CN106701952B - Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker - Google Patents
Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker Download PDFInfo
- Publication number
- CN106701952B CN106701952B CN201710004003.6A CN201710004003A CN106701952B CN 106701952 B CN106701952 B CN 106701952B CN 201710004003 A CN201710004003 A CN 201710004003A CN 106701952 B CN106701952 B CN 106701952B
- Authority
- CN
- China
- Prior art keywords
- seq
- cabbage
- gene
- common head
- chinese cabbage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 244000178937 Brassica oleracea var. capitata Species 0.000 title claims abstract description 123
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 117
- 230000005945 translocation Effects 0.000 title claims abstract description 71
- 239000003550 marker Substances 0.000 title claims abstract description 43
- 238000000034 method Methods 0.000 title claims abstract description 24
- 238000011161 development Methods 0.000 title claims abstract description 7
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 claims abstract description 95
- 235000000536 Brassica rapa subsp pekinensis Nutrition 0.000 claims abstract description 95
- 241000499436 Brassica rapa subsp. pekinensis Species 0.000 claims abstract description 95
- 230000003321 amplification Effects 0.000 claims abstract description 70
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 70
- 240000007124 Brassica oleracea Species 0.000 claims abstract description 29
- 238000012408 PCR amplification Methods 0.000 claims abstract description 25
- 239000012634 fragment Substances 0.000 claims abstract description 16
- 235000011303 Brassica alboglabra Nutrition 0.000 claims abstract 2
- 235000011302 Brassica oleracea Nutrition 0.000 claims abstract 2
- 235000003899 Brassica oleracea var acephala Nutrition 0.000 claims description 27
- 235000011301 Brassica oleracea var capitata Nutrition 0.000 claims description 27
- 235000001169 Brassica oleracea var oleracea Nutrition 0.000 claims description 27
- 210000000349 chromosome Anatomy 0.000 claims description 18
- 230000002068 genetic effect Effects 0.000 claims description 9
- 238000006243 chemical reaction Methods 0.000 claims description 8
- 241000427033 Stomolophus meleagris Species 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 5
- 235000011331 Brassica Nutrition 0.000 claims description 3
- 241000219198 Brassica Species 0.000 claims description 3
- 239000000872 buffer Substances 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 238000003752 polymerase chain reaction Methods 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 238000004321 preservation Methods 0.000 claims description 3
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 108090000790 Enzymes Proteins 0.000 claims 1
- 102000004190 Enzymes Human genes 0.000 claims 1
- 238000002372 labelling Methods 0.000 claims 1
- 238000013461 design Methods 0.000 abstract description 4
- 108020004414 DNA Proteins 0.000 description 118
- 238000000246 agarose gel electrophoresis Methods 0.000 description 14
- 238000001514 detection method Methods 0.000 description 7
- 241000894007 species Species 0.000 description 6
- 238000009395 breeding Methods 0.000 description 5
- 230000001488 breeding effect Effects 0.000 description 5
- 238000001962 electrophoresis Methods 0.000 description 5
- 238000012216 screening Methods 0.000 description 5
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 238000011160 research Methods 0.000 description 3
- 230000015572 biosynthetic process Effects 0.000 description 2
- 238000005034 decoration Methods 0.000 description 2
- 230000003993 interaction Effects 0.000 description 2
- 239000012160 loading buffer Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 101150090724 3 gene Proteins 0.000 description 1
- 101150047313 52 gene Proteins 0.000 description 1
- 241000219193 Brassicaceae Species 0.000 description 1
- 108091092878 Microsatellite Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 239000011449 brick Substances 0.000 description 1
- 239000010432 diamond Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000010195 expression analysis Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000009871 nonspecific binding Effects 0.000 description 1
- 238000013081 phylogenetic analysis Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000009331 sowing Methods 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a method for identifying a Chinese cabbage-common head cabbage translocation line based on a collinear gene development marker, which comprises the following steps: a) determining a gene fragment segment of the Brassica oleracea in the translocation line; obtaining all gene sequences of the gene fragment segment and the flanking region of the common head cabbage and the corresponding colinear gene sequence in the Chinese cabbage, and designing a primer covering a differential site region according to the differential site of the gene sequences; b) performing PCR amplification on the translocation line parent Chinese cabbage and the parent common head cabbage by using the primers, and determining the specific gene marker of the common head cabbage relative to the Chinese cabbage according to the amplification result; c) and performing PCR amplification on the translocation line parent Chinese cabbage, the parent common head cabbage and the translocation line selfing progeny by using the gene marker, and obtaining the identification result of the translocation line according to the amplification result. The invention designs the primer based on the difference site of the colinear gene sequence of the Chinese cabbage and the common head cabbage, increases the difference of the amplification efficiency and can directly identify the introduction of the exogenous gene.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a method for identifying a Chinese cabbage-common head cabbage translocation line based on a collinear gene development marker.
Background
The translocation line is a new type formed after the exchange of a section of chromosome of a certain species (donor) and a corresponding chromosome segment of another species (acceptor), is a means for improving and breeding crops, can improve the resistance of the crops, increase the yield of the crops and improve the quality of the crops, and has very important significance in the aspect of crop breeding. In the process of introducing the target gene into the translocation line, the transferred gene and the chromosome segment thereof are tracked and identified in the receptor background, so that the accuracy of selection can be improved, the breeding period can be shortened, and the breeding efficiency can be improved. Therefore, it is important to accurately identify the foreign chromosome fragment introduced into the translocation line.
Molecular markers (Molecular markers), genetic markers based on nucleotide sequence (DNA) variations in the genetic material between individuals, are very valuable tools in genotypic determination, genetic diversity analysis, exogenous fragment identification, marker-assisted breeding, phylogenetic analysis, and other studies. The methods currently used to identify foreign fragments of translocation lines are mainly SSR markers (Simple sequence repeat markers) and InDel markers (Insert/delete markers). However, the SSR marker has a low polymorphism ratio between the Chinese cabbage and the cabbage, and cannot be used for identifying the introduction of the exogenous cabbage segment in the genetic background of the Chinese cabbage, and although the InDel marker has great advantages in the identification of the Chinese cabbage-common head cabbage translocation line, the InDel marker cannot identify the precise position of the specifically introduced exogenous gene and the segment in the Chinese cabbage chromosome and whether the gene of interest can be stably inherited, which brings difficulty for the research on the expression and interaction of the exogenous gene in the translocation line.
Disclosure of Invention
In view of the above, the present invention provides a method for identifying a Chinese cabbage-common head cabbage translocation line based on a collinear gene development marker, which can identify the precise positions of specific introduced foreign genes and fragments in the Chinese cabbage-common head cabbage translocation line, and whether a gene of interest can be stably inherited.
The invention aims to develop a relatively specific gene marker based on a cabbage and cabbage colinear gene difference sequence, provides a new method for species identification of the Chinese cabbage and the common head cabbage and accurate identification of the Chinese cabbage-common head cabbage translocation line, and lays a foundation for expression and function research of an exogenous cabbage gene under the genetic background of the Chinese cabbage and improvement of the genetic background of the Chinese cabbage by using the cabbage gene.
The basic principle of the invention is as follows: the Chinese cabbage and the common head cabbage belong to the same genus Brassica of Brassicaceae and are sequenced, and the sequence-based blast finds that the two gene groups have higher homology and a plurality of chromosome colinear sections exist. The invention designs a primer aiming at the difference site of the colinear gene sequence of Chinese cabbage and common head cabbage, PCR amplification is carried out by taking the Chinese cabbage, the common head cabbage and translocation line genome DNA thereof as a template, the difference of the difference site causes the difference of the combination efficiency of the primer, thereby influencing the PCR amplification efficiency, the agarose gel electrophoresis detection shows the difference of the existence, the intensity or the position of a PCR product among test materials, if the amplification result of a certain gene marker in the translocation line is only consistent with that of the Chinese cabbage, the invention shows that the gene is not introduced into the alien addition line, if the amplification product of the certain gene marker in the translocation line is only consistent with that of the common head cabbage or is simultaneously consistent with the Chinese cabbage and the common head cabbage, the invention shows that the gene is introduced into the translocation line.
The invention is characterized in that: designing a primer based on the difference site of the colinear gene sequence of the Chinese cabbage and the common head cabbage, increasing the difference of amplification efficiency, improving the polymorphism of the primer, and being used for identifying the species of the Chinese cabbage and the common head cabbage; the marker primer is designed in the gene, so that the introduction of the exogenous gene can be directly identified; the ratio of the colinearity gene in the Chinese cabbage and the common head cabbage is higher, so that a high-density gene marker can be developed, and the size of the exogenous chromosome segment can be identified more accurately.
The invention provides a method for developing a specific marker and identifying a Chinese cabbage-common head cabbage translocation line based on a colinearity gene, which comprises the following steps:
a) determining a gene segment section of the cabbage in the Chinese cabbage-cabbage translocation line;
obtaining all gene sequences of the gene fragment segment and the flanking region of the common head cabbage and the corresponding colinear gene sequence in the Chinese cabbage, and designing a primer covering a differential site region according to the differential site of the gene sequences;
b) performing PCR amplification on a translocation line parent Chinese cabbage and a parent common head cabbage respectively by using the designed primers, and determining a gene marker of the common head cabbage specific to the Chinese cabbage according to an amplification result, wherein the gene marker meets the following conditions: the common head cabbage has amplification products, but the Chinese cabbage does not have the amplification products; or both of them have amplification products, but the positions of the amplification bands are different;
c) and respectively carrying out PCR amplification on the translocation line parent Chinese cabbage, the parent common head cabbage and the translocation line selfing progeny by using the gene markers, and obtaining the identification result of the translocation line according to the amplification result.
Specifically, the present invention can determine the gene segment of the cabbage in the Chinese cabbage-common cabbage translocation line by using the InDel marking method, and then perform the subsequent operation based on the gene segment.
The method specifically comprises the following steps:
(1) gene marker primer design and synthesis
Searching and downloading a common linear gene sequence of the common head cabbage and the Chinese cabbage by using data information of a Chinese cabbage genome website (http:// branched. org/branched), designing a primer aiming at a difference site through the sequence, and synthesizing the common head cabbage and the Chinese cabbage by Shanghai bioengineering technology Limited company.
(2) Polymorphic primer screening
Extracting genome DNA of the Chinese cabbage and the common head cabbage by adopting an improved CTAB method, carrying out PCR amplification by using the designed gene primer by using the genome DNA as a template, and detecting an amplification result by adopting agarose gel electrophoresis to determine the availability and polymorphism of the designed gene primer.
(3) Determination of specific gene markers of common head cabbage relative to Chinese cabbage
According to the agarose gel electrophoresis detection result, the polymorphism conditions of the designed primers in the genomes of the celery cabbage '85-1' and the common head cabbage '11-1' are counted, and the primers which do not have the amplification products in the '85-1' and have the amplification products in the '11-1' or have the amplification products in the '85-1' and the '11-1' but have the amplification products at different positions in the cabbage from the celery cabbage are selected as the genetic marker primers of the common head cabbage specific to the celery cabbage.
(4) Identification of Chinese cabbage-common head cabbage translocation line
The specific gene marker of the cabbage-head cabbage determined by screening is utilized, the translocation line selfing progeny is used as a template for PCR amplification, agarose gel electrophoresis is used for detecting the amplification result, the size of the translocation segment of the cabbage-head cabbage translocation line and the genetic condition of the translocation segment in the progeny are revealed, and the cabbage-head cabbage translocation line is identified.
(5) Universality verification of polymorphism markers in genome identification of Chinese cabbages and common head cabbages
The polymorphism gene markers between the screened and determined Chinese cabbage '85-1' and the common head cabbage '11-1' are utilized, the genome DNA of 4 Chinese cabbage varieties and 4 common head cabbage varieties is used as a template for PCR amplification, the agarose gel electrophoresis is used for detecting the amplification result, and the practicability of the developed gene markers is verified.
Specifically, the detailed description of the invention is as follows:
(1) identifying the position of the preliminarily determined exogenous fragment on the common head cabbage chromosome according to the InDel marker, searching the position of the chromosome of the common head cabbage and all genes flanking the chromosome from a Chinese cabbage genome website (http:// branched. org/branch /) by using a Search tool, downloading the nucleotide sequence of the common head cabbage colinear gene and the corresponding Chinese cabbage colinear gene, comparing the nucleotide sequence difference sites of the colinear gene by using DNAMEN software, designing a primer by using primer 5.0 software, covering the difference sites by using the primer, wherein the designed primer is synthesized by Shanghai bioengineering technology, Inc.
(2) Sowing and raising seedlings of two diploid parent Chinese cabbage '85-1' and common head cabbage '11-1' material seeds of a translocation line, cutting fresh tender leaves when the seedlings grow to 3-4 true leaves, extracting genome DNA by adopting an improved CTAB method, carrying out PCR amplification by taking the genome DNA of '85-1' and '11-1' as templates, wherein the total PCR reaction system is 20 mu L and contains 10 multiplied PCR Buffer (containing Mg)2+) Mu.l, 1.6. mu.l of 2.5mmol/L dNTPs, 0.2. mu.l of 1U Taqase, 1. mu.l of 50 ng/mu LForward primer, 1. mu.l of 50 ng/mu LReverse primer, 1. mu.l of 50 ng/mu.l template DNA, and 13.2. mu.l of sterile double distilled water; the PCR amplification procedure was: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 3s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1.5min, 35 cycles in total, extension at 72 ℃ for 10min, and heat preservation at 4 ℃. The annealing temperature was slightly adjusted according to the difference of primers. The PCR amplification product is detected by 1.2% agarose gel electrophoresis under the conditions of 5V/cm constant pressure, 1 XTBE electrophoresis buffer, 5 mu LPCR product sample loading amount and 1 Xbromophenol blue sample loading buffer, and the electrophoresis time is about 40 min.
(3) According to the agarose gel electrophoresis detection result, the amplification conditions of the designed primers in the Chinese cabbage '85-1' and the common head cabbage '11-1' are respectively counted, the amplification conditions comprise the frequency of the occurrence of no amplification product of the primers, no polymorphism of the primers, the occurrence of polymorphism of the primers, and the like, and the primers which have no amplification product in the '85-1' and have the amplification product in the '11-1' or the occurrence of the amplification product in the primers and have the amplification product in the cabbage are determined to be different from the position of the Chinese cabbage and serve as the gene marker primers of the common head cabbage specific to the Chinese cabbage.
(4) And (3) preparing a seed seedling of a selfed progeny of the Chinese cabbage-common head cabbage translocation line to be tested according to the step (2), extracting genome DNA of the seed seedling, performing PCR amplification according to the PCR reaction system and the reaction program in the step (2) by using the screened and determined gene marker of the common head cabbage relative to the Chinese cabbage, detecting an amplification result by adopting agarose gel electrophoresis, identifying the Chinese cabbage-common head cabbage translocation line, and revealing the size of a translocation fragment of the Chinese cabbage-common head cabbage translocation line and the genetic condition of the translocation fragment in the progeny.
(5) And (3) preparing 4 parts of Chinese cabbage seeds and 4 parts of common head cabbage seeds to be tested according to the step (2), extracting genome DNA of the seedlings, carrying out PCR amplification by using the polymorphism primers between the screened Chinese cabbage '85-1' and the screened common head cabbage '11-1' as a template according to the PCR reaction system and the reaction program in the step (2), detecting an amplification result by adopting agarose gel electrophoresis, and verifying the practicability of the developed gene marker in the aspect of identifying the species of the Chinese cabbage and the common head cabbage.
Through the method, 50 groups of common head cabbages are obtained, and the gene markers are specific to the Chinese cabbages and are shown as SEQID No. 1-100: BoC 03-4: forward primer AGCAGTCCCACAAAGAATAA (SEQ ID No.1), reverse primer CATCACCTCCTCTGAAACCT (SEQ ID No. 2); BoC 03-5: forward primer TTGTTGTGGTTGGAGGAGTT (SEQ ID No.3), reverse primer ATCGTCAGGCTCATCATTTT (SEQ ID No. 4); BoC 03-9: forward primer AGTGGTGGCGGAGAAGGTCA (SEQ ID No.5), reverse primer CAGAGGCAGAGTCATTGGAT (SEQ ID No. 6); BoC 03-12: forward primer CCGCAGACCAAATCAACACT (SEQ ID No.7), reverse primer GCTGTAGACGGAGTTAGCCAC (SEQ ID No. 8); BoC 03-16: forward primer TAATCCATTCGCCTATCCTC (SEQ ID No.9), reverse primer ATTCCCTACCCATTCTACAC (SEQ ID No. 10); BoC 03-19: forward primer AGAAATGGGTTGGATGTTGG (SEQ ID No.11), reverse primer GTCTTCCCTCCTTGTGCTGA (SEQ ID No. 12); BoC 03-21: forward primer GGCTCGCTACACTATGCT (SEQ ID No.13), reverse primer AACCTCCACTTACAACCT (SEQ ID No. 14); BoC 03-24: forward primer TCCTCCTGGTGGTCGTCTCC (SEQ ID No.15), reverse primer GCCTTCTTCCATTGAGTGCC (SEQ ID No. 16); BoC 03-25: forward primer GTTGTGGTTATGTCGGAAGG (SEQ ID No.17), reverse primer AAAGATTAGCCATCAAGTCG (SEQ ID No. 18); BoC 03-27: forward primer GGTGGAGGTTACATCGGTCTT (SEQ ID No.19), reverse primer TGATTCCTTTGTTGGCGTAG (SEQ ID No. 20); BoC 03-28: forward primer AGTCACTAAACGCAAAGGAG (SEQ ID No.21), reverse primer CTCGGTCACTTGGTCATACA (SEQ ID No. 22); BoC 03-29: forward primer CCCCTTTCCTAATGGTTCGT (SEQ ID No.23), reverse primer CAATGGCTTGACATGGTTCT (SEQ ID No. 24); BoC 03-30: forward primer CGCAGGCATCATTCCAAAGC (SEQ ID No.25), reverse primer GCGTATCGGCAGGCGTGTAT (SEQ ID No. 26); BoC 03-35: forward primer CAGAGTGAGATTGGAGGAAC (SEQ ID No.27), reverse primer TCATCTACATCCCTTCACAT (SEQ ID No. 28); BoC 03-38: forward primer TACCGTCAGAGGATGAGCAG (SEQ ID No.29), reverse primer GCAGTTCCCATCTCCTTCTA (SEQ ID No. 30); BoC 03-40: forward primer CGTCCACAGTCTCCTATTCC (SEQ ID No.31), reverse primer GAAACCTCCTGCTGCTAAAT (SEQ ID No. 32); BoC 03-41: forward primer CACGGAGAAAGGCTACTGGA (SEQ ID No.33), reverse primer GGAAGGCTGCTGGTGTAAAA (SEQ ID No. 34); BoC 03-45: forward primer CTTGGGTTTGATGATTATGTC (SEQ ID No.35), reverse primer GTGAGTGATTTCTTCAGGGTA (SEQ ID No. 36); BoC 03-46: forward primer CTTGGGTTTGATGATTATGTC (SEQ ID No.37), reverse primer TATTCTTCACTGTCTAAGGAGC (SEQ ID No. 38); BoC 03-48: forward primer GGTAGTCGGTAACCTATTCCAGT (SEQ ID No.39), reverse primer TGCGTCAGCGAGAAATAAGT (SEQ ID No. 40); BoC 03-49: forward primer GAATCAGCCCTTTCCACATC (SEQ ID No.41), reverse primer ACAATCTCAGGTTTCCCACA (SEQ ID No. 42); BoC 03-52: forward primer ACCACCCAATGTTATCAGGC (SEQ ID No.43), reverse primer CTACAATGGCAAGCAGACCC (SEQ ID No. 44); BoC 03-54: forward primer ACGGGTCGCCATTATTAGAG (SEQ ID No.45), reverse primer GAGCGTTAGTAGAAGTCATAGCAG (SEQ ID No. 46); BoC 03-56: forward primer GACCTTTGTTTCGGACTA (SEQ ID No.47), reverse primer AATCTGCTGGAATCGTAT (SEQ ID No. 48); BoC 03-66: forward primer GGGGCAGGTTGAACATAA (SEQ ID No.49), reverse primer AAGAGCAAACTCGGCATT (SEQ ID No. 50); BoC 03-67: forward primer CTTGAGACCTTATCCCTTTC (SEQ ID No.51), reverse primer ATATCCCAATACTCGCTGTA (SEQ ID No. 52); BoC03-68, forward primer GGTGAGGCTTCTTACCATTA (SEQ ID No.53), reverse primer TGCGGTGAGTTTATCTGTCT (SEQ ID No. 54); BoC 03-69: forward primer GGAAAGGGAAGAAGGAGCCG (SEQ ID No.55), reverse primer GCGAGCGTCGTTGAAGTTGT (SEQ ID No. 56); BoC 03-75: forward primer GGGAAGAGTATGGCGGTGGA (SEQ ID No.57), reverse primer AGAGGCGTGGCTTGGTCAGT (SEQ ID No. 58); BoC 03-87: forward primer CAATGGAAGTGACATCGGAGGA (SEQ ID No.59), reverse primer TCGGTTGTTGGAGCCTTGTT (SEQ ID No. 60); BoC 03-88: forward primer ACTTCAGGGCTTTCAGACAC (SEQ ID No.61), reverse primer TTCCAGTAGCGAACATAACA (SEQ ID No. 62); BoC 03-91: forward primer CGGCGATTGTTCTGTTCTGG (SEQ ID No.63), reverse primer CTGAAACGGTAACGCAAACG (SEQ ID No. 64); BoC 03-92: forward primer ACTTCAGGGCTTTCAGACAC (SEQ ID No.65), reverse primer TTCCAGTAGCGAACATAACA (SEQ ID No. 66); BoC 03-105: forward primer CTCCACCGCCGAGGAAAGTC (SEQ ID No.67), reverse primer TCCACCACCAAACCGCAACG (SEQ ID No. 68); BoC 03-107: forward primer AACTAACGGTAGCAGACATTG (SEQ ID No.69), reverse primer AGAGGACCAGACACTTGACG (SEQ ID No. 70); BoC 03-111: forward primer AACAAGGAGCAACTGGAACT (SEQ ID No.71), reverse primer GGAAGGGAAGGACATAGGAG (SEQ ID No. 72); BoC 03-113: forward primer GAAGATGAATGGGCTTGTGA (SEQ ID No.73), reverse primer AAGGGAGTGTTTGTGGATGG (SEQ ID No. 74); BoC 03-114: forward primer TGGTTGGGTGATTTAGGGTA (SEQ ID No.75), reverse primer CGGGTAGATAAGTAGGGACA (SEQ ID No. 76); BoC 03-118: forward primer TTTTGCTTATGTGGCGAGAA (SEQ ID No.77), reverse primer AGCCGTATGTTGTGGAATGGAG (SEQ ID No. 78); BoC 03-120: forward primer TCCGTCAACACTCTACTCCC (SEQ ID No.79), reverse primer AAGGCAATCCGAGATAGAAC (SEQ ID No. 80); BoC 03-121: forward primer TATCTAGCTTCATCGTCCAA (SEQ ID No.81), reverse primer CTCTACCGTCTAAGTCCCAC (SEQ ID No. 82); BoC 03-122: forward primer GTTGCTACGCTCTTGCTGTC (SEQ ID No.83), reverse primer ACTGAACTCGCTCTTCTTGG (SEQ ID No. 84); BoC 03-123: forward primer CTGGCATTCTCGCTGCTGTC (SEQ ID No.85), reverse primer CTCGCTATCCGTCGCCTTCG (SEQ ID No. 86); BoC 03-124: forward primer GATGCGGAGGATTACTTGAA (SEQ ID No.87), reverse primer CGTGGCGTTGTGATTGTCTT (SEQ ID No. 88); BoC 03-125: forward primer GCTCGCCTTCTAAAGCACAA (SEQ ID No.89), reverse primer CCAAGGAGTGGCAGTAGTCG (SEQ ID No. 90); BoC 03-127: forward primer TGAGTATCGCCTCGCTAATG (SEQ ID No.91), reverse primer GTAGATTCGGCATAACACCC (SEQ ID No. 92); BoC 03-134: forward primer GTCCGTAGGGAATCTGAACC (SEQ ID No.93), reverse primer TCTCACTGCTCCACGAAACC (SEQ ID No. 94); BoC 03-137: forward primer GATCATATCCAAATCGGTAC (SEQ ID No.95), reverse primer CCAATACAAATACATTCCCT (SEQ ID No. 96); BrA 03-17: forward primer TTTTGTTCTGTGACTCGTGCCG (SEQ ID No.97), reverse primer GCCGCTTGGTTAGTGTCCTG (SEQ ID No. 98); BrA 03-26: a forward primer GAAGCGATACAGAAGCAGAG (SEQ ID No.99), and a reverse primer CAAGATTGGAAGATGGGTAA (SEQ ID No. 100).
The invention also provides a method for identifying the species of the Chinese cabbage and the common head cabbage, which comprises the following steps:
a) determining a gene segment section of the cabbage in the Chinese cabbage-cabbage translocation line;
obtaining all gene sequences of the gene fragment segment and the flanking region of the common head cabbage and the corresponding colinear gene sequence in the Chinese cabbage, and designing a primer covering a differential site region according to the differential site of the gene sequences;
b) the primers are utilized to carry out PCR amplification on the translocation line parent Chinese cabbage and the parent common head cabbage respectively, and polymorphism primers are determined according to the amplification result, wherein the polymorphism primer screening standard is as follows: different amplification results exist in the Chinese cabbage and the common head cabbage, and the amplification results show that the amplification bands exist or are different in position;
c) and performing PCR amplification on the Chinese cabbage or the common head cabbage by using the polymorphic primer, and determining the variety of the Chinese cabbage or the common head cabbage according to the amplification result.
The procedure for obtaining polymorphic primers is identical to that described above, except that the screening criteria are different, as described above.
After the polymorphic primers are obtained by screening, extracting the genomic DNA of the Chinese cabbages and the common head cabbages of different varieties, taking the genomic DNA as a template, carrying out PCR amplification by utilizing the polymorphic primers, and detecting the amplification result by adopting agarose gel electrophoresis. And identifying the Chinese cabbage and the common head cabbage according to the electrophoresis detection result, and determining the applicability of the gene marker.
The invention has the following technical effects and advantages:
1) the gene specific primers are designed by utilizing the colinear gene difference site of the Chinese cabbage and the common head cabbage, so that the non-specific binding amplification of the primers at other positions of a genome is avoided or reduced, and a molecular technical support is provided for inter-species identification of the Chinese cabbage and the common head cabbage.
2) The primers are designed based on the internal loci of the genes, and the difference result can accurately identify the introduction of the target gene, thereby laying the foundation for directly researching the expression analysis of the exogenous gene in a translocation line and the interaction influence with a receptor background.
3) The genome sequence comparison result shows that a very high proportion of collinear genes exist between the Chinese cabbage and the cabbage, so that a higher-density gene specific marker can be developed and used for accurately identifying the translocation fragment of the Chinese cabbage-common head cabbage translocation line.
Drawings
FIG. 1 shows the amplification results of partial primers in the genomes of Chinese cabbage '85-1' and common head cabbage '11-1';
FIG. 2 shows the amplification results of partial primers in the selfed progeny of Chinese cabbage-common head cabbage translocation line 'AT 1-47';
FIG. 3 shows the amplification results of partial primers in 4 varieties of Chinese cabbage and 4 varieties of common head cabbage.
Detailed Description
The method for identifying a brassica rapa-head cabbage translocation line according to the present invention is described in detail below with reference to examples.
Example 1
The present invention will be described with reference to an example of a gene marker developed by introducing an exogenous chromosome fragment into a Chinese cabbage-common head cabbage translocation line "AT 1-47".
The Chinese cabbage-common head cabbage translocation line 'AT 1-47' is obtained by identifying the selfing progeny of the Chinese cabbage-common head cabbage No.1 diplodial heteroepisome by using 9 specific InDel markers of the common head cabbage C03 chromosome and combining a cytology method, and contains an exogenous segment of 154444bp to 1814490bp of the common head cabbage C03 chromosome upstream according to InDel marker information. The InDel marker information is shown in Table 1.
TABLE 1 selection of InDel marker information for Chinese cabbage-common head cabbage C03 chromosome translocation line
(1) Design and Synthesis of Gene-tagged primers
Combining with sequencing data of the Chinese cabbage and the common head cabbage, searching all genes of the common head cabbage chromosome segment 154444-1814490 bp and the flanking 20kb thereof and the corresponding common head cabbage A03 chromosome colinear gene from a Chinese cabbage genome website (http:// branched. org/branch /) by using a Search tool, downloading the nucleotide sequences thereof, and downloading 263 common head cabbage genes and 254 common head cabbage genes, wherein the 9 common head cabbage genes do not have the colinear gene in the genome of the Chinese cabbage. The nucleotide sequence difference sites of the colinear genes are compared by using DNAMEN, the difference sites are searched, primers are designed by using Primemir 5.0 software, the primers cover the difference sites, and specific primer 171 pairs (table 2) are successfully designed together, wherein 140 pairs of primers are designed based on the common head cabbage gene sequence (beginning with BoC 03), and 31 pairs of primers are designed based on the Chinese cabbage gene sequence (beginning with BrA 03). The designed primer is synthesized by Shanghai bioengineering technology, Inc.
Genes for primer numbers and reference sequences designed in Table 2
(2) PCR amplification of primers
(3) Polymorphism primer and determination of cabbage head relative to Chinese cabbage specific gene mark
According to the detection result of agarose gel electrophoresis on PCR products, the amplification results of the designed gene primers in the genomes of the Chinese cabbage '85-1' and the common head cabbage '11-1' are represented as 5 types, see FIG. 1, FIG. 1 is the amplification result of a part of primers in the genomes of the parent Chinese cabbage and the common head cabbage, and in FIG. 1, M: marker DL 2000; 1: chinese cabbage '85-1'; 2: common head cabbage '11-1'.
A-C, no amplification product, A, BoC 03-7; b, BoC 03-13; c, BoC 03-110; D-E, '85-1' specific amplification, D, BrC 03-9; e, BrC 03-19; f, BrC 03-29;
G-I, '11-1' specific amplification, G, BoC 03-120; h, BoC 03-114; i, BoC 03-107; J-L, amplified without polymorphism, J, BrC 03-5; k, BoC 03-8; l, BrC 03-19;
M-O, '85-1' and '11-1' amplified bands differ in position, M, BoC 03-124; n, BrC 03-26; o, BoC 03-24; P-R, '11-1' amplification intensity is greater than '85-1', P, BoC 03-65; q, BoC 03-79; r, BoC 03-82.
The 5 types are: the parent Chinese cabbage and the common head cabbage have no amplification result (indicated by 0); ② the parent Chinese cabbage has amplification result (indicated by 1) and the common head cabbage has no amplification result (indicated by 0); ③ the parent Chinese cabbage has no amplification result (indicated by 0) and the common head cabbage has amplification result (indicated by 2); fourthly, the parent Chinese cabbage and the common head cabbage have amplification results, and the positions and the intensities of the amplification bands are basically the same (both are indicated as 1); the parent Chinese cabbage and the common head cabbage have amplification results and different amplification band positions (respectively represented by 1 and 2); sixthly, the parent Chinese cabbage and the common head cabbage have amplification results, and the amplification bands are identical in position and different in strength. Wherein, the primer expressed in the third five is determined to be a primer with polymorphism between the Chinese cabbage and the common head cabbage.
The results of PCR amplification and product detection show that among 171 designed primers, 66 primers showed polymorphism between cabbage '85-1' and common head cabbage '11-1', wherein 48 primers were designed based on the cabbage gene sequence and 18 primers were designed based on the cabbage gene, and the ratio of the polymorphic primers to the total primers was 38.60% (Table 3); moreover, 48 pairs of primers showing polymorphism were designed based on the cabbage gene sequence, 43 pairs showed specific amplification in the head cabbage and no amplification in the head cabbage, and 5 pairs showed different amplification band positions in the head cabbage and the head cabbage; 18 pairs of primers showing polymorphism are designed based on the gene sequence of the Chinese cabbage, 16 pairs show specific amplification in the Chinese cabbage but no amplification in the common head cabbage, and 2 pairs show different amplification band positions in the Chinese cabbage and the common head cabbage. And determining 50 pairs of primers which are respectively designed based on the common head cabbage gene sequence, 48 pairs of primers which are designed based on the Chinese cabbage gene sequence and are amplified in the common head cabbage and the Chinese cabbage but have different positions as the specific gene markers of the common head cabbage relative to the Chinese cabbage.
TABLE 3 Gene-specific primer sequences and basic information
(4) Identification of Chinese cabbage-common head cabbage translocation line
Extracting 30 self-bred progeny genomic DNAs of the translocation line by adopting an improved CTAB method, and carrying out PCR amplification by using the genomic DNAs as templates and 50 relatively specific gene primers for the common head cabbage according to the PCR reaction system and the reaction program. The agarose gel electrophoresis detection result shows that 50 test markers show polymorphism consistent with the C03 chromosome specific InDel marker in self-bred offspring, and the homozygous translocation and the heterozygous translocation in the self-bred offspring can be identified according to the existence and the heterozygous condition of the amplified bands. Research results show that development of cabbage specific gene markers based on cabbage and cabbage colinear genes can provide technical support for accurate identification of a Chinese cabbage-common head cabbage translocation line.
Fig. 2 is the amplification result of a partial primer in a translocation line genome, and in fig. 2, M: marker DL 2000; 1: chinese cabbage '85-1'; 2: selfing progeny of common head cabbage '11-1', 3-32 and translocation line 'AT 1-47'; a, identifying the translocation line progeny population by BoC 03-3; b, identification of progeny of the translocation line by BoC 03-9.
(5) General verification of polymorphism markers of Chinese cabbage and common head cabbage
In order to verify the universality of the developed polymorphic gene marker between the Chinese cabbage and the common head cabbage species and provide technical support for identification between the Chinese cabbage and the common head cabbage species, 4 Chinese cabbage commercial varieties (respectively ' Shandong No.6 ', ' Tengzhou Chinese cabbage ', ' Beijing New No. three ' and ' oil green No.) and 4 common head cabbage commercial varieties (respectively ' Zhongganundecan ', ' Shengshijingang ', ' Yubao ' and ' Green Diamond 55 ') are selected, a seed seedling of a material to be tested is prepared according to the step (2) and genome DNA of the seed seedling is extracted, the obtained 66 is used for carrying out PCR amplification on the polymorphic primer, and the reaction system and the reaction program are the same and are detected by agarose gel electrophoresis. The result shows that the total 52 gene markers can identify 4 Chinese cabbages and 4 common head cabbage varieties, the percentage of the common head cabbage varieties is 78.79 percent, and the common head cabbage varieties comprise 38 markers developed according to the common head cabbage genes and 14 markers developed according to the Chinese cabbage genes; there were 11 markers that showed specificity in only a subset of varieties. The partial marker amplification results are shown in FIG. 3, and FIG. 3 shows the amplification results of partial primers in other genomes of Chinese cabbage and common head cabbage. In fig. 3, 1: 'Shandong No. 6'; 2: 'Tengzhou cabbage'; 3: 'Beijing New No. three'; 4: 'oil green number three'; 5: 'Zhongganundecane'; 6: 'Shengshijingang'; 7: 'shoe-shaped gold ingot'; 8: 'Green brick 55'.
A, a primer BoC 03-3; b, a primer BoC 03-4; c, primer BoC 03-6; d, primer BoC 03-12; e, primer BoC 03-16; f, primer BoC 03-19; g, a primer BoC 03-24; h, primer BoC 03-27; i, primers BoC 03-38; j, primer BoC 03-41; k, primer BoC 03-41; l, primer BoC 03-46; m, primer BoC 03-49; n, primer BoC 03-54; o, primer BoC 03-65; p, primer BoC 03-67; q, primer BoC 03-72; r, primer BaA 03-1; s, primer BaA 03-4; t, primer BaA 03-6.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
SEQUENCE LISTING
<110> Applicant
<120> identification method of Chinese cabbage-common head cabbage translocation line
<130>
<160>100
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<400>1
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<400>2
<210>3
<211>20
<212>DNA
<213> Artificial sequence
<400>3
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
<210>5
<211>20
<212>DNA
<213> Artificial sequence
<400>5
<210>6
<211>20
<212>DNA
<213> Artificial sequence
<400>6
<210>7
<211>20
<212>DNA
<213> Artificial sequence
<400>7
<210>8
<211>21
<212>DNA
<213> Artificial sequence
<400>8
gctgtagacg gagttagcca c 21
<210>9
<211>20
<212>DNA
<213> Artificial sequence
<400>9
taatccattc gcctatcctc 20
<210>10
<211>20
<212>DNA
<213> Artificial sequence
<400>10
<210>11
<211>20
<212>DNA
<213> Artificial sequence
<400>11
<210>12
<211>20
<212>DNA
<213> Artificial sequence
<400>12
<210>13
<211>18
<212>DNA
<213> Artificial sequence
<400>13
<210>14
<211>18
<212>DNA
<213> Artificial sequence
<400>14
<210>15
<211>20
<212>DNA
<213> Artificial sequence
<400>15
<210>16
<211>20
<212>DNA
<213> Artificial sequence
<400>16
<210>17
<211>20
<212>DNA
<213> Artificial sequence
<400>17
<210>18
<211>20
<212>DNA
<213> Artificial sequence
<400>18
<210>19
<211>21
<212>DNA
<213> Artificial sequence
<400>19
ggtggaggtt acatcggtct t 21
<210>20
<211>20
<212>DNA
<213> Artificial sequence
<400>20
<210>21
<211>20
<212>DNA
<213> Artificial sequence
<400>21
<210>22
<211>20
<212>DNA
<213> Artificial sequence
<400>22
<210>23
<211>20
<212>DNA
<213> Artificial sequence
<400>23
<210>24
<211>20
<212>DNA
<213> Artificial sequence
<400>24
<210>25
<211>20
<212>DNA
<213> Artificial sequence
<400>25
cgcaggcatc attccaaagc 20
<210>26
<211>20
<212>DNA
<213> Artificial sequence
<400>26
<210>27
<211>20
<212>DNA
<213> Artificial sequence
<400>27
<210>28
<211>20
<212>DNA
<213> Artificial sequence
<400>28
<210>29
<211>20
<212>DNA
<213> Artificial sequence
<400>29
<210>30
<211>20
<212>DNA
<213> Artificial sequence
<400>30
<210>31
<211>20
<212>DNA
<213> Artificial sequence
<400>31
<210>32
<211>20
<212>DNA
<213> Artificial sequence
<400>32
<210>33
<211>20
<212>DNA
<213> Artificial sequence
<400>33
<210>34
<211>20
<212>DNA
<213> Artificial sequence
<400>34
<210>35
<211>21
<212>DNA
<213> Artificial sequence
<400>35
cttgggtttg atgattatgt c 21
<210>36
<211>21
<212>DNA
<213> Artificial sequence
<400>36
gtgagtgatt tcttcagggt a 21
<210>37
<211>21
<212>DNA
<213> Artificial sequence
<400>37
cttgggtttg atgattatgt c 21
<210>38
<211>22
<212>DNA
<213> Artificial sequence
<400>38
tattcttcac tgtctaagga gc 22
<210>39
<211>23
<212>DNA
<213> Artificial sequence
<400>39
ggtagtcggt aacctattcc agt 23
<210>40
<211>20
<212>DNA
<213> Artificial sequence
<400>40
<210>41
<211>20
<212>DNA
<213> Artificial sequence
<400>41
gaatcagccc tttccacatc 20
<210>42
<211>20
<212>DNA
<213> Artificial sequence
<400>42
<210>43
<211>20
<212>DNA
<213> Artificial sequence
<400>43
<210>44
<211>20
<212>DNA
<213> Artificial sequence
<400>44
<210>45
<211>20
<212>DNA
<213> Artificial sequence
<400>45
<210>46
<211>24
<212>DNA
<213> Artificial sequence
<400>46
gagcgttagt agaagtcata gcag 24
<210>47
<211>18
<212>DNA
<213> Artificial sequence
<400>47
<210>48
<211>18
<212>DNA
<213> Artificial sequence
<400>48
<210>49
<211>18
<212>DNA
<213> Artificial sequence
<400>49
<210>50
<211>18
<212>DNA
<213> Artificial sequence
<400>50
<210>51
<211>20
<212>DNA
<213> Artificial sequence
<400>51
cttgagacct tatccctttc 20
<210>52
<211>20
<212>DNA
<213> Artificial sequence
<400>52
atatcccaat actcgctgta 20
<210>53
<211>20
<212>DNA
<213> Artificial sequence
<400>53
<210>54
<211>20
<212>DNA
<213> Artificial sequence
<400>54
<210>55
<211>20
<212>DNA
<213> Artificial sequence
<400>55
<210>56
<211>20
<212>DNA
<213> Artificial sequence
<400>56
<210>57
<211>20
<212>DNA
<213> Artificial sequence
<400>57
<210>58
<211>20
<212>DNA
<213> Artificial sequence
<400>58
<210>59
<211>22
<212>DNA
<213> Artificial sequence
<400>59
caatggaagt gacatcggag ga 22
<210>60
<211>20
<212>DNA
<213> Artificial sequence
<400>60
<210>61
<211>20
<212>DNA
<213> Artificial sequence
<400>61
<210>62
<211>20
<212>DNA
<213> Artificial sequence
<400>62
<210>63
<211>20
<212>DNA
<213> Artificial sequence
<400>63
<210>64
<211>20
<212>DNA
<213> Artificial sequence
<400>64
<210>65
<211>20
<212>DNA
<213> Artificial sequence
<400>65
<210>66
<211>20
<212>DNA
<213> Artificial sequence
<400>66
<210>67
<211>20
<212>DNA
<213> Artificial sequence
<400>67
ctccaccgcc gaggaaagtc 20
<210>68
<211>20
<212>DNA
<213> Artificial sequence
<400>68
<210>69
<211>21
<212>DNA
<213> Artificial sequence
<400>69
aactaacggt agcagacatt g 21
<210>70
<211>20
<212>DNA
<213> Artificial sequence
<400>70
<210>71
<211>20
<212>DNA
<213> Artificial sequence
<400>71
<210>72
<211>20
<212>DNA
<213> Artificial sequence
<400>72
<210>73
<211>20
<212>DNA
<213> Artificial sequence
<400>73
<210>74
<211>20
<212>DNA
<213> Artificial sequence
<400>74
<210>75
<211>20
<212>DNA
<213> Artificial sequence
<400>75
<210>76
<211>20
<212>DNA
<213> Artificial sequence
<400>76
<210>77
<211>20
<212>DNA
<213> Artificial sequence
<400>77
<210>78
<211>22
<212>DNA
<213> Artificial sequence
<400>78
agccgtatgt tgtggaatgg ag 22
<210>79
<211>20
<212>DNA
<213> Artificial sequence
<400>79
<210>80
<211>20
<212>DNA
<213> Artificial sequence
<400>80
<210>81
<211>20
<212>DNA
<213> Artificial sequence
<400>81
<210>82
<211>20
<212>DNA
<213> Artificial sequence
<400>82
ctctaccgtc taagtcccac 20
<210>83
<211>20
<212>DNA
<213> Artificial sequence
<400>83
gttgctacgc tcttgctgtc 20
<210>84
<211>20
<212>DNA
<213> Artificial sequence
<400>84
<210>85
<211>20
<212>DNA
<213> Artificial sequence
<400>85
ctggcattct cgctgctgtc 20
<210>86
<211>20
<212>DNA
<213> Artificial sequence
<400>86
<210>87
<211>20
<212>DNA
<213> Artificial sequence
<400>87
<210>88
<211>20
<212>DNA
<213> Artificial sequence
<400>88
<210>89
<211>20
<212>DNA
<213> Artificial sequence
<400>89
gctcgccttc taaagcacaa 20
<210>90
<211>20
<212>DNA
<213> Artificial sequence
<400>90
<210>91
<211>20
<212>DNA
<213> Artificial sequence
<400>91
<210>92
<211>20
<212>DNA
<213> Artificial sequence
<400>92
<210>93
<211>20
<212>DNA
<213> Artificial sequence
<400>93
<210>94
<211>20
<212>DNA
<213> Artificial sequence
<400>94
<210>95
<211>20
<212>DNA
<213> Artificial sequence
<400>95
<210>96
<211>20
<212>DNA
<213> Artificial sequence
<400>96
<210>97
<211>22
<212>DNA
<213> Artificial sequence
<400>97
ttttgttctg tgactcgtgc cg 22
<210>98
<211>20
<212>DNA
<213> Artificial sequence
<400>98
<210>99
<211>20
<212>DNA
<213> Artificial sequence
<400>99
<210>100
<211>20
<212>DNA
<213> Artificial sequence
<400>100
Claims (5)
1. A method for identifying a Chinese cabbage-common head cabbage translocation line based on a collinear gene development marker is characterized by comprising the following steps:
a) determining a gene segment section of the cabbage in the Chinese cabbage-cabbage translocation line;
obtaining all gene sequences of the gene fragment segment and the flanking region of the common head cabbage and the corresponding colinear gene sequence in the Chinese cabbage, and designing a primer covering a differential site region according to the differential site of the colinear gene sequence;
b) performing PCR amplification on a translocation line parent Chinese cabbage and a parent common head cabbage respectively by using the designed primers, and determining a gene marker of the common head cabbage specific to the Chinese cabbage according to an amplification result, wherein the gene marker meets the following conditions: the common head cabbage has amplification products but the Chinese cabbage does not have the amplification products; or both of them have amplification products, but the positions of the amplification bands are different;
c) respectively carrying out PCR amplification on the translocation line parent Chinese cabbage, the parent common head cabbage and the translocation line selfing progeny by using the gene markers, and obtaining the identification result of the translocation line according to the amplification result;
the gene fragment segment and the flanking region thereof of the common head cabbage are the region from 154444bp to 1814490bp of the chromosome upstream of the common head cabbage C03 and 20kb of the flanking region thereof;
the gene marker is selected from one or more groups of the following gene sequences: SEQ ID number 1+ SEQ ID number 2, SEQ ID number 3+ SEQ ID number 4, SEQ ID number 5+ SEQ ID number 6, SEQ ID number 7+ SEQ ID number 8, SEQ ID number 9+ SEQ ID number 10, SEQ ID number 11+ SEQ ID number 12, SEQ ID number 13+ SEQ ID No.14, SEQ ID number 15+ SEQ ID number 16, SEQ ID number 17+ SEQ ID number 18, SEQ ID number 19+ SEQ ID number 20, SEQ ID number 21+ SEQ ID number 22, SEQ ID number 23+ SEQ ID number 24, SEQ ID number 25+ SEQ ID number 26, SEQ ID number 27+ SEQ ID number 28, SEQ ID number 29+ SEQ ID number 30, SEQ ID number 31+ SEQ ID number 31, SEQ ID number 33+ SEQ ID number 34, SEQ ID No.35 + SEQ ID No.36, SEQ ID No.37 + SEQ ID No.38, SEQ ID No.39+ SEQ ID No.40, SEQ ID No.41 + SEQ ID No.42, SEQ ID No.43 + SEQ ID No.44, SEQ ID No.45 + SEQ ID No.46, SEQ ID No.47+ SEQ ID No.48, SEQ ID No.49 + SEQ ID No.50, SEQ ID No.51 + SEQ ID No.52, SEQ ID No.53 + SEQ ID No.54, SEQ ID No.55 + SEQ ID No.56, SEQ ID No.57 + SEQ ID No.58, SEQ ID No.59 + SEQ ID No.60, SEQ ID No.61+ SEQ ID No.62, SEQ ID No.63 + SEQ ID No.64, SEQ ID No.65 + SEQ ID No.68, SEQ ID No.66 + SEQ ID No.67, SEQ ID No.69+ SEQ ID No.70, SEQ ID No.71 + SEQ ID No.72, SEQ ID No.73 + SEQ ID No.74, SEQ ID No.75 + SEQ ID No.76, SEQ ID No.77 + SEQ ID No.78, SEQ ID No.79 + SEQ ID No.80, SEQ ID No.81 + SEQ ID No.82, SEQ ID No.83+ SEQ ID No.84, SEQ ID No.85 + SEQ ID No.86, SEQ ID No.87 + SEQ ID No.88, SEQ ID No.89 + SEQ ID No.90, SEQ ID No.91+ SEQ ID No.92, SEQ ID No.93 + SEQ ID No.94, SEQ ID No.95 + SEQ ID No.96, SEQ ID No.97 + SEQ ID No.98 or SEQ ID No.99 + SEQ ID No. 100.
2. The method according to claim 1, wherein in step a), the gene fragment segments of Brassica oleracea in Brassica napus-Brassica oleracea translocation line are determined by InDel labeling.
3. The method of claim 1, wherein in step b), the PCR amplification conditions are:
20 μ L of total PCR reaction system, including 10 XPCR Buffer 2 μ L, 2.5mmol/L dNTPs 1.6 μ L, 1 UTaq enzyme 0.2 μ L, 50ng/μ L forward primer 1 μ L, 50ng/μ L reverse primer 1 μ L, 50ng/μ L template DNA 1 μ L, and sterilized double distilled water 13.2 μ L;
the PCR Buffer contains Mg2+;
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 1.5min, 35 cycles in total, extension at 72 ℃ for 10min, and heat preservation at 4 ℃.
4. The gene marker for identifying the Chinese cabbage-common head cabbage translocation line is characterized by comprising the following components in parts by weight: SEQ ID number 1+ SEQ ID number 2, SEQ ID number 3+ SEQ ID number 4, SEQ ID number 5+ SEQ ID No.6, SEQ ID number 7+ SEQ ID number 8, SEQ ID number 9+ SEQ ID number 10, SEQ ID number 11+ SEQ ID number 12, SEQ ID number 13+ SEQ ID number 14, SEQ ID number 15+ SEQ ID number 16, SEQ ID No.17+ SEQ ID number 18, SEQ ID number 19+ SEQ ID number 20, SEQ ID number 21+ SEQ ID number 22, SEQ ID number 23+ SEQ ID No.24, SEQ ID number 25+ SEQ ID number 26, SEQ ID number 27+ SEQ ID No.28, SEQ ID number 29+ SEQ ID number 30, SEQ ID number 31+ SEQ ID number 32, SEQ ID number 33+ SEQ ID No.34, SEQ ID number 35+ SEQ ID number 36, SEQ ID number 37+ SEQ ID number 38, SEQ ID No.39+ SEQ ID number 40, SEQ ID number 41+ SEQ ID number 42, SEQ ID number 43+ SEQ ID number 44, SEQ ID number 45+ SEQ ID number 46, SEQ ID number 47+ SEQ ID number 48, SEQ ID number 49+ SEQ ID No.50, SEQ ID number 51+ SEQ ID number 52, SEQ ID number 53+ SEQ ID number 54, SEQ ID number 55+ SEQ ID number 56, SEQ ID number 57+ SEQ ID number 58, SEQ ID number 59+ SEQ ID No.60, SEQ ID No.61+ SEQ ID No.62, SEQ ID number 63+ SEQ ID number 64, SEQ ID number 65+ SEQ ID number 68, SEQ ID number 66 + SEQ ID No.67, SEQ ID number 69+ SEQ ID number 70, SEQ ID number 71+ SEQ ID No.72, SEQ ID number 73+ SEQ ID number 74, SEQ ID number 75+ SEQ ID number 76, SEQ ID number 77+ SEQ ID number 78, SEQ ID number 79+ SEQ ID number 80, SEQ ID number 81+ SEQ ID number 82, SEQ ID No.83+ SEQ ID number 84, SEQ ID number 85+ SEQ ID number 86, SEQ ID number 87+ SEQ ID number 88, SEQ ID number 89+ SEQ ID number 90, SEQ ID number 91+ SEQ ID number 92, SEQ ID number 93+ SEQ ID No.94, SEQ ID number 95+ SEQ ID number 96, SEQ ID number 97+ SEQ ID number 98 and SEQ ID number 99+ SEQ ID number 100.
5. Use of the genetic marker of claim 4 to identify a Chinese cabbage-head cabbage translocation line.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710004003.6A CN106701952B (en) | 2017-01-04 | 2017-01-04 | Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710004003.6A CN106701952B (en) | 2017-01-04 | 2017-01-04 | Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106701952A CN106701952A (en) | 2017-05-24 |
CN106701952B true CN106701952B (en) | 2020-11-03 |
Family
ID=58905821
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710004003.6A Expired - Fee Related CN106701952B (en) | 2017-01-04 | 2017-01-04 | Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106701952B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117431332A (en) * | 2023-09-27 | 2024-01-23 | 中国农业科学院蔬菜花卉研究所 | Molecular marker of common head cabbage leaf bulb development gene BoKAN1 and application |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101165194A (en) * | 2007-09-28 | 2008-04-23 | 中国科学院遗传与发育生物学研究所 | EST-STS marking primer 2 with differential rye1RS chromosome, screening method and use |
CN101423867A (en) * | 2008-07-03 | 2009-05-06 | 河北农业大学 | Method for identifying celery cabbage-brassica oleracea alien addition lines |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101962640B (en) * | 2010-05-04 | 2013-03-27 | 华中农业大学 | Specific molecular markers of related genes of brassica napus grain weight and application thereof |
CN104278025B (en) * | 2013-07-10 | 2017-06-20 | 华中农业大学 | Cabbage type rape full-length genome SCAR molecular labelings and preparation method and application |
CN106148334B (en) * | 2016-09-14 | 2018-08-17 | 四川省农业科学院生物技术核技术研究所 | A kind of molecular labeling primer of haynaldia villosa 3V chromosomes and application thereof and PCR method |
-
2017
- 2017-01-04 CN CN201710004003.6A patent/CN106701952B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101165194A (en) * | 2007-09-28 | 2008-04-23 | 中国科学院遗传与发育生物学研究所 | EST-STS marking primer 2 with differential rye1RS chromosome, screening method and use |
CN101423867A (en) * | 2008-07-03 | 2009-05-06 | 河北农业大学 | Method for identifying celery cabbage-brassica oleracea alien addition lines |
Also Published As
Publication number | Publication date |
---|---|
CN106701952A (en) | 2017-05-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN114231654B (en) | PARMS molecular marker associated with thousand grain weight of rape and application thereof | |
CN107988409A (en) | Differentiate Rice Salt gene OsRR22 wild types or specific C APS marks, primer and the primer purposes of mutant | |
CN107201395B (en) | Molecular marker of major gene Bph30 for resisting brown planthopper of rice and application thereof | |
CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
CN106701952B (en) | Method for identifying Chinese cabbage-common head cabbage translocation line based on collinear gene development marker | |
CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
KR101961656B1 (en) | Composition comprising InDel DNA marker derived from Gayabyeo for selecting rice variety resistant to brown planthopper and method of selecting rice variety resistant to brown planthopper using the InDel DNA marker | |
Chunwongse et al. | Development of di-nucleotide microsatellite markers and construction of genetic linkage map in mango (Mangifera indica L.). | |
CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
CN111705157B (en) | PCR marker and primer for screening I-type S haplotypes of cabbage self-incompatible line | |
CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
Karakotov et al. | Modern issues of sugar beet (Beta vulgaris L.) hybrid breeding | |
CN113832251A (en) | SNP locus combination for detecting tomato mosaic virus disease resistance and application thereof | |
CN108285928B (en) | InDel molecular marker of corn ear row number related gene GRMZM2G098557 and application | |
CN108165649B (en) | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof | |
KR100264743B1 (en) | Map QTL related to cold tolerance at seedling stage of rice using RAPD marker and selection method of cold tolerant rice variety | |
KR20090111223A (en) | A seed purity checking method for F1 hybrid of Citrullus lanatus | |
KR101735244B1 (en) | Marker for discriminating bolting time in radish and uses thereof | |
CN112094940B (en) | Indel marker linked with cucumber long hypocotyl gene lh1 as well as primer, kit and application thereof | |
CN112725515B (en) | Iris florida ground color SNP molecular marker primer composition and application thereof | |
CN113699273B (en) | SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof | |
AU2020104103A4 (en) | The InDel molecular marker of the maize ear row number related gene GRMZM2G098557 and the application thereof | |
CN111004858B (en) | Molecular marker primer of soybean single pod number major QTL (quantitative trait locus) locus and application thereof | |
CN116334300B (en) | Molecular marker closely linked with main effect QTL of wheat spike number per spike and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201103 |
|
CF01 | Termination of patent right due to non-payment of annual fee |