrial DNA of loach by PCR is just one example. It is not limited. Other DNA extraction methods known to those skilled in the art, methods using a primer capable of amplifying known D-loop genes or CO I genes in addition to the primers shown in Table 1, or modified PCR amplification conditions It will also be apparent that they fall within the scope of the invention.

Example 3 Sequence Analysis of Amplified Genes

AccuPrep amplified products of D-loop and CO I genes of domestic and Chinese loach, respectively, amplified in Example 2, respectively. After purification using PCR Purification Kit (Bioneer), the nucleotide sequence of each gene was determined by Direct_sequencing method using an automatic base sequencer (ABI 3700; Perkin Elmer).

Sequencing showed that the D-loop gene successfully amplified 970 bp in all subjects. I gene was also successfully amplified 1551 bp in all individuals. The analyzed sequences were subjected to multiple sequence alignment using ClustalW of BioEdit 7.0.1. Through this, the nucleotide sequence of the D-loop gene of domestic loach (SEQ ID NO: 1) and the base sequence of the D-loop gene of Chinese loach ( SEQ ID NO: 2), the nucleotide sequence (SEQ ID NO: 3) of the CO I gene of domestic loach, and the nucleotide sequence (SEQ ID NO: 4) of the CO I gene of Chinese loach.

Example 4 Detection of Group-Specific Mutation Sites of Domestic and Chinese Loach

As a result of comparing and comparing the nucleotide sequences finally determined in Example 3, it was found that more than 99% of the D-loop genes SEQ ID NO: 1 and SEQ ID NO: 2 were identical, but 70, 608, 845 nucleotide sequences It was found that this is a site specific mutation site for domestic and Chinese loach. In the case of the CO I gene, SEQ ID NO: 3 and SEQ ID NO: 4 were found to be more than 99% identical, but among them, the 315th and 1475th sequences were found to be site-specific mutation sites of domestic and Chinese loach.

Details of the population specific variation sites are shown in Table 2.

Population-specific mutation sites (bp) D-loop COI origin individual 70 608 845 315 1475 Made in China Made in China 1 C A G A T Made in China 2 C A G A T Made in China 3 C A G A T Made in China 4 C A G A T Made in China 5 C A G A T Made in China 6 C A G A T Made in China 7 C A G A T Made in China 8 C A G A T Made in China 9 C A G A T Made in China 10 C A G A T Domestic Nakdong River 1996 T C A G C Nakdong River 1996 T C A G C Nakdong River 1996 T C A G C Nakdong River 1996 T C A G C Nakdong River 1996 T C A G C Nakdong River 2010 1 T C A G C Nakdong River 2010 2 T C A G C Nakdong River 2010 3 T C A G C Nakdong River 2010 4 T C A G C Nakdong River 2010 (2010) T C A G C

Example 5 Preparation of Primer Using Group Specific Mutation Sites

Of the group specific mutation sites found in Example 4, 22 mer forward primer (SEQ ID NO: 5) that binds to the 608th site of SEQ ID NO: 1 and 19 mer reverse primer that complementarily binds to the 845th site of SEQ ID NO: 1 (SEQ ID NO: 6) was produced. It is a pair of primer sets that can amplify a part of D-loop gene of domestic loach, and it is designed so that amplification occurs in domestic loach and no amplification occurs in Chinese loach.

In addition, 19 mer forward primer (SEQ ID NO: 7) that binds to the 315th site of SEQ ID NO: 3 and 15 mer of 15 mer that complementarily bind to the 1475 th site of SEQ ID NO: 3 among the population specific mutation sites found in Example 4 A reverse primer (SEQ ID NO: 8) was prepared. This is a pair of primer sets that can amplify a portion of the domestic I loach CO I gene, it was designed to amplify in domestic loach, but not amplification in Chinese loach.

Detailed primer information is shown in Table 3.

 Primer information to identify domestic and Chinese loach origin
gene For identification of origin
Primer name Pry and nucleotide sequence
(5 '→ 3') Size (mer) Amplification Size
(bp) D-loop Mizol_D_loop F F:  GCATTGCATATGTTTATATCAC (SEQ ID NO: 5) 22 274 Mizol_D_loop R R:  CCCTGKTTTTGGGGTTTAT (SEQ ID NO: 6) 19 CO I Mizol_ CO I F F:  CATAAGCTTTTGACTCCTG (SEQ ID NO: 7) 19 1192 Mizol_ CO I R R:  CGTGGAGTAACTCGG (SEQ ID NO: 8) 15

Example 6 Verification of Developed Primer

Two pairs of primer sets developed in Example 5 were used to verify whether the origin of domestic and Chinese loach can be effectively identified. For domestic loach, 8 dogs were collected from Nakdong, Geum, Dongjin, Mangyeong, Nakdong, Seomjin, Yeongsan, and Han rivers in 1996.The Chinese loach was 8 individuals purchased at the Shanghai market in December 2009. Was used.

Genomic DNA extraction was performed in the same manner as in Example 1, and PCR reaction was performed in the same manner as in Example 2, but each of two pairs of primer sets developed in Example 5 were used as primers. The success of the PCR reaction was confirmed by electrophoresis on a 1.5% agarose gel stained with GelRed (Invitrogen, USA). First, in case of using the primer sets consisting of SEQ ID NOs: 5 and 6, PCR products were identified at 274 bp in only 8 loach loach in Korea, and 1192 bp only in 8 loach loach in Korea. PCR products were identified in size. Therefore, it was confirmed that even if only one pair of primer sets of the two pairs of primer sets were used, the origin could be accurately identified with or without bands.

In a preferred embodiment, in the present invention, in order to more accurately identify the origin of the loach, multiplex PCR reaction using both pairs of primer sets results in only 274 bp and 1192 of 8 domestic loach as shown in FIG. Multiplex DNA products double-amplified at bp size were identified, and multiplex DNA products were not identified in eight Chinese products, confirming that a more accurate and convenient Mizol_Multi marker was developed.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> Primers for distinguishing Misgurnus mizolepis and method using          the same <130> WP-2012-0076 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 969 <212> DNA <213> Misgurnus mizolepis <400> 1 gttatggtat agtacatatt atgcataata ttacattaat ggattagtac attaatgtat 60 tatcacctat ttcataattt aaccataaag caagtaattt aaactaagat atacataaac 120 caatataatt tttcaacaca taaaatccaa caaagacatg atgatatatt ccccaaatta 180 ttgtcctcaa aattttcctt gaataactca actaacatct attagacaaa tattaatgta 240 gtaagagacc accaaccagt ttatataaag gcatattatt aatgataggg tcagggacaa 300 taattgtggg ggtaacactt agtgaactat tactggcatc tggttcctat ttcagggaca 360 aaactgcata actccactta cagataatta tactggcatc tgattaatgg tgtagtacat 420 acgactcgtt acccaccatg ccgggcattc ttttatatgc atagggttct cttttttggt 480 ctacctttcc tatacatctc agagtgcagg ctcaaataat aaaacaaggt ggaacatttt 540 tcttgcatga attaatataa gtgaatgata aaaagacata acttaagcat tgcatatgtt 600 tatatcacgt gcataacaca tccttattca acacagcttt atactatatg cccccttttg 660 gtttttgcgc gacaaacccc cctaccccct acgctaggcg attcctgttt atccttgtca 720 aaccccgaaa ccaaggaaga ctcgactgag cgtatcaaaa tcaatgagtt gaagtagata 780 ttgatttatg ccaccacatt atatatatat atatcacata aaatatatat ataatgattt 840 tgtataaacc ccaaaaccag ggttaaaaat tgttaaaatg aagtcaatac taacttttaa 900 gagaacaaat atgctcgcgt agcttaaaat aaagcatagc actgaagatg ctaagatggg 960 ccctagaaa 969 <210> 2 <211> 969 <212> DNA <213> Misgurnus mizolepis <400> 2 gttatggtat agtacatatt atgcataata ttacattaat ggattagtac attaatgtat 60 tatcacctac ttcataattt aaccataaag caagtaattt aaactaagat atacataaac 120 caatataatt tttcaacaca taaaatccaa caaagacatg atgatatatt ccccaaatta 180 ttgtcctcaa aattttcctt gaataactca actaacatct attagacaaa tattaatgta 240 gtaagagacc accaaccagt ttatataaag gcatattatt aatgataggg tcagggacaa 300 taattgtggg ggtaacactt agtgaactat tactggcatc tggttcctat ttcagggaca 360 aaactgcata actccactta cagataatta tactggcatc tgattaatgg tgtagtacat 420 acgactcgtt acccaccatg ccgggcattc ttttatatgc atagggttct cttttttggt 480 ctacctttcc tatacatctc agagtgcagg ctcaaataat aaaacaaggt ggaacatttt 540 tcttgcatga attaatataa gtgaatgata aaaagacata acttaagcat tgcatatgtt 600 tatatcaagt gcataacaca tccttattca acacagcttt atactatatg cccccttttg 660 gtttttgcgc gacaaacccc cctaccccct acgctaggcg attcctgttt atccttgtca 720 aaccccgaaa ccaaggaaga ctcgactgag cgtatcaaaa tcaatgagtt gaagtagata 780 ttgatttatg ccaccacatt atatatatat atatcacata aaatatatat ataatgattt 840 tgtgtaaacc ccaaaaccag ggttaaaaat tgttaaaatg aagtcaatac taacttttaa 900 gagaacaaat atgctcgcgt agcttaaaat aaagcatagc actgaagatg ctaagatggg 960 ccctagaaa 969 <210> 3 <211> 1551 <212> DNA <213> Misgurnus mizolepis <400> 3 gtggcaatca cacgctgatt cttctctact aaccacaaag atattggcac cctctacctt 60 gtatttggtg cctgagccgg aatggtcgga acggccctca gccttttaat tcgtgctgag 120 ctcagccaac ctggatctct cctgggggat gaccaaattt ataatgttat tgttaccgca 180 catgcctttg tcatgatttt ctttatagta atgccaattc tcattggcgg ctttggaaat 240 tgactaattc cactaatgat tggggcccca gatatagcgt tcccacgaat aaacaacata 300 agcttttgac tcctgccacc ctcatttcta cttttactag cctcctctgg tgttgaagct 360 ggggccggaa cagggtgaac agtctacccg ccactggcgg gtaatctcgc ccatgcaggt 420 gcatccgttg accttaccat cttttctctt cacctcgcag gtgtttcttc aattctggga 480 gcaattaatt ttattaccac aacaattaat atgaaacccc cagccatttc acaatatcag 540 acacccttat ttgtctgagc agtccttgta accgccgttc ttctcctttt gtccctgcct 600 gtcttagctg ctgggattac tatgctttta acagaccgaa acctgaatac aacattcttt 660 gacccggcgg gaggaggaga cccaattcta taccagcact tattctgatt ctttggccac 720 ccagaagtat acattttaat tttacccgga ttcgggatta tctcacatgt tgtagcctac 780 tacgctggta aaaaagaacc tttcggctat ataggaatgg tttgagctat gatggccatt 840 ggcctcttag gcttcattgt ctgagcccac catatgttta cggtcgggat agatgttgac 900 acccgcgcat acttcacatc tgctacaata attattgcca tccctactgg tgtaaaagtc 960 tttagctgac tggccaccct tcacgggggc tcaattaaat gagagacccc aatactctga 1020 gccctaggat ttatcttcct gttcacagtg ggtgggctta ccgggattgt tctagctaac 1080 tcatccatcg acattgttct ccatgacaca tattatgtag ttgcccactt ccattatgta 1140 ctctcaatgg gtgcagtctt tgctattata gccggctttg tacactgatt cccgctgttt 1200 acaggttata ctttacacag cacatgaact aaaatccact ttggggtcat gtttttaggt 1260 gtcaacctca ccttcttccc acaacacttc cttggccttg caggtatgcc ccgacggtac 1320 tcagattacc cagatgccta tacactgtga aacacagtct catctattgg atctataatt 1380 tcactagtag ctgtaattat gttcctattt atcttatgag aagccttcgc cgctaaacgg 1440 gaagtcctat ccgtagaact aaccgcaaca aacgccgagt gactccacgg atgccctccc 1500 ccttatcata catttgagga gccagcattt gttcaagttc aatcaaatta a 1551 <210> 4 <211> 1551 <212> DNA <213> Misgurnus mizolepis <400> 4 gtggcaatca cacgctgatt cttctctact aaccacaaag atattggcac cctctacctt 60 gtatttggtg cctgagccgg aatggtcgga acggccctca gccttttaat tcgtgctgag 120 ctcagccaac ctggatctct cctgggggat gaccaaattt ataatgttat tgttaccgca 180 catgcctttg tcatgatttt ctttatagta atgccaattc tcattggcgg ctttggaaat 240 tgactaattc cactaatgat tggggcccca gatatagcgt tcccacgaat aaacaacata 300 agcttttgac tcctaccacc ctcatttcta cttttactag cctcctctgg tgttgaagct 360 ggggccggaa cagggtgaac agtctacccg ccactggcgg gtaatctcgc ccatgcaggt 420 gcatccgttg accttaccat cttttctctt cacctcgcag gtgtttcttc aattctggga 480 gcaattaatt ttattaccac aacaattaat atgaaacccc cagccatttc acaatatcag 540 acacccttat ttgtctgagc agtccttgta accgccgttc ttctcctttt gtccctgcct 600 gtcttagctg ctgggattac tatgctttta acagaccgaa acctgaatac aacattcttt 660 gacccggcgg gaggaggaga cccaattcta taccagcact tattctgatt ctttggccac 720 ccagaagtat acattttaat tttacccgga ttcgggatta tctcacatgt tgtagcctac 780 tacgctggta aaaaagaacc tttcggctat ataggaatgg tttgagctat gatggccatt 840 ggcctcttag gcttcattgt ctgagcccac catatgttta cggtcgggat agatgttgac 900 acccgcgcat acttcacatc tgctacaata attattgcca tccctactgg tgtaaaagtc 960 tttagctgac tggccaccct tcacgggggc tcaattaaat gagagacccc aatactctga 1020 gccctaggat ttatcttcct gttcacagtg ggtgggctta ccgggattgt tctagctaac 1080 tcatccatcg acattgttct ccatgacaca tattatgtag ttgcccactt ccattatgta 1140 ctctcaatgg gtgcagtctt tgctattata gccggctttg tacactgatt cccgctgttt 1200 acaggttata ctttacacag cacatgaact aaaatccact ttggggtcat gtttttaggt 1260 gtcaacctca ccttcttccc acaacacttc cttggccttg caggtatgcc ccgacggtac 1320 tcagattacc cagatgccta tacactgtga aacacagtct catctattgg atctataatt 1380 tcactagtag ctgtaattat gttcctattt atcttatgag aagccttcgc cgctaaacgg 1440 gaagtcctat ccgtagaact aaccgcaaca aacgtcgagt gactccacgg atgccctccc 1500 ccttatcata catttgagga gccagcattt gttcaagttc aatcaaatta a 1551 <210> 5 <211> 22 <212> DNA <213> Misgurnus mizolepis <400> 5 gcattgcata tgtttatatc ac 22 <210> 6 <211> 19 <212> DNA <213> Misgurnus mizolepis <400> 6 ccctgktttt ggggtttat 19 <210> 7 <211> 19 <212> DNA <213> Misgurnus mizolepis <400> 7 cataagcttt tgactcctg 19 <210> 8 <211> 15 <212> DNA <213> Misgurnus mizolepis <400> 8 cgtggagtaa ctcgg 15

Claims (2)

A primer for identifying the origin of loach, which comprises at least one nucleotide sequence selected from SEQ ID NO: 5 to SEQ ID NO: 8. Separating genomic DNA of loach;
Binding the DNA to a primer having at least one nucleotide sequence selected from SEQ ID NO: 5 to SEQ ID NO: 8; And
Identifying loach origin according to the combination; Loach origin identification method comprising a.

Images