CN107119129B - Method for identifying Huai 33 wheat variety - Google Patents
Method for identifying Huai 33 wheat variety Download PDFInfo
- Publication number
- CN107119129B CN107119129B CN201710340926.9A CN201710340926A CN107119129B CN 107119129 B CN107119129 B CN 107119129B CN 201710340926 A CN201710340926 A CN 201710340926A CN 107119129 B CN107119129 B CN 107119129B
- Authority
- CN
- China
- Prior art keywords
- wheat
- huai
- mul
- variety
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention belongs to the technical field of identification of wheat germplasm resource varieties, and particularly relates to an identification method of a conventional wheat variety Huai Mai 33. Using SSR labeling techniques by800 pairs of SSR primers distributed on 21 wheat chromosomes are screened and confirmedbarc45Andwmc382the primer has better specificity for the Huai wheat 33 variety and is used for identifying the Huai wheat 33 variety. The method needs a small amount of detection samples, is mature, has high accuracy, is applied to the market to identify the authenticity of the Huai wheat 33 variety, and is beneficial to the popularization of new varieties and the germplasm resource protection.
Description
Technical Field
The invention belongs to the technical field of identification of wheat germplasm resource varieties, and particularly relates to a method for identifying a Huai-mai 33 wheat variety.
Background
Wheat (Triticum aestivum L.) is one of the most important grain crops in China, and the annual planting area is about 3.6 hundred million acres. With the improvement of the commercialization level of seeds and the continuous emergence of excellent new varieties, the wheat varieties in China are updated more and more quickly. And with the increase of the land circulation speed in rural areas in China, the rate of good seeds purchased by farmers is continuously improved, and the annual demand for good seeds of wheat is about 50 billion jin. The existence of commercial value causes a plurality of seed enterprises to start to operate the improved variety of wheat, while enterprises without variety rights often appear phenomena that illegal behaviors such as variety fake package, fake plate and the like occur in the market for obtaining high profit, and the farmers are injured by fake and counterfeit seeds, thereby affecting the willingness of the farmers to purchase the improved variety to a certain extent, also infringing the legal rights and interests of regular enterprises, inhibiting the breeding innovation power of breeders and affecting the healthy and stable development of the wheat seed industry in China. In order to protect the new wheat variety right and provide effective evidence for the work of forging the right of maintenance, an accurate, rapid and stable variety identification method is urgently needed.
The traditional morphological identification of wheat grains, seedlings, plants and the like needs experts with abundant experience, and the problems of long identification time, easy influence of artificial subjective factors and the like exist, so that the method is not suitable for use in courts; chemical identification means such as a phenol dyeing method, sodium hydroxide determination and the like are easily limited by the development degree of seeds, environmental conditions and the like, and the identification accuracy is not high; protein marking technologies such as acid polyacrylamide gel electrophoresis and the like are adopted, so that more bands exist, the result is difficult to judge, and the variety with closer genetic relationship is difficult to identify; whole genome sequencing using a single variety often has many problems such as complex technology and high cost. The above-mentioned techniques have drawbacks that make it difficult to use them as a uniform means of identification for different wheat varieties.
Currently, molecular marker (including RAPD, RFLP, SSR and KASP) technologies are widely used in the study of wheat genomes. Compared with other molecular markers, the SSR markers mainly have the following advantages: (1) the markers are abundant in quantity, have more allelic variation and are widely distributed on each chromosome; (2) is a co-dominant marker, inherited in mendelian; (3) the method has the advantages of good technical repeatability, easy operation and reliable result. The method is widely applied to the aspects of construction of wheat genetic linkage maps, marking and positioning of target genes, identification of chromosome segments, genetic diversity analysis, marker-assisted selection and the like. Therefore, according to the technical characteristics of molecular markers, 1 or more specific primers are screened out by using the molecular marker technology, and the primers can truly reflect the genotype information of the wheat variety, so that the specific primers can be used for the identification work of the wheat variety. The technology can provide effective evidence for the work of forging the right to maintain the wheat variety, and is beneficial to the development of the protection work of the related variety.
Disclosure of Invention
The purpose of the invention is: provides a method for identifying 33 wheat varieties in Huai wheat, utilizes SSR marking technology and adopts specific primers capable of better expressing the wheat varieties in Huang-Huai wheat areabarc45Andwmc382the rapid and accurate identification method is provided for the Huai 33 wheat variety through the two pairs of primers.
The technical solution of the invention is as follows: by utilizing SSR marking technology, 800 pairs of SSR primers distributed on 21 wheat chromosomes are screened to confirmbarc45Andwmc382the primer has better specificity for the 33 varieties of the Chinese yams, and is used for identifying the 33 varieties of the Chinese yams; the identification method comprises the following steps:
(1) extracting DNA from any organ or tissue of the Huai 33 wheat variety and the wheat variety to be detected respectively by adopting a CTAB method;
(2) the Huai wheat 33 wheat variety extracted in the step (1) and waiting for the sameDNA of wheat variety is used as template tobarc45 Andwmc382respectively carrying out PCR amplification for the primer sequences; the above-mentionedbarc45 Andwmc382the sequences for the primers correspond to the following table:
(3) carrying out electrophoresis on the PCR amplification product obtained in the step (2), and developing after the electrophoresis is finished;
(4) performing banding statistics on the developed sample obtained in the step (3), and comparing and judging, wherein if the electrophoresis result of the PCR amplification sample of the wheat variety to be detected is consistent with the banding pattern of the PCR amplification sample of the wheat variety Huai 33, the wheat variety to be detected is Huai 33; if the difference is not consistent, the variety of the wheat to be detected is non-Huai wheat 33.
Wherein in the step (2), the 12.5 muL PCR amplification reaction system is set as follows: 2 muL of DNA template extracted in the step (1), 0.08 muL of Taq DNA polymerase (5U/muL), 10 xbuffer (containing Tris-HCl 100 mM, KCl 500 mM and MgCl)215 mM) 1.25 muL, dNTPs (10 mM) 0.25 muL, ultrapure water 6.92 muL, and a primer pairbarc45 Andwmc3821 muL of each of the upstream sequence and the downstream sequence is counted by 10 mumol/L; the amplification procedure (Touchdown PCR): pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; renaturation at 62 ℃ (1 ℃ per cycle) for 40 s; extension at 72 ℃ for 40s for 10 cycles; denaturation at 94 ℃ for 30 s; renaturation at 52 ℃ for 40 s; extension at 72 ℃ for 40s, 26 cycles; finally, extending for 5min at 72 ℃; the PCR amplification product is stored at 4 ℃ for later use.
Wherein, in the step (3), a loading buffer solution is added before electrophoresis, and the components of the loading buffer solution are as follows: 0.3 mol/L sodium hydroxide, 6mM EDTA (pH8.0), 0.15% of bromophenol blue in mass fraction, and 0.25% of xylene cyan in mass fraction.
Wherein, in the step (3), the gel electrophoresis analysis specifically comprises: adding 2.5 muL of sample loading buffer solution into a reaction system of 12.5 muL PCR amplification; a sample is taken and subjected to 3 muL electrophoresis, the constant voltage of 200V electrophoresis is carried out for 100 minutes on non-denatured polyacrylamide gel with the mass concentration of 10%, and silver staining is carried out for color development.
The invention has the advantages that: 1. by utilizing SSR marking technology, 800 SSR marks on 21 wheat chromosomes are screened to confirmbarc45 Andwmc382 the primer sequence has better specificity aiming at the Huai-mai 33 wheat variety and is used for identifying the Huai-mai 33 wheat variety; 2. the method is mature, has small detection sample amount, is quick, simple and convenient, has high accuracy, can be conveniently and effectively applied to market for identifying the truth of the 33 varieties of the Huai wheat, is favorable for protecting the new variety right of the plant, popularizing the new variety and utilizing germplasm resources, and simultaneously provides better reference for popularizing, utilizing and protecting other wheat varieties.
Drawings
FIG. 1 is an electrophoretogram of untreated portions of primers during primary screening of specific primers: wherein, Lane 1 is Huai wheat 33, Lane 2 is Ninong 19, Lane 3 is Zheng wheat 991;
FIG. 2 is an electrophoretogram of untreated portions of primers during primary screening of specific primers: wherein, Lane 1 is Huai wheat 33, Lane 2 is Ninong 19, Lane 3 is Zheng wheat 991;
FIG. 3 is an electrophoretogram of untreated partial primers during primary screening of specific primers: wherein, Lane 1 is Huai wheat 33, Lane 2 is Ninong 19, Lane 3 is Zheng wheat 991;
FIG. 4 is an electrophoretogram of untreated portions of primers during primary screening of specific primers: wherein, Lane 1 is Huai wheat 33, Lane 2 is Ninong 19, Lane 3 is Zheng wheat 991;
FIG. 5 shows the specific primers in the secondary screening processbarc45The electrophoretic alignment chart of (1), wherein from left to right are: marker; 1: 33 of Huai wheat; 2: tobacco grower 19; 3: zheng wheat 991; 4-16: huai mai 33 derived cultivar (line); 17-30: mainly pushing varieties in Huang-Huai-Mai district; 31-33: the variety is mainly pushed in the northern region of Jiangsu Huaihe province;
FIG. 6 shows the specific primers in the secondary screening processwmc382The electrophoretic alignment chart of (1), wherein from left to right are: marker; 1: 33 of Huai wheat; 2: tobacco grower 19; 3: zheng wheat 991; 4-16: a Huai 33 derived variety; 17-30: Huang-Huai-Mai district main-tui variety(ii) a 31-33: the variety is mainly developed in the northern region of Huaihei of Jiangsu province.
Detailed Description
The present invention will be further explained with reference to the following examples, wherein the sources and major reagents of the wheat varieties to which the present invention relates are briefly described as follows before the examples are specifically described: the Huai-33 wheat variety and other wheat test materials are provided by a wheat breeding chamber of a farm institute in Huaian city or purchased from a regular channel in the market;Barc45、wmc382and other primer sequences are synthesized and provided by Takara biological engineering (Dalian) Co.Ltd; taq DNA polymerase was purchased from Takara Bio engineering (Dalian) Ltd; the PCR reaction was run on a German Eppendorf series PCR instrument.
The difficulty and key point of the invention lie in the specific primer sequence aiming at the Huai-Mai 33 wheat varietybarc45Andwmc382the screening procedure for the primer sequence is described below.
First, preliminary screening of specific primer sequence
1. SSR primer selection: the SSR primers are 800 pairs of Simple Sequence Repeat (SSR) primers covering 21 wheat chromosomes, and comprise SSR primer series of WMC, BARC, CFD and GWM; primer sequence information was consulted at the GrainGene2.0 (http:// at. pw. usda. gov.); the related primer sequences are all synthesized and provided by Takara biological engineering (Dalian) Co.Ltd;
2. DNA extraction, PCR amplification and electrophoresis of the amplified product: the method comprises the following steps of carrying out primary screening of primers by taking wheat variety Huai wheat 33 and parents thereof, namely Yannong 19 and Zheng wheat 991 as detection materials:
(1) respectively extracting DNA from any organs or tissues of the Huai-mai 33 wheat and the wheat variety to be detected by adopting a CTAB method;
(2) taking the DNAs of the Huai wheat 33 extracted in the step (1) and the wheat variety to be detected as templates, and taking the DNAs asbarc45 Andwmc382respectively carrying out PCR amplification for the primer sequences; the 12.5 muL PCR amplification reaction system is set as follows: 2 muL of DNA template extracted in the step (1), 0.08 muL of Taq DNA polymerase (5U/muL), and 10 xbuffer (containing Tri)s-HCl 100 mM、KCl 500 mM、MgCl 215 mM) 1.25 muL, dNTPs (10 mM) 0.25 muL, ultrapure water 6.92 muL, and a primer pairbarc45 Andwmc3821 muL of each of the upstream sequence and the downstream sequence is counted by 10 mumol/L; PCR amplification procedure (Touchdown PCR): pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; renaturation at 62 ℃ (1 ℃ per cycle) for 40 s; extension at 72 ℃ for 40s for 10 cycles; denaturation at 94 ℃ for 30 s; renaturation at 52 ℃ for 40 s; extension at 72 ℃ for 40s, 26 cycles; finally, extending for 5min at 72 ℃; storing the PCR amplification product at 4 ℃ for later use;
(3) performing electrophoresis on the PCR amplification product in the step (2): adding 2.5 muL of sample loading buffer solution to the 12.5 muL of PCR amplification product in the step (2); separating a sample of 3 mu L in non-denaturing polyacrylamide gel electrophoresis with the mass concentration of 10%, and carrying out silver staining and color development; the loading buffer comprises the following components: 0.3 mol/L sodium hydroxide, 6mM EDTA (pH8.0), 0.15% of bromophenol blue in mass fraction, and 0.25% of xylene blue in mass fraction;
(4) and (4) performing banding statistics on the sample developed in the step (3), and screening out a primer pair with the banding pattern of the PCR amplified Huai wheat 33 different from that of the parent Yannong 19 and Zheng wheat 991 according to an electrophoresis result.
The screening results show that 30 primer pairs with different banding patterns of the Huai wheat 33 and the parent Yannong 19 and Zheng wheat 991 are provided, and specifically shown in the following table, and partial preliminary electrophoretograms are shown in figure 1, figure 2, figure 3 and figure 4.
Second, secondary screening of specific primer sequences
The number of the specific primers of the 33 varieties of the Chinese yams obtained by the primary screening is relatively large, and the primers are not suitable for being directly used for the identification work of the wheat varieties, so that further screening is needed; in the secondary screening process, based on 33 standard seeds of Huai wheat (new variety right protection seeds of plants in a national germplasm resource library), 2 parents of the Huai wheat 33, 13 derived varieties (lines) of the Huai wheat 33, 17 total 33 materials of the currently main-pushed varieties in Huang-Huai-Mai region and the main-pushed varieties in part of Jiangsu Huai-Bei region, 30 pairs of primers preliminarily screened are subjected to further specific primer screening; the specific primers screened from the primer are used for detecting and verifying a new variety (line) derived from the Huai wheat 33 with similar appearance length phase to the Huai wheat 33, and a main variety of Huang-Huai and Huai-Huai with larger difference and a main variety of a part of Huai-Bei areas; the method comprises the following specific steps:
(1) wheat varieties used in the screening process: the specific wheat variety conditions are shown in the following table, wherein the number 1 is Huai wheat 33; 2 and 3 are the parents and parents of Huai Mai 33; 4-16 are derived varieties (lines) of Huai wheat 33; 17-30 is a main-pushed variety in Huang-Huai-Mai district; 31-33 are partial main-pushing varieties in the northern area of Huaihe river, Su;
(2) performing DNA extraction, PCR amplification and electrophoresis of amplified samples on wheat genomes and performing primary screening; during screening, the derived varieties (lines) of the Huai mai 33, which have long and similar appearances to the Huai mai 33, are screened, because the derived lines inherit part of genes of the Huai mai 33, and part of the varieties (lines) are very similar to standard seeds of the Huai mai 33 in phenotypic characters like the Huai mai 4046 and the Huai mai 08147, and an experienced expert is needed for phenotypic identification; specific primers screened from derived varieties (lines) are used for detecting and verifying main pushed varieties in Huang-Huai-Mai areas with larger popularization areas in current production and main pushed varieties in part of Jiangsu-Huaibei areas; the material No. 4-16 is derived from the generation of Huai Mai 33, the Huai Mai 33 is inbarc45The locus is only consistent with the banding patterns of Huai Mai 4046 and Huai Mai 08147; in thatwmc382The locus is only consistent with the Huai Mai 508 banding pattern; 17-30 are main-tui varieties of Huang-Huai-Mai district, and Huai-Mai 33 has a different banding pattern from the main-tui varieties at the above two sites, so as to preliminarily determine the primer markersbarc45Andwmc382the kit can be used as a specific marker of the Huai-mai 33, and can effectively identify the truth of the Huai-mai 33 wheat variety by combining the amplification results of the two pairs of SSR markers.
In conclusion, the final specific primers for the target are combinedbarc45Andwmc382the electrophoresis alignment chart (as shown in FIG. 5 and FIG. 6) shows that the SSR markerbarc45Andwmc382has better effectCan be used for screening and identifying the Huai-mai 33 wheat variety.
Claims (3)
1. The method for identifying the Huai-33 wheat variety is characterized by comprising the following steps of: by utilizing an SSR marking technology, 800 pairs of SSR primers distributed on 21 wheat chromosomes are screened, and the fact that the primer of barc45 has better specificity for the 33 varieties of Huai wheat is confirmed and is used for identifying the 33 varieties of Huai wheat; the identification method comprises the following steps:
(1) extracting DNA from any organ or tissue of the Huai 33 wheat variety and the wheat variety to be detected respectively by adopting a CTAB method;
(2) respectively carrying out PCR amplification by taking the DNAs of the Huai wheat 33 variety extracted in the step (1) and the wheat variety to be detected as templates and the barc45 as primer sequences; the forward primer sequence of barc45 is from 5'- > 3': gcgaccacctcagccaacttattatgt, the reverse primer sequence of barc45 is from 5'- > 3': gcggggaggcacattcataggagt, respectively;
(3) carrying out electrophoresis on the PCR amplification product obtained in the step (2), and developing after the electrophoresis is finished;
(4) performing band type statistics on the developed sample obtained in the step (3), and comparing and judging: if the electrophoresis result of the PCR amplification sample of the wheat variety to be detected is consistent with the banding pattern of the PCR amplification sample of the Huai-mai 33 wheat variety, the wheat variety to be detected is the Huai-mai 33; if the difference is not consistent, the variety of the wheat to be detected is non-Huai wheat 33;
wherein in the step (2), the 12.5 muL PCR amplification reaction system is set as follows: 2 muL, 5U/muL Taq DNA polymerase 0.08 muL of the DNA template extracted in the step (1) and containing Tris-HCl 100 mM, KCl 500 mM and MgCl21.25 muL of 15 mM 10 Xbuffer, 0.25 muL of 10 mM dNTPs0.25 muL of ultrapure water, 6.92 muL of primer barc45 counted in 10 mumol/L, and 1 muL of each of the upstream sequence and the downstream sequence; the PCR amplification procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; renaturation at 62 ℃ for 40 s; extension at 72 ℃ for 40s for 10 cycles; denaturation at 94 ℃ for 30 s; renaturation at 52 ℃ for 40 s; extension at 72 ℃ for 40s, 26 cycles; finally, extending for 5min at 72 ℃; the PCR amplification product is stored at 4 ℃ for later use.
2. The method of identifying a Huai 33 wheat variety of claim 1, wherein: in the step (3), a loading buffer solution is added before electrophoresis, and the components of the loading buffer solution are as follows: 0.3 mol/L sodium hydroxide, 6mM EDTA with the pH value of 8.0, 0.15 percent of bromophenol blue in mass fraction and 0.25 percent of xylene cyan in mass fraction.
3. The method of identifying a Huai 33 wheat variety of claim 1, wherein: in the step (3), the gel electrophoresis analysis specifically comprises: adding 2.5 muL of sample loading buffer solution into a 12.5 muL PCR amplification reaction system; a sample is taken and subjected to 3 muL electrophoresis, the constant voltage of 200V electrophoresis is carried out for 100 minutes on non-denatured polyacrylamide gel with the mass concentration of 10%, and silver staining is carried out for color development.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340926.9A CN107119129B (en) | 2017-05-16 | 2017-05-16 | Method for identifying Huai 33 wheat variety |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340926.9A CN107119129B (en) | 2017-05-16 | 2017-05-16 | Method for identifying Huai 33 wheat variety |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107119129A CN107119129A (en) | 2017-09-01 |
| CN107119129B true CN107119129B (en) | 2021-02-09 |
Family
ID=59727691
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710340926.9A Active CN107119129B (en) | 2017-05-16 | 2017-05-16 | Method for identifying Huai 33 wheat variety |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107119129B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113817859B (en) * | 2021-08-24 | 2023-10-13 | 江汉大学 | MNP (MNP) marking site for wheat variety identification, primer composition, kit and application of MNP marking site |
| US12081639B1 (en) * | 2023-05-17 | 2024-09-03 | Pathogenomix, Inc. | Systems and methods for pre-processing string data for network transmission |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4114887B1 (en) * | 2007-03-27 | 2008-07-09 | 独立行政法人農業・食品産業技術総合研究機構 | Wheat variety identification method |
| CN104774968B (en) * | 2015-05-08 | 2017-06-20 | 周口市农业科学院 | A kind of No. 22 methods of wheat breed of all wheats of identification |
-
2017
- 2017-05-16 CN CN201710340926.9A patent/CN107119129B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107119129A (en) | 2017-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Domestication footprints anchor genomic regions of agronomic importance in soybeans | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| Bharathi | Phenotypic and genotypic diversity of global finger millet (Eleusine coracana (L.) Gaertn.) composite collection | |
| CN113832243B (en) | Core SNP marker for tea tree variety identification based on KASP technology development | |
| CN111235302B (en) | Method for identifying authenticity of Chinese cabbage variety and special SSR primer combination thereof | |
| CN103045588A (en) | Molecular marker of major QTL (Quantitative Trait Locus) of soybean seed protein content and application thereof | |
| CN107012217B (en) | SNP molecular markers for distinguishing bred sesame varieties in China | |
| CN107119129B (en) | Method for identifying Huai 33 wheat variety | |
| CN112195264A (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of tomato hybrid and application | |
| CN106591460B (en) | Method for identifying variety of 'Zhongcha 302' tea tree by SSR molecular marker and application | |
| CN110551844A (en) | Sugarcane cultivar genome SSR molecular marker development method and application | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| CN104818326B (en) | A kind of SNP marker relevant to Erhualian sow litter trait | |
| CN110540987A (en) | Design and detection method of new functional marker of rice low temperature resistance gene COLD1 | |
| CN116240207A (en) | Primer group for identifying Sanhua plums and early plums and application thereof | |
| Kyaligonza et al. | Identification of F1 cassava (Manihot esculenta Crantz) progeny using microsatellite markers and capillary electrophoresis | |
| CN111235301B (en) | Method for identifying authenticity of bitter gourd varieties and special SSR primer combination thereof | |
| CN114231651A (en) | Radish whole genome SSR core primer combination suitable for SSR-Seq technology and application thereof | |
| CN108570517B (en) | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer | |
| CN114381544A (en) | Watermelon leaf etiolation lethal major gene, dCAPS molecular marker for identifying major gene and application | |
| CN109536633B (en) | SNP (Single nucleotide polymorphism) marker co-separated from corn gray spot resistant major QTL-qRgls2 and application | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| Xiao-Xia et al. | Development of SSR markers linked to low hydrocyanic acid content in sorghum-sudan grass hybrid based on BSA method | |
| CN106701952B (en) | Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |