CN104774968B - A kind of No. 22 methods of wheat breed of all wheats of identification - Google Patents
A kind of No. 22 methods of wheat breed of all wheats of identification Download PDFInfo
- Publication number
- CN104774968B CN104774968B CN201510231299.6A CN201510231299A CN104774968B CN 104774968 B CN104774968 B CN 104774968B CN 201510231299 A CN201510231299 A CN 201510231299A CN 104774968 B CN104774968 B CN 104774968B
- Authority
- CN
- China
- Prior art keywords
- wheats
- wheat
- pcr amplification
- electrophoresis
- methods
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to Wheat Germplasm Resources cultivar identification technical field, and in particular to a kind of identification week No. 22 methods of wheat breed of wheat.The method include extract DNA, withXgwm577It is primer sequence, PCR amplifications, electrophoresis, colour developing, banding pattern are counted, contrast the steps such as judgement.The present invention utilizes SSR technologies, is screened by 340 SSR primers on 21 chromosomes of wheat, confirmsXgwm577Primer sequence is directed to No. 22 wheat breeds of all wheats has preferably specificity, can be used for No. 22 detections of kind of all wheats, identification.In general; the technology of the present invention is ripe; quickly, the easy, degree of accuracy is higher; can more convenient, effectively identify No. 22 kinds of all wheats; New species right in plant is conducive to protect, new varieties are promoted, germ plasm resource is utilized, while also being used for reference for the utilization and extention of other wheat breeds and protection provide preferably application.
Description
Technical field
The invention belongs to Wheat Germplasm Resources cultivar identification technical field, and in particular to one kind identification No. 22 wheat product of all wheats
The method planted.
Background technology
Wheat is one of most important cereal crops of China, and Annual planting area is more stable, is floated downward on 3.6 hundred million mu throughout the year
It is dynamic, year 9000000000 jin or so of demand wheat breeding.With the emergence and the raising of seed commercial level of improved Varieties, I
State's wheat breed changes increasingly faster, and peasant buys breeding rate and also improving constantly every year, annual demand wheat breeding about 5,000,000,000
Jin, and kind of rate is changed in continuous improvement.The presence of commercial value causes many enterprises for managing corn hybrid seed to start to manage small
Wheat breeding, causes enterprise to weigh keen competition to wheat breed, and the enterprise without kind power is to gain high profits, and infringement personation is existing
As spreading unchecked, vacation is packed, arbitrarily changes the phenomenons such as kind name commercially generally existing, and personation seed of poor quality hinders agriculture evil agriculture phenomenon
Repeatedly occur, have a strong impact on peasant's purchase breeding, also invaded the legitimate rights and interests of breeding man, contained the dynamic of breeding man innovation
The healthy and rapid development of industry is planted by power, influence China.It is protection new variety of wheat power, vaild evidence is provided to right-safeguarding work of cracking down on the fake,
Urgently need the cultivar identification method of accurate, quick, easy stabilization.
Carried out by the phenotypic evaluation veteran expert of needs of the proterties such as seed, seedling and plant, and often deposited
The time it is more long, be easily affected by human factors the problems such as, law court be difficult use；Using phenol decoration method, NaOH determination method
Often exist by the restriction such as seed development degree, environmental condition etc. chemical identification method, identify that the different kind degrees of accuracy are not high；
The protein labelings such as the acid polyacrylamide electrophoresis using alcohol soluble protein identification wheat breed authenticity often exist band compared with
It is many, by planting environment conditionality, between the kind nearer to affiliation identification have bigger difficulty；Again because of Wheat volatiles
It is relatively large and 80% be all repetitive sequence, carry out single kind genome sequencing exist technical sophistication, it is time-consuming it is more long, survey
The problems such as sequence expense is more, basic unit's breeding units and Seed enterprises cannot often be carried out.Above technical characterstic is determined and is directed to
Wheat Cultivars are often difficult to using unified authentication method.
In the prior art, molecular labeling（Including RAPD, RFLP, SSR and RGAP）Technology is in the research of Wheat volatiles
It is widely applied.Wherein SSR technologies have the advantages that codominance, polymorphism high, easy detection and re-examination are good, and into
This is low, is a kind of ideal molecule labelling method, at present oneself be widely used in population genetic variations and analysis of genetic diversity,
The comparing and identification of affiliation, the evolution of species and phylogenetic study, build gene linkage collection of illustrative plates and carry out functional gene and determine
The aspect such as position and qtl analysis.Therefore, according to molecular marking technique feature, if it is possible to filter out this using molecular marking technique
1 for wheat breed or several special primers, and these primers are capable of the genotype information of the actual response kind, thus
It is used for the appraisal of wheat breed using the specific primer for the wheat breed.In addition in view of SSR technologies
Accurately, quickly, easy, stabilization the features such as, use the method to provide effective card for the right-safeguarding work of cracking down on the fake of specific wheat breed
According to beneficial to the protection of related kind and other work development.It is emphasized that because wheat belongs to self pollination crop, and tool
There is special region, in the different propagable Approved variety limited amounts in ecotope, breediness is fixed, this is again this side
Method improves accuracy in certain species identification, thus is with preferable application effect and practical significance.
The content of the invention
It is an object of the present invention to provide the authentication method that a kind of utilization SSR technologies are directed to wheat breed week wheat No. 22, the method
Using the specific primer that can preferably express winter-wheat in Huang-Huai wheat production zones kindXgwm577, can be all wheats No. 22 using the primer
The fast and accurately detection of wheat breed, identification are provided and preferably ensured.
The main technical schemes that the present invention is taken are as follows.
A kind of No. 22 methods of wheat breed of all wheats of identification, comprise the following steps：
（1）Using single grain DNA extraction methods, DNA is extracted to No. 22 wheats of all wheats and wheat seed to be measured respectively；
（2）With step（1）No. 22 wheats of all wheats of middle extraction and the DNA of wheat seed to be measured are template, withXgwm577For
Primer sequence, enters performing PCR amplification respectively；
It is describedXgwm577For primer sequence is：
Upstream sequence, ATGGCATAATTTGGTGAAATTG；
Downstream sequence, TGTTTCAAGCCCAACTTCTATT；
15 μ L pcr amplification reactions systems set as follows：
2 × Taq PCR Mix (containing the U/ μ L of Taq enzyme 0.1, the mmol/L of dNTPs 500 μm ol/L, Tris-HCl 20,
KCl 100 mmol/L、MgCl23 mmol/L) 7.5 μ L,
PrimerXgwm577（10 µmol/L）, each 1 μ L of upstream sequence, downstream sequence,
Step（1）The DNA profiling of extraction, 1.5 μ L,
The μ L of ultra-pure water 4；
PCR amplification programs：94 DEG C of min of predegeneration 5；94 DEG C of denaturation 1 min, 55 DEG C of 1 min of annealing, 72 DEG C extend 1
Min, 35 circulations；72 DEG C of 7 min of extension；Pcr amplification product is placed in 4 DEG C and saves backup；
（3）To step（2）Middle pcr amplification product carries out electrophoresis, before electrophoresis, indicator is added, with step（2）In 15 μ L
As a example by pcr amplification product, 3 μ L denaturation loading indicator is added；After 94 DEG C of denaturation 10min, it is immediately placed in cold in mixture of ice and water
But 10min；Then the μ L of sample 6.5 after treatment are taken to be separated by electrophoresis in the denaturing polyacrylamide gel that mass concentration is 6%,
Silver staining develops the color；
It is described denaturation loading indicator component be：98% without formamide, 10mM EDTA（pH8.0）, 0.1% bromophenol blue
It is blue or green with 0.1% dimethylbenzene；
（4）To step（3）Sample carries out banding pattern statistics after colour developing, and contrast judges, if the PCR amplifications of wheat seed to be measured
The PCR amplification sample result banding patterns of No. 22 wheats of sample electrophoresis result and all wheats are consistent, show that wheat seed to be measured is all wheats 22
Number kind, if it is inconsistent, showing wheat seed to be measured No. 22 kinds of non-all wheats.
The present invention utilizes SSR technologies, is screened by 340 SSR primers on 21 chromosomes of wheat, confirmsXgwm577Primer sequence is directed to No. 22 wheat breeds of all wheats has preferably specificity, can be used for No. 22 inspections of kind of all wheats
Survey, identify.In general, the technology of the present invention is ripe, and quick, the easy, degree of accuracy is higher, being capable of more convenient, effective identification
Go out No. 22 kinds of all wheats, be conducive to New species right in plant protection, new varieties popularization, germ plasm resource to utilize, while also for other are small
The utilization and extention of wheat variety and protection provide preferably application and use for reference.
Brief description of the drawings
Fig. 1 is undressed part primer electrophoretogram during first screening specific primer；Wherein, the 1st swimming lane is
All wheats No. 12, the 2nd swimming lane is Wenmai 6, and the 3rd swimming lane is all wheats No. 13, and the 4th swimming lane is all wheats No. 22；
Fig. 2 is undressed part primer electrophoretogram during first screening specific primer；Wherein the 1st swimming lane is week
Wheat No. 12, the 2nd swimming lane is Wenmai 6, and the 3rd swimming lane is all wheats No. 13, and the 4th swimming lane is all wheats No. 22；
Fig. 3 is undressed part primer electrophoretogram during first screening specific primer；Wherein the 1st swimming lane is week
Wheat No. 12, the 2nd swimming lane is Wenmai 6, and the 3rd swimming lane is all wheats No. 13, and the 4th swimming lane is all wheats No. 22；
Fig. 4 be postsearch screening during be directed to special primerXgwm577Electrophoresis comparison diagram, wherein from left to right distinguishing
It is：Marker；A1：All wheats No. 22；A2-A5：No. 22 Sister Lines of all wheats；B1-B17：No. 22 derived varieties of all wheats；C1-C4：Field
No. 22 similar varieties of proterties and all wheats, C5-C18：Promote mainly kind in Yellow River-Huai River region；C19：All wheats No. 22；Marker.
Specific embodiment
With reference to embodiment the present invention will be further explained explanation, before specifically introducing embodiment, to institute of the present invention
The part wheat breed source and main application reagent being related to are briefly discussed below.
No. 22 wheat breeds of all wheats and other wheat materials to be tested provided by wheat research institute of academy of agricultural sciences of Zhoukou City or by
The regular channel in market is bought；
Xgwm577And other primer sequences are provided by the synthesis of Shanghai life work biology Co., Ltd；
2 × Taq PCR Mix are purchased from Beijing Hui Tian east Science and Technology Ltd.；
PCR is reacted in BIO-RAD S1000- PCR instruments（Bio Rad Laboratories）Upper operation.
Embodiment
Because difficult point of the invention and key point are for No. 22 specific primer sequences of wheat breed of all wheatsXgwm577Screening obtain, therefore the present embodiment is briefly discussed below for the screening process of the primer sequence.
First, the preliminary screening of specific primer sequence
Preliminary screening process comprises the following steps：
1st, SSR Primer selections
SSR primers are from covering 21 the 340 of chromosome pairs of simple repeated sequences of wheat（simple sequence
Repeat, SSR）Primer, including BARC, CFA, CFD, GDM, the SSR primers and CWM, KSUM, CWEM, SWES of WMC series, and
The EST-SSR primers of CNL series.Primer sequence information is in GrainGenes2.0 (http://wheat.pw.usda.gov/)
Consult and obtain.
Relevant primer sequence is provided by the synthesis of Shanghai life work biology Co., Ltd.
2nd, the electrophoresis of DNA extractions, PCR amplifications and amplified production
With all wheats No. 22 and its parent week wheat No. 12, Wenmai 6, No. 13 preliminary sieves that primer is carried out for detection material of all wheats
Choosing, comprises the following steps that：
（1）Using single grain DNA extraction methods, respectively to the wheat seed extraction DNA of each kind；
（2）With step（1）The DNA of the wheat seed of middle extraction is template, is respectively primer with the SSR primers in step 1
Sequence, enters performing PCR amplification respectively；
15 μ L pcr amplification reactions systems set as follows：
2 × Taq PCR Mix (containing the U/ μ L of Taq enzyme 0.1, the mmol/L of dNTPs 500 μm ol/L, Tris-HCl 20,
KCl 100 mmol/L、MgCl23 mmol/L) 7.5 μ L,
Primer（10 µmol/L）, each 1 μ L of upstream sequence, downstream sequence,
Step（1）The DNA profiling of extraction, 1.5 μ L,
The μ L of ultra-pure water 4；
PCR amplification programs：94 DEG C of min of predegeneration 5；94 DEG C of denaturation 1 min, 55 DEG C of 1 min of annealing, 72 DEG C extend 1
Min, 35 circulations；72 DEG C of 7 min of extension；Pcr amplification product is placed in 4 DEG C and saves backup；
（3）Electrophoresis, before electrophoresis, adds indicator, with step（2）In as a example by 15 μ L pcr amplification products, add 3 μ L denaturation
Loading indicator；After 94 DEG C of denaturation 10min, it is immediately placed in mixture of ice and water and cools down 10min；Then the sample after treatment is taken
6.5 μ L are separated by electrophoresis in the denaturing polyacrylamide gel that mass concentration is 6%, silver staining colour developing；
It is described denaturation loading indicator component be：98% without formamide, 10mM EDTA pH8.0,0.1% bromophenol blue and
0.1% dimethylbenzene is blue or green；
（4）To step（3）Sample carries out banding pattern statistics after colour developing, finally according to electrophoresis result, filters out the week of PCR amplifications
The banding pattern that wheat is No. 22 and its parent week wheat No. 12, No. 13 primer pairs for differing of Wenmai 6 and all wheats.
The selection result shows that the banding pattern that all wheats are No. 22 is differed with its parent week wheat No. 12, Wenmai 6 and all wheats No. 13
Primer pair have 28, shown in table specific as follows, partial preliminary electrophoretogram as shown in Figure 1, Figure 2 and Figure 3.
2nd, the postsearch screening of specific primer sequence
The specific primer quantity of No. 22 kinds of all wheats obtained by due to preliminary screening is relatively more, thus is not appropriate for
It is directly used in identification, the screening operation of wheat breed, therefore further screening of still needing.
During postsearch screening, inventor is with the standard seed of all wheats No. 22（National germplasm resource bank New species right in plant
Protection seed）And its 5 Sister Lines, the derivative new varieties of all wheats No. 22（System）17 strains 4 and mesh similar to all wheats 22
Kind 14 is promoted mainly based on totally 41 parts of materials in preceding Yellow River-Huai River region, and preliminary screening 28 pairs of primers out have been carried out further
Specific primer is screened.It is briefly discussed below.
The special primer for therefrom filtering out is again to new varieties derived from all wheats No. 22（B group materials）, and outward appearance appearance with
Kind is promoted mainly in No. 22 similar varieties of all wheats or the Yellow River-Huai River region for differing greatly（C group materials）Carry out detection checking.
（1）Wheat breed used in screening process
Specific wheat breed situation used is as shown in the table, wherein 5 Sister Lines are labeled as A group materials（A2~A6）, it is derivative
New varieties are labeled as B group materials（B1~B17）, outward appearance appearance is similar to all wheats No. 22 or product are promoted mainly in Yellow River-Huai River region that differ greatly
Plant and be labeled as C group materials（C1~C18）.
（2）Wheat volatiles DNA is extracted, PCR expands and expand the same preliminary screening of electrophoresis method of sample.
During screening, first to all wheats No. 22（A1）And see the extremely similar Sister Lines of appearance to the extra of all wheats 22（A group materials）
Screened, because Sister Lines are closely similar with No. 22 standard seeds of all wheats on phenotypic character, general breeding man is not easy to
Tell truth from falsehood, generally requiring veteran expert can just carry out phenotypic evaluation, and existence time is more long, easily receive human factor
The problems such as influence.Therefore, certain wheat breed specific mark is filtered out in Sister Lines just very important meaning.
The special primer filtered out from Sister Lines is again to No. 22 derivative new varieties of all wheats（B group materials）, and outward appearance is long
Kind is promoted mainly with No. 22 Yellow River-Huai River regions for differing greatly of all wheats（C group materials）Carry out detection checking.
B group materials are the derivative offsprings of all wheats No. 22, be with all wheats No. 22 as parent, therefore, B group materials are only inherited
The part inhereditary material of all wheats No. 22, while being recombinated with the part inhereditary material of another or multiple parent.To it
When detecting checking, if it is Genomic-SRR to filter out mark（Simple repeated sequence）, then to select in derivative offspring with all wheats
No. 22 different marks；If it is EST-SSR to filter out mark（EST）, then after derivation in generation, it is possible to meeting
Have and No. 22 identicals of all wheats.The filtered out specific mark type of this invention is exactly Genomic-SRR, in its derivative offspring
In will select the mark differed with No. 22 electrophoresis banding patterns of all wheats as its specific mark.
C group descriptions of materials are at present in the kind of Yellow River-Huai River region spread, their phenotypic character and all wheats No. 22
Differ greatly, it is that phenotypic evaluation can also be identified for which kind, from terms of hereditary angle, the larger kind of general phenotypic difference, its
Inhereditary material difference is also larger.Therefore, all wheats No. 22 are all different from any one kind of C group materials, also with regard to preliminary judgement
Primer markXgwm577Can be as the specific mark of all wheats No. 22, the true and false for detecting all wheats No. 22.
In sum, with reference to final for special primerXgwm577Electrophoresis comparison diagram（As shown in Figure 4）, can see
Go out, primerXgwm577With preferable specificity, Screening and Identification week No. 22 wheat breeds of wheat are suitable for use in.
Claims (4)
1. it is a kind of to identify No. 22 methods of wheat breed of all wheats, it is characterised in that the method is comprised the following steps：
（1）Using single grain DNA extraction methods, DNA is extracted to No. 22 wheats of all wheats and wheat seed to be measured respectively；
（2）With step（1）No. 22 wheats of all wheats of middle extraction and the DNA of wheat seed to be measured are template, withXgwm577It is primer
Sequence, enters performing PCR amplification respectively；
It is describedXgwm577Primer sequence is：
Upstream sequence, ATGGCATAATTTGGTGAAATTG；
Downstream sequence, TGTTTCAAGCCCAACTTCTATT；
（3）To step（2）Gained pcr amplification product carries out electrophoresis, before electrophoresis, adds indicator, electrophoresis to be developed the color after terminating；
（4）To step（3）Sample carries out banding pattern statistics after gained colour developing, and contrast judges, if the PCR amplifications of wheat seed to be measured
The PCR amplification sample result banding patterns of No. 22 wheats of sample electrophoresis result and all wheats are consistent, show that wheat seed to be measured is all wheats 22
Number kind；If it is inconsistent, showing wheat seed to be measured No. 22 kinds of non-all wheats.
2. No. 22 methods of wheat breed of all wheats are identified as claimed in claim 1, it is characterised in that step（2）Middle PCR amplifications are anti-
Should set as follows：
15 μ L pcr amplification reactions systems set as follows：
The μ L of 2 × Taq PCR Mix 7.5, wherein including：The U/ μ L of Taq enzyme 0.1, dNTPs 500 μm ol/L, Tris-HCl
20 mmol/L、KCl 100 mmol/L、MgCl23 mmol/L；
PrimerXgwm577In terms of 10 μm of ol/L, each 1 μ L of upstream sequence, downstream sequence,
Step（1）The DNA profiling of extraction, 1.5 μ L,
The μ L of ultra-pure water 4；
PCR amplification programs：94 DEG C of min of predegeneration 5；94 DEG C of denaturation 1 min, 55 DEG C of 1 min of annealing, 72 DEG C extend 1 min, 35
Individual circulation；72 DEG C of 7 min of extension；Pcr amplification product is placed in 4 DEG C and saves backup.
3. No. 22 methods of wheat breed of all wheats are identified as claimed in claim 1, it is characterised in that step（3）Described in indicate
Agent is denaturation loading indicator, and the denaturation loading indicator component is：98% without formamide, 10mM EDTA pH8.0,
0.1% bromophenol blue and 0.1% dimethylbenzene are blue or green.
4. No. 22 methods of wheat breed of all wheats are identified as claimed in claim 3, it is characterised in that the step（3）Specially：
Take step（2）The μ L pcr amplification products of gained 15, add 3 μ L denaturation loading indicator；After 94 DEG C of denaturation 10min, it is immediately placed in
10min is cooled down in mixture of ice and water；Then the μ L of sample 6.5 after treatment are taken solidifying in the denaturing polyacrylamide that mass concentration is 6%
It is separated by electrophoresis in glue, silver staining colour developing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510231299.6A CN104774968B (en) | 2015-05-08 | 2015-05-08 | A kind of No. 22 methods of wheat breed of all wheats of identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510231299.6A CN104774968B (en) | 2015-05-08 | 2015-05-08 | A kind of No. 22 methods of wheat breed of all wheats of identification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104774968A CN104774968A (en) | 2015-07-15 |
| CN104774968B true CN104774968B (en) | 2017-06-20 |
Family
ID=53616732
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510231299.6A Expired - Fee Related CN104774968B (en) | 2015-05-08 | 2015-05-08 | A kind of No. 22 methods of wheat breed of all wheats of identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774968B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107119129B (en) * | 2017-05-16 | 2021-02-09 | 江苏徐淮地区淮阴农业科学研究所 | Method for identifying Huai 33 wheat variety |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302564B (en) * | 2008-05-27 | 2011-02-09 | 周口市农业科学院 | Primer sequence for screening wheat brown leaf rust-resistance and use thereof |
| CN101760513A (en) * | 2008-11-19 | 2010-06-30 | 李祥 | Chromosome mapping and molecule marking research on powdery mildew resisting gene of Elytrigia intermedium |
-
2015
- 2015-05-08 CN CN201510231299.6A patent/CN104774968B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104774968A (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sandhu et al. | Positive interactions of major-effect QTLs with genetic background that enhances rice yield under drought | |
| Li et al. | Comparative mapping of quantitative trait loci associated with waterlogging tolerance in barley (Hordeum vulgare L.) | |
| Lu et al. | Efficient indica and japonica rice identification based on the InDel molecular method: Its implication in rice breeding and evolutionary research | |
| Lee et al. | Molecular evolution of the rice blast resistance gene Pi-ta in invasive weedy rice in the USA | |
| Xie et al. | Genetic maps of SSR and SRAP markers in diploid orchardgrass (Dactylis glomerata L.) using the pseudo-testcross strategy | |
| CN104532359A (en) | Core SNP sites combination maizeSNP384 for building of maize DNA fingerprint database and molecular identification of varieties | |
| CN105087768B (en) | A kind of method of the anti-bean weevil kind of molecular marking supplementary breeding mung bean | |
| Chang et al. | Genome-wide single nucleotide polymorphism discovery and the construction of a high-density genetic map for melon (Cucumis melo L.) using genotyping-by-sequencing | |
| CN112877453B (en) | Method for identifying authenticity of pepper variety | |
| CN107815507A (en) | For detecting SNP marker and the application of rice brown planthopper resistant Bph14 genes | |
| CN102242219B (en) | Method and pair of special primers for identifying purple properties of Chinese cabbages | |
| CN103045588A (en) | Molecular marker of major QTL (Quantitative Trait Locus) of soybean seed protein content and application thereof | |
| CN106350584A (en) | Primer set and method for identifying variety authentication and seed purity of tomatoes | |
| CN113322345A (en) | Molecular marker co-separated from watermelon peel grain covering gene ClGS and application | |
| Lin et al. | Development of a sequence-specific PCR marker linked to the gene “pauper” conferring low-alkaloids in white lupin (Lupinus albus L.) for marker assisted selection | |
| CN106520762A (en) | Molecular marks closely linked to glomerella leaf spot resistant genetic loci of apple and application | |
| Giancarla et al. | The use of RAPD and ISSR markers for genetic diversity among some barley cultivars | |
| Gu et al. | Development, identification and utilization of introgression lines using Chinese endemic and synthetic wheat as donors | |
| CN106591460A (en) | Method for identifying variety of 'Chinese Tea 302' tea tree by adopting SSR molecular marker and applications of SSR molecular marker | |
| WO2017088144A1 (en) | Snp combination for analyzing diversity of chinese cabbage germplasm resource and for molecular breeding, and use thereof | |
| CN105039335A (en) | Molecular maker for barley grain protein content main effect QTL (quantitative trait locus..) and application of molecular marker | |
| CN105063201B (en) | The molecular labeling of corn Chromosome 9 tassel row number main effect QTL and its application | |
| CN104774968B (en) | A kind of No. 22 methods of wheat breed of all wheats of identification | |
| CN107119129B (en) | Method for identifying Huai 33 wheat variety | |
| CN114480721B (en) | Method for identifying whether melon variety to be detected is thin-skin melon or thick-skin melon and special SNP primer combination thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170620 Termination date: 20190508 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |