KR20130143458A - Rna aptamer that selectively binds to extracellular domain of pap - Google Patents

Abstract

The present invention relates to a RNA aptamer which is selectively bound to extracellular domain of PAP having high correlation with morphological characteristics of prostate cancer, to a composition for diagnosing cancers which includes the RNA aptamer, to a kit for diagnosing cancers which includes the composition, a pharmaceutical composition for treating cancers which includes the RNA aptamer, and to a method for screening DNA pieces which are interacted with the extracellular domain of PAP using the RNA aptamer. The RNA aptamer of the present invention can be strongly bound to the extracellular domain of PAP which is specific to prostate cancer so that the RNA aptamer can be widely utilized for diagnosing or treating the prostate cancer.

Description

RNA aptamer that selectively binds to the extracellular domain of PAP {RNA aptamer that selectively binds to extracellular domain of PAP}

The present invention relates to an RNA aptamer that selectively binds to the extracellular domain of PAP (Prostatic acid phosphatase). More specifically, the present invention relates to an RNA aptamer that selectively binds to the extracellular domain of PAP having a high correlation with the morphological characteristics of prostate cancer. , A cancer diagnostic kit comprising the RNA aptamer, a cancer diagnostic kit containing the composition, a pharmaceutical composition for treating cancer comprising the RNA aptamer as an active ingredient, and the RNA aptamer To a method for screening a gene fragment that interacts with the extracellular domain of PAP.

Prostate cancer, one of the most common nonpepsic cancers, occurs predominantly in elderly people over 60 years of age. In Korea, it ranked fifth in male cancer incidence in 2003-2005 and 11th in cancer death in 2006. These prostate cancers are classified into 1 to 4 stage, and 1 and 2 are localized prostate cancer localized to the prostate gland. Operative therapy such as radical prostatectomy, radiation therapy and observation therapy are mainly used. In the case of metastasis, methods for using drugs involved in the metabolism of male hormones or inhibiting growth factors have been studied and are mainly used. On the other hand, hormone refractory prostate cancer is present, but chemotherapy and transfer site radiation therapy are used.

Unlike other cancers, these prostate cancers do not have a 5-year or 2-year survival rate, but are good prognosis with a 10-year survival rate. It is known that early diagnosis increases the cure rate. It is necessary to study the early diagnosis and treatment of prostate cancer to improve the quality of life of elderly people in Korea.

Prostatic acid phosphatase (PAP) is a protein that has been used as a marker for prostate cancer since the 1940s. It is known to be expressed only in normal prostate, but it is known to increase in proportion to progression of prostate cancer when prostate cancer is developed , It has been found that PAP has a certain influence on the morphological development of prostate cancer. Thus, PAP is used as a measure of cancer-specific survival, and PAP is used as a therapeutic target for prostate cancer.

Aptamer is a small molecule oligonucleotide that binds to target molecules very closely and specifically and selectively. So oncology is a very interesting substance in terms of diagnosis and treatment. In general, protein antibodies are excellent in high affinity, specificity, and target range, but they show a decrease in imaging ability due to long blood flow in vivo and have a merit of high absorptivity of target tissue, but they have a long residual and often have a limit of blood toxicity. In addition, the antibody exhibits imperfect permeability to the target tissue. New target substances and clinical protocols are therefore required. For example, smaller antibody fragments or peptides as well as antibody primer targeting strategies are included (Boerman OC, et al. Cancer Res. 1999; 59: 4400-4405). The aptamer, an oligonucleotide ligand, is compared with specificity and affinity in a typical protein target molecule such as an antibody. The aptamer has a molecular weight of 8-15 kDa and has a peptide (1-5 kDa) (Wu AM, et al. Immunotechnology. 1996; 2: 21-36; Lister-James J, et al., QJ Nucl. : 221-233) and the antibody (150 kDa), and is smaller than the single-chain mutated fragment antibody (scFve, 25 kDa). The multivalent aptamer, aptamer, is quite different from scFve. The synthetic molecule, aptamer, supports site specific degeneration, which readily shows structure and activity. Thus, polyethylene glycol (PEG) polymers can be used in conjunction with biological binding, diagnostic and therapeutic agents. In addition, the aptamers can be pharmacodynamically modified (Watson SR, Chang YF, O'Connell D, Weigand L, Ringquist S, Parma DH. Anti-L-selectin aptamers: binding characteristics, pharmacokinetic parameters, and activity against an intravascular target in vivo. Antisense Nucleic Acid Drug Dev. 2000; 10: 6375).

Under these circumstances, the inventors of the present invention have made extensive efforts to develop a method for diagnosing or treating prostate cancer more effectively using PAP. As a result, they have developed an RNA aptamer that specifically binds to the extracellular domain of PAP, The prostate cancer can be diagnosed or treated more effectively, and the present invention has been completed.

The main object of the present invention is to provide an RNA aptamer which binds to the extracellular domain of PAP (Prostatic acid phosphatase).

Another object of the present invention is to provide a composition for diagnosing cancer comprising the RNA aptamer.

Yet another object of the present invention is to provide a cancer diagnostic kit comprising the composition.

It is still another object of the present invention to provide a pharmaceutical composition for treating cancer comprising the RNA aptamer as an active ingredient.

It is another object of the present invention to provide a method for screening a gene fragment interacting with the extracellular domain of PAP.

In one aspect, the present invention provides an RNA aptamer that binds to the extracellular domain of PAP (Prostatic acid phosphatase).

The term "PAP (Prostatic acid phosphatase) " of the present invention refers to a marker protein that is expressed in the prostate and increases in expression according to the progression of prostate cancer. The concentration of PAP is used as a measure of cancer- And is used as a therapeutic target for prostate cancer, and a DNA vaccine encoding PAP has been developed.

The term "aptamer " of the present invention means a small single-stranded oligonucleic acid capable of specifically recognizing a target substance with high affinity. In particular, "RNA aptamers" are short single-stranded oligonucleotides capable of forming a three-dimensional structure capable of binding to a target protein or cell with high affinity and specificity, and the 2'- It is preferable to be constructed so as to be resistant to RNase by substitution. In addition, most RNA aptamers can not only bind specifically to the target protein but also efficiently inhibit its function, and thus can be used to determine the function of the target protein. In the case of the present invention, it is considered to mean an RNA aptamer which binds to the extracellular domain of PAP.

The RNA aptamer of the present invention can be selected through SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method.

The term "SELEX (Systematic Evolution of Ligands by Exponential Enrichment) " of the present invention means a method of isolating a specific RNA base sequence having a specific affinity for a target protein and having a high affinity in an RNA library having about 1024 various kinds in vitro .

In a specific embodiment, the present invention provides a method for selecting an RNA aptamer comprising: (a) preparing an RNA library, which comprises cloning at both ends (5 'and 3') and restriction enzymes A 5 'primer and a 3' primer including a DNA template having a random base sequence and a T7 RNA polymerase promoter portion were prepared in the center. Next, (b) SELEX process was performed by reacting with an RNA library and a target substance (extracellular domain of PAP), and RNA aptamer binding to the extracellular domain of PAP was selected.

The SELEX method used in the present invention is a method for selecting an aptamer that specifically binds to a specific compound or protein, and specifically comprises the following steps. 1) attaching the RNA library to the surface of the protein, 2) removing molecules with weak binding force, 3) separating the RNA having strong binding force from the protein surface, 4) converting the obtained RNA molecule into DNA 5) amplify it again, and 6) recreate the DNA into RNA to obtain the selected RNA molecule. If the selected RNA molecule does not have a strong binding force to the extracellular domain of PAP, the above procedure can be repeated (FIG. 1). BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing a SELEX process used in the present invention. FIG. For purposes of the present invention, it is preferred that the RNA aptamer binding to the extracellular domain of PAP of the present invention is selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3 and 22.

5'-gggagagcggaagcgugcugggccuguguuuaagcacuguaugaugugcggcccggcuuaucguca uaaccccagaggucgauggaucccccc-3 '(SEQ ID NO: 1)

5'-gggagagcggaagcgugcugggcugugugagagccgugaguaaaaggccgcgacaaagaucggacau aacccagaggucgauggaucccccc-3 '(SEQ ID NO: 2)

5'-gggugugugagagccgugaguaaaaggccgcgacaaagaucggacauacc-3 '(SEQ ID NO: 3)

5'-gggcugugugagagccgugaguaaaaggccgcgacaaagaucggacauaacc-3 '(SEQ ID NO: 22)

The RNA aptamer of the present invention may comprise the nucleotide sequence of SEQ ID NO: 3 and the RNA aptamer of the present invention may comprise the nucleotide sequence of SEQ ID NO: . The RNA aptamer of SEQ ID NO: 3 can minimize the size of the aptamer and reduce the cost of production of the aptamer. In order to protect the RNA aptamer from the activity of the RNase, U (uracil) and C (cytosine) in the nucleotide sequence of the RNA aptamer are preferably substituted by fluorine groups in their 2'-hydroxyl groups, It does not.

In one embodiment of the present invention, the RNA selected by the SELEX method, specifically, the RNA of SEQ ID NOS: 1 to 3 selectively binds to the extracellular domain of PAP, and exhibits not only PAP expressed in E. coli, And has the ability to bind to existing PAPs.

According to another embodiment of the present invention, there is provided a cancer diagnostic composition comprising an RNA aptamer which binds to an extracellular domain of PAP which is increased upon progression of prostate cancer, and a cancer diagnostic kit comprising the composition.

Since the RNA aptamer of the present invention can bind to the extracellular domain of PAP existing in the cell membrane of cancer cells, preferably prostate cancer cells, and the PAP increases the expression level in proportion to the progress of prostate cancer, The use of the RNA aptamer to measure the level of binding to prostate cancer cells, the progression of prostate cancer, as well as the incidence of prostate cancer can be diagnosed.

In addition, the cancer diagnostic kit comprising the composition may further include an imaging agent in addition to the RNA aptamer provided in the present invention. Since the RNA aptamer of the present invention can bind to PAP expressed in mammalian prostate tissue cells, binding of the imaging agent to the RNA aptamer results in the expression level of PAP expressed in vivo in the individual suffering from prostate cancer Can be visualized in vitro, from which the expression position and expression level of PAP can be identified to diagnose prostate cancer. The imaging material may be, but is not limited to, gold nanoparticles, superparamagnetic iron oxide nanoparticles, and quantum dots. The imaging means is preferably a CT, MRI, fluorescence A microscope, a confocal microscope, or the like. More preferably, a method of binding an RNA aptamer to a gold nanoparticle, which is an imaging material for CT, and imaging the CT image using a superparamagnetic iron oxide nanoparticle and an RNA aptamer A method of photographing a T2-weighted MRI image, a method of photographing a fluorescence image using a combination of a quantum dot and an RNA aptamer, and the like may be used, but the present invention is not particularly limited thereto.

The cancer diagnostic kit of the present invention may further include a buffer solution and containers for performing and analyzing the detection, if necessary, such as a bottle, a tub, a small sachet, an envelope, a tube, an ampoule. may take the form of ampoules and the like and they may be formed, in part or in whole, from plastic, glass, paper, foil, wax, and the like. The container may be equipped with a fully or partially separable stopper that may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which is accessible to the contents by the injection needle. The kit may include an external package, and the external package may include instructions for use of the components.

According to another embodiment of the present invention, there is provided a pharmaceutical composition for treating cancer comprising the RNA aptamer binding to the extracellular domain of PAP as an active ingredient.

It is known that the expression level of PAP increases in the body in proportion to progress of prostate cancer and is used as a therapeutic target of prostate cancer. Therefore, when the above-described RNA aptamer is used to suppress the expression of PAP or inactivate its function, Can be used for the treatment of prostate cancer. At this time, in order to improve the cancer treatment effect, preferably the prostate cancer therapeutic effect, the composition may further include another known cancer therapeutic agent, preferably a known prostate cancer therapeutic agent. The known cancer therapeutic agent, which is further included, binds to the RNA aptamer and is hit by the prostate cancer tissue, thereby doubling the prostate cancer therapeutic effect.

The pharmaceutical composition for treating cancer comprising the RNA aptamer of the present invention as an active ingredient may include the RNA aptamer of the present invention in an amount of 10 to 95% by weight based on the total weight of the composition. In addition, the pharmaceutical composition for treating cancer of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the active ingredient.

The pharmaceutical composition for treating cancer of the present invention may be preferably formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile solutions suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added.

In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, A target organ specific antibody or other ligand can be used in combination with the carrier.

Pharmaceutical formulation forms of the pharmaceutical compositions for cancer treatment of the present invention are granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release formulations of the active compounds. And so on.

The pharmaceutical composition for treating cancer of the present invention can be administered to mammals including humans by various routes. For example, conventional routes are possible via intravenous, intraarterial, intraperitoneal, intramuscular, intraperitoneal, intrasternal, percutaneous, intranasal, inhalation, topical, rectal, intraoral or subcutaneous routes. At this time, the administration method is not particularly limited, but parenteral administration is preferred.

The dosage of the pharmaceutical composition for treating cancer of the present invention may include the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type of the dosage form and the age, weight, general state of health, sex and diet of the patient. It can be adjusted according to various factors including the time of administration, the route of administration and the rate of secretion of the composition, the duration of treatment, and the drugs used simultaneously. However, for the desired effect, the effective amount of the RNA aptamer of the therapeutic agent of the present invention is such that the intracellular concentration is 1 nM to 1000 nM, preferably 100 nM to 500 nM. In this case, the administration may be administered once a day, may be divided into several times.

According to another embodiment of the present invention, the present invention provides a method for screening a gene fragment that interacts with the extracellular domain of PAP.

Specifically, a method for screening a gene fragment interacting with the extracellular domain of PAP of the present invention comprises the steps of: (i) deriving a common base sequence contained in the selected RNA aptamer; (Ii) searching the derived common nucleotide sequence in a DNA / RNA database to search for a new gene fragment comprising the common sequence; And (iii) measuring the activity of the searched gene fragment to select a gene fragment that interacts with the extracellular domain of PAP.

Since the RNA aptamer of the present invention can bind strongly to the extracellular domain of prostate cancer-specific PAP, it can be widely used for the diagnosis or treatment of prostate cancer.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing a SELEX process used in the present invention. FIG.
2A is a graph showing the results of evaluating an RNA aptamer pool obtained by performing 6 SELEXs using real-time RT-PCR.
FIG. 2B is a photograph showing the results of evaluating an RNA aptamer pool obtained by performing 6 SELEXs using EMSA.
FIG. 3 is a view showing a process of selecting a sequence having binding ability to PAP among the RNA aptamers of the present invention.
FIG. 4 is a graph showing the binding degree and characteristics of the RNA aptamer clones of the present invention.
FIG. 5 is a schematic diagram showing the secondary structure of 6N, 11N full-length RNA aptamer and minimized 6N RNA aptamer of the present invention, and it was confirmed that each RNA aptamer includes hairpin structures of various sizes at various positions.
6 is a graph showing the binding of PAP of the RNA aptamer of the present invention to cancer cells expressing on the cell surface.
FIG. 7 is a diagram showing a region important for determining the minimum nucleotide sequence of the RNA aptamer of the present invention and binding to the protein.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: human PAP of Extracellular  Domain protein ( ecdPAP ) Production

Example  1-1: Protein Tablet 7

Escherichia coli (origami strain) into which pQE-80L-ecdPAP expression vector was introduced was inoculated into 5 ml of LB medium containing 50 μg / ml of ampicillin and cultured for 16 hours at 37 ° C. with stirring. 5 ml of Escherichia coli cultured for 16 hours was added to 500 ml of LB medium supplemented with 50 占 퐂 / ml of ampicillin. After incubation at 37 ° C with OD ₅₉₅ of 0.6, 0.2 mM IPTG was added and incubated at 30 ° C for 4 hours with agitation to induce the expression. 100 ml aliquots were added and centrifuged at 4000 rpm for 10 minutes The supernatant was removed and the precipitate was stored at -80 ° C for 16 hours.

The precipitate was dissolved in 10 ml of lysis buffer (50 mM NaH ₂ PO ₄ (pH 8.0), 0.3 M NaCl, 10 mM imidazole, 20 mM β-mercaptoethanol, 0.5% Sarkosyl (v / v)). ≪ / RTI > 2.5 mg / ml lysozyme was added, and the mixture was vortexed at intervals of 5 minutes and left on ice for 30 minutes. Ultrasonic treatment was performed by repeating the process of 10 seconds of ultrasonication and 10 seconds of ice for 25 times, and the final product was centrifuged at 13000 rpm at 4 ° C. 1 ml of Ni-NTA-agarose beads (Qiagen, USA) in 50% slurry was placed in a 1.5 ml tube and centrifuged at 2000 rpm for 2 minutes at 4 ° C. The supernatant was removed and 500 μl of the lysis buffer was added to dissolve the beads, followed by centrifugation at 4 ° C and 2000 rpm to obtain a precipitate. Then, the precipitate was resuspended in 500 μl of lysis buffer, and the supernatant obtained by ultrasonication and centrifugation was added to the supernatant, and the protein and beads were bound while stirring at 7 rpm at 4 ° C for 2 hours.

The reaction mixture was applied to a polypropylene column (Qiagen, USA), and a flow through fraction, a washing buffer (50 mM NaH ₂ PO ₄ (pH 8.0), 0.3 M NaCl, 10 mM imidazole, 20 mM β- (50 mM NaH ₂ PO ₄ (pH 8.0), 0.3 M NaCl, 10 mM imidazole, 20 mM β-mercaptoethanol, 100 mM imidazole) in a buffer and elution buffer The treated fractions were each obtained and each of the above samples was applied to 10% SDS-PAGE.

On the other hand, in order to use Ni-IDA / TED silica beads prepared in a column type, cell dissolution and ultrasonic treatment were carried out using the same buffer not containing imidazole in the same manner as above, one was the supernatant was applied to the column, the elution buffer for washing with lysis buffer contains, with each other imidazole of different concentration _{(50 mM NaH 2 PO 4 (} pH 8.0), 0.3 M NaCl, 10 mM imidazole, 20 mM β-mercaptoethanol, 10, 20, 50, 100, 250, 500 mM imidazole), and each of the obtained samples was applied to 10% SDS-PAGE.

Example  1-2: Dialysis

A spectrometer with a pore size of 3.5 kDa was cut to a depth of about 10 cm and 600 ml of a solution containing 2% (w / v) NaHCO ₃ and 1 mM EDTA (pH 8.0) was added. The cleaved dialysis membrane was placed in the solution, heat-treated for 10 minutes, and then heat-treated for 10 minutes using 600 ml of a solution containing 1 mM EDTA (pH 8.0) to activate the dialysis membrane. The bottom of the activated dialysis membrane was closed with a closure (spectrometer), and the protein obtained in Example 1-1 was placed inside the tube. When all of the protein is added, the solution is blocked with a closure to prevent the solution from escaping. Then, the solution is added to a 1000-fold volume of dialysis buffer (136.8 mM NaCl, 2.7 mM KCl, 1.5 mM KH ₂ PO ₄ , 4.3 mM Na ₂ PO ₄ Lt; / RTI > Dialyzed while rotating at 4 ° C for 4 hours, and then dialyzed against the same volume of dialysis buffer for another 16 hours. After dialysis, the closure was carefully opened and all protein solutions were obtained and stored frozen at -80 ° C.

Example  2: RNA Aptamer  excavation

Example  2-1: DNA  Library Manufacturing

(SEQ ID NO: 5) and a reverse primer (SEQ ID NO: 5) using a single 76-mer oligonucleotide (SEQ ID NO: 4) containing 40 random nucleotide sequences between the fixed base sequences to prepare an RNA library required for SELEX SEQ ID NO: 6) to prepare a double helix DNA library. At this time, the forward primer used includes a T7 RNA polymerase promoter base sequence for producing RNA using T7 RNA polymerase, and the reverse primer contains a BamHI restriction enzyme base sequence.

PCR was performed by mixing 119 bp DNA library template, 100 nM DNA oligonucleotide, 250 nM forward primer, 250 nM reverse primer, 200 uM dNTP, 10 ㎕ of 10X buffer and 1 unit Neotherm Taq polymerase (GeneCraft, Germany) (95 ° C for 5 minutes, 10 cycles (95 ° C for 30 seconds, 58 ° C for 30 seconds and 72 ° C for 30 seconds) and 72 ° C for 7 minutes). Performing a phenol extraction and ethanol precipitation process targeting the PCR product, and was dissolved in the process _{H 2 O DEPC (diethyl pyrocarbonate)} .

Example  2-2: RNA  Library Manufacturing

Using the DNA library prepared in Example 2-1 as a template, in vitro transcription was carried out using NTP modified with 2'-F for CTP and UTP to obtain an RNA library having various base sequences .

DuraScribe T7 transcription buffer, 2'-F CTP, 2'-F UTP, ATP, GTP (5 mM each), 10 mM DTT, DuraScribe T7 enzyme (DicScribe Biotechnology, USA) using a DuraScribe T7 transcription kit The mixture was reacted for 16 hours at 37 ° C in a thermostat, and 2 MBU (molecular biology unit) of DNase I was treated at 37 ° C for 30 minutes to remove the DNA library. Then, 6X denaturing RNA loading dye (95% deionized formamide (v / v), 5 mM EDTA, 0.025% bromophenol blue (w / v), 0.025% xylenecanol (w / v) EDTA) was added and denatured at 80 DEG C for 5 minutes. The denatured RNA was applied to 7 M urea - 8% PAGE, and the correct RNA size band was cut and immersed in 400 μl of eluate (10 mM Tris-Cl (pH 7.5), 5 mM EDTA (pH 8.0) Lt; / RTI > for 4 hours. The eluted RNA was purified by phenol extraction and ethanol precipitation (ethanol precipitation) and quantified by UV spectrometer (BioMate 3, Thermo Scientific, Swiss).

Example  2-3: SELEX

The resulting 2'-F RNA was heated at 95 ° C for 5 minutes to dissolve the structure, and then the 150 pmole RNA library and the binding buffer (30 mM Tris-Cl (pH 7.5), 150 mM NaCl , 1.5 mM MgCl ₂ , 2 mM DTT, 1% BSA (w / v)), and reacted at room temperature for 20 minutes.

The reaction solution was transferred to a tube containing Ni-IDA silica beads and reacted by gently inverting for 20 minutes. After centrifugation at 13000 rpm for 10 seconds, the supernatant was transferred to an empty tube and nonspecific RNA bound to Ni-IDA silica beads was removed. Then, ecdPAP protein was added and reacted at room temperature for 20 minutes. The reaction solution was transferred to a tube containing Ni-IDA silica beads and reacted by gently inverting for 20 minutes. After precipitating at 13000 rpm for 10 seconds, the supernatant containing the RNAs that did not bind to ecdPAP was removed, 400 μl of binding buffer was added, and light vortexing was performed to wash the bound RNA with binding force 5 times Respectively.

After completion of the above procedure, 200 μl of DEPC-H ₂ O and 80% phenol were added, vortexed strongly, and concentrated by phenol extraction and ethanol precipitation to obtain RNA. A 500 nM reverse primer (SEQ ID NO: 6) was added to the obtained RNA, denatured at 65 DEG C for 5 minutes, and then incubated at room temperature for 10 minutes to bind the RNA and the primer. 1 mM dNTP, 5X RT buffer, and 10 units of AMV RTase (Promega). The mixture was reacted at 37 ° C for 30 minutes, heated at 95 ° C for 5 minutes, cooled in ice, and the RTase was inactivated to obtain cDNA. The resulting cDNA was mixed with 100 nM forward primer (SEQ ID NO: 5), 100 nM reverse primer (SEQ ID NO: 6), 200 uM dNTP, 10 μl of 10X buffer and 1 unit Neotherm Taq polymerase (GeneCraft, Germany) (95 ° C for 5 minutes, 20 cycles (95 ° C for 30 seconds, 58 ° C for 30 seconds and 72 ° C for 30 seconds) and 72 ° C for 7 minutes). The DNA obtained by RT-PCR was confirmed by 3% agarose gel electrophoresis and was concentrated by phenol extraction and ethanol precipitation. Then, for the next order of SELEX, the process from in vitro transcription was repeated to obtain RNA, and the process of SELEX was repeated 6 times to perform 6 selections. The obtained DNA was cloned and 17 clones (8 (SEQ ID NOS: 34 to 50) were obtained, and their nucleotide sequences were analyzed (SEQ ID NOS: 34 to 50, ).

Example  3: 6 times Selected  2'-F RNA Of app tamer enrichment  Confirm

Example  3-1: Real - time quantitative RT - PCR

Real-time quantitative RT-PCR (CORBETT RG-3000, SYBR Green I) was performed to confirm that the RNA aptamer pool, which had been selected 6 times compared to the initial RNA library, bound better to ecdPAP. 300 fmole of RNA and 30 pmole of ecdPAP were reacted at room temperature for 20 minutes. Then, Ni-IDA silica beads were added, and the protein and beads were combined by inverting for 20 minutes. After centrifuging at 13000 rpm for 10 seconds, the beads were submerged, and the supernatant was removed. 500 μl of binding buffer was added again, followed by washing with 5 times of inverting. This procedure was repeated 5 times to remove RNA that was not bound to the protein, followed by phenol extraction and ethanol precipitation to obtain only the RNA bound to the protein.

Real-time PCR was performed using all of the cDNAs obtained through RT, and the cycle threshold (Ct) values of the respective samples were compared (FIG. At this time, the conditions of RT and real-time PCR were the same as RT and PCR conditions described above. FIG. 2A is a graph showing the results of evaluating an RNA aptamer pool obtained by performing 6 SELEXs using real-time RT-PCR. The sample used in the above graph shows 6 SELEXs for human ecdPAP protein Lt; RTI ID = 0.0 > a < / RTI > aptamer pool. As shown in FIG. 2A, it was found that the level of RNA aptamer binding to ecdPAP was about 3.51 times higher than that of the initial RNA library in the RNA aptamer pool obtained by performing 6 times of SELEX.

Example  3-2: Electrophoretic mobility shift  assay EMSA )

EMSA was performed to confirm that the RNA aptamer pool, which had 6 selections compared to the initial RNA library, bound better to ecdPAP.

Specifically, 6 and 12 pmoles of ecdPAP protein were mixed with 60 fmole of an RNA aptamer pool and library RNA for 20 min in EMSA binding buffer (300 mM Tris-Cl (pH 7.5), 1.5 M NaCl, 15 mM MgCl ₂ , 20 mM DTT) At room temperature, electrophoresed using 8% native-PAGE, and applied to northern blot to detect the band (Ambion BrightStar Bio Detected Kit). The probe used for RNA detection was the same sequence as the reverse primer (SEQ ID NO: 6) but labeled with biotin at the 5'-end (Fig. 2B). FIG. 2B is a photograph showing the result of evaluating an RNA aptamer pool obtained by performing 6 SELEXs using EMSA. As shown in FIG. 2B, no RNA having an altered position was detected in the initial RNA library. However, in the RNA aptamer pool obtained by performing 6 times of SELEX, RNA having a changed position bound to ecdPAP was detected.

These results indicate that the RNA aptamer pool obtained by performing SELEX 6 times contains an RNA aptamer (SEQ ID NOS: 34 to 50) capable of binding ecdPAP. The RNA aptamer is classified into group I (8,12, 2N, 2, 3N, 20N and 10 clones, SEQ ID NOS 34 to 40), group II (7, 11N, 13, 9 and 11 clones, Nos. 41 to 45) and non-groups (1N, 6N, 19N, 21N and 24N, SEQ ID NOS: 46 to 50).

Example  4: Each selected RNA Of app tamer  Binding ability analysis

Example  4-1: Electrophoretic mobility shift  assay EMSA )

EMSA was performed to reaffirm the binding of each RNA aptamer clone obtained by cloning to ecdPAP. The ratio of the bound RNA and protein was 1: 200 (60 fmole: 12 pmole), and the northern blot procedure was performed in the same manner as in Example 3-2 (FIG. 3). FIG. 3 is a photograph showing a result of screening a sequence having binding ability to PAP among the RNA aptamers of the present invention. FIG. 3 (a) is a photograph showing the nucleotide sequence of the 12 clones (SEQ ID NO: 35) (SEQ ID NO: 42) representing a representative group and 19N clone (SEQ ID NO: 48) representing a non-group. FIG. 3B shows the result of performing EMSA on the group I FIG. 3C shows the result of performing the EMSA on the group II, and FIG. 3D shows the result of performing the EMSA on the non-group. As shown in FIG. 3, it was confirmed that the 11N and 6N clones exhibit strong binding, and the 12, 13 and 24N clones exhibit weak binding.

Example  4-2: Real - time quantitative RT - PCR

As shown in the results of Example 4-1, 11N (SEQ ID NO: 1) and 6N (SEQ ID NO: 2) among the RNA aptamer clones selected as a result of EMSA show the best combination, -time RT-PCR. The ratio of the combined RNA and protein was 1: 100 (300 fmole: 30 pmole), and the subsequent procedure was performed in the same manner as in Example 3-1. The result was expressed as 300fmol of RNA- (Fig. 4 (a)). In Fig. 4a, bead shows a background value for binding of RNA aptamer nonspecifically to beads without adding protein, protein shows a value measured by adding protein, and library represents a negative control with library added instead of aptamer. As shown in FIG. 4 (a), about 2.3% of the RNA aptamer binds to the protein in the case of the 11N clone and about 6.1% in the case of the 6N clone, It was confirmed that the RNA aptamer binds to the protein. From the above results, it can be seen that not only the RNA aptamer selected in the present invention can sufficiently bind to the target protein but also the 6N clone shows about 3 times more binding affinity than the 11N clone.

Example  5: 6N RNA Of app tamer  Character analysis

Example  5-1: Biotinylated  6N RNA full length Aptamer  making

In vitro transcription was performed to label biotin at the 5 'site of the 6N RNA aptamer. 6N DNA, DuraScribe T7 transcription buffer, 2'-F CTP, 2'-F UTP, ATP (5 mM each), 5'-biotin GMP 1 mM, GTP 4 mM, and GTP using a DuraScribe T7 transciption kit (Epicenter Biotechnology, USA) 10 mM DTT, and DuraScribe T7 Enzyme Mix. The subsequent procedure was carried out in the same manner as in Example 2-2.

Example  5-2: Dose - dependent binding

EMSA was performed to determine if the 6N full length RNA aptamer increased binding as the concentration of ecdPAP protein increased. Biotinylated 6N full length RNA aptamer was added at 0, 2, 4, 6, 8, 16, 32, 64, 128, 256, or 512 times the amount of protein based on 60 fmole. Then, the northern blot procedure was performed in the same manner as in Example 3-2, but the probe was not treated because it was already labeled on the RNA (Fig. 4 (b)). As shown in FIG. 4 (b), as the concentration of the target protein increases, the level of the RNA aptamer (a band indicated by *) increases, while the level of the RNA aptamer Respectively.

The RNA aptamer recognizes and binds to the tertiary structure of the target protein by its own tertiary structure, and the increase in the level of the bound RNA aptamer as the level of the target protein increases means that the 6N clone RNA aptamer specifically binds to the target protein.

Example  5-3: Competition assay

A competition assay was performed to confirm the binding specificity of 6N full length RNA aptamer. A biotinylated 6N full length RNA aptamer of 60 fmole and an ecdPAP protein of 12 pmole were reacted with competitor (6N full length RNA aptamer not labeled with biotin) and 1: 1, 1 : 2, 1: 5 or 1:10, respectively. Then, the northern blot procedure was performed in the same manner as in Example 3-2, but the probe was not treated because the RNA was already labeled (FIG. 4C). In FIG. 4C, the library and 6N represent competitors without biotin binding. The biotin-bound 6N clone competes with 6N although it does not compete with the library.

From the above results, it was found that the 6N RNA aptamer specifically binds to the target protein.

Example  6: Prostate In Cancer Cells  6N and 11N full length RNA Of app tamer  Confirm binding

To confirm whether 11N and 6N could bind to ecdPAP obtained from E. coli in vitro, we examined whether PAP expressed in mammalian cells could bind to these RNA aptamers. PC3, and LNCaP) were subjected to immunohistochemistry.

TSA Fluorescence System Tyramide Signal Amplification Kit (Perkin Elmer, NEL704A) was used. The cells were fixed with 4% (w / v) paraformaldehyde for 15 minutes and then washed three times with PBS containing 150 mM MgCl ₂ . After blocking with the blocking buffer provided, 20 pmoles of each full-length RNA aptamer were reacted at room temperature for 20 minutes and then washed again three times. 20 pmole of the reverse primer labeled with biotin (SEQ ID NO: 6) at the 5'-end was reacted at room temperature for 20 minutes and washed three times with PBS. After streptavidin-HRP was reacted for 20 minutes, TSA-Cy3 was treated with substrate for 3 minutes at room temperature. DAPI, placed on a cover slide and observed with a confocal laser scanning microscope (Fig. 6). FIG. 6 is a photograph showing whether PAP of the RNA aptamer of the present invention binds to cancer cells expressing on the cell surface. PC3 and LNCaP represent prostate cancer cell lines expressing excessive PAP, Instead, the library represents a negative control, and 6N and 11N represent RNA aptamer clones. As shown in FIG. 6, it was confirmed that the negative control group did not bind to the surface of the prostate cancer cell line, while the RNA aptamer clone specifically binds to the surface of the prostate cancer cell line.

Example  7: 6N RNA Of app tamer  Minimum sequence determination

Example  7-1: Minimized  6N DNA template  Ready

The template DNA was synthesized by PCR to produce minimized 6N RNA aptamer. 10 nM minimization-1 forward primer (SEQ ID NO: 7), 10 nM minimization-1 reverse 1 primer (SEQ ID NO: 8), 200 uM dNTP, 10X buffer 10 (95 ° C for 5 minutes, 20 cycles (95 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 30 seconds), and 72 ° C for 7 minutes) were mixed with 1 unit Neotherm Taq polymerase (GeneCraft, Germany). The DNA obtained by PCR was confirmed on 3% agarose gel and then concentrated by phenol extraction and ethanol precipitation. 10 nM minimization-1 forward primer (SEQ ID NO: 7), 10 nM minimization-1 reverse2 primer (SEQ ID NO: 9), 200 uM dNTP, 10 l of 10X buffer and 1 unit of Neotherm Taq polymerase (GeneCraft, Germany ) Were amplified by PCR using the same conditions, followed by 3% agarose gel electrophoresis, followed by phenol extraction and ethanol precipitation. 6N minimization 2, 3, 4 (6N-M2, M3, M4) (SEQ ID NOS: 3, 23 and 24) RNA aptamers were amplified with primers (SEQ ID NOS: 10, 11, 12, 13, 14 and 15) , Respectively, and DNA was concentrated by the same procedure.

Example  7-2: Biotinylated minimized  6N RNA Aptamer transcription

PCR was performed using 500 ng of each of the DNAs synthesized in Example 7-1 as a template to obtain an RNA aptamer fragment of the 6N clone in which the biotin-linked 6N clone RNA aptamer and its partial sequence were deleted 6N-M1, 6N-M2, 6N-M3 and 6N-M4, SEQ ID NOS: 22, 3, 23 and 24, respectively. At this time, PCR was performed in the same manner as in Example 5-1 (Fig. 7 (a)). FIG. 7A is a schematic diagram showing the secondary structure of the RNA aptamer of the 6N clone in which the biotin is bound. FIG.

Generally, since the bulge and the hairpin region are more important than the stem region of the aptamer structure in the binding reaction of the RNA aptamer to the target protein, the size is minimized so as not to include the bulge portion sequentially.

As shown in FIG. 7A, the RNA aptamer of the 6N clone can be generated to have a secondary structure of "a" shape and "a" shape according to the dG value, and 6N -M1 (SEQ ID NO: 22) and 6N-M2 (SEQ ID NO: 3) can form both of the structures derived from the two forms of "a" secondary structure and "a" secondary structure, -M3 (SEQ ID NO: 23) and 6N-M4 (SEQ ID NO: 24) can selectively form only the structure derived from the form of the "a" secondary structure.

Example  7-3: Electrophoretic mobility shift  assay EMSA )

EMSA was performed to reaffirm the binding of biotinylated minimized 6N RNA aptamers obtained in Example 7-2 to ecdPAP. The ratio of bound RNA to protein was 1: 200 (60 fmole: 12 pmole). The northern blotting process was then carried out in the same manner as in Example 5-2 (Fig. 7b). 7 (b) is a northern blot photograph showing the results of EMSA analysis using each biotinylated RNA aptamer.

Of the four types of RNA aptamer fragments obtained in Example 7-2, 6N-M3 (SEQ ID NO: 23) and 6N-M4 (SEQ ID NO: 24) It is possible to predict the secondary structure of the RNA aptamer binding to the target protein by confirming the binding thereof. 6N-M3 and 6N-M4 were able to form a conjugate (a band marked with *) with the target protein, while 6N-M3 and 6N-M4 were able to bind to the target protein Since the protein and the conjugate (the band denoted by *) were not formed, it was found that the RNA aptamer binding to the target protein forms a secondary structure of "a" -shaped structure.

Example  8: 6N- M2 RNA Of app tamer  Identification of protein binding sites

Example  8-1: Truncated  6N- M2 DNA template  Ready

Based on the 6N-M2 RNA aptamer, various truncated 6N-M2 RNA aptamers were prepared. Specifically, 6N-M2-RD (right deletion) in which the right hairpin structure of 6N-M2 RNA aptamer is deleted, 6N-M2-TD (top deletion) in which the upper hairpin structure is deleted, 6N-M2-RTD (right & top deletion), which is a deletion of all structures, was constructed by PCR.

First, each primer composed of the polynucleotides of SEQ ID NOS: 16 and 17, 10 uL of 10X buffer, 1 unit Neotherm Taq polymerase (GeneCraft < RTI ID = 0.0 > , Germany), followed by 95 ° C for 5 minutes and then 20 cycles at 95 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 30 seconds. Finally, PCR was performed at 72 ° C for 7 minutes 6N-M2-RD (SEQ ID NO: 31), a truncated 6N-M2 RNA aptamer, was prepared. The prepared 6N-M2-RD was confirmed by 3% agarose gel, and then concentrated by phenol extraction and ethanol precipitation.

Next, PCR was performed in the same manner as described above, except that a dimeric polynucleotide consisting of polynucleotides of SEQ ID NOS: 27 and 28 was used as a template and polynucleotides of SEQ ID NOS: 18 and 19 were used as primers, 6N-M2-TD (SEQ ID NO: 32) which is a 6N-M2 RNA aptamer was prepared.

Finally, PCR was performed in the same manner as described above, except that a dimeric polynucleotide consisting of polynucleotides of SEQ ID Nos. 29 and 30 was used as a template and polynucleotides of SEQ ID NOS: 20 and 21 were used as primers, 6N-M2-RTD (SEQ ID NO: 33), a 6N-M2 RNA aptamer, was prepared.

Example  8-2: Biotinylated truncated  6N- M2 RNA Aptamer transcription

Each biotinylated RNA aptamer was obtained by performing the same method as in Example 5-1 using 500 ng of each of the truncated 6N-M2 RNA aptamers obtained in Example 8-1 as a template 7 c). 7C is a schematic diagram showing the secondary structure of biotin-bound truncated 6N-M2 RNA aptamers (6N-M2-RD, 6N-M2-TD and 6N-M2-RTD).

Example  8-3: Electrophoretic mobility shift  assay EMSA )

EMSA was performed to confirm the binding of biotin-bound truncated 6N-M2 RNA aptamers synthesized in Example 8-2 to ecdPAP. The ratio of bound RNA and protein was 1: 200 (60 fmole: 12 pmole). The northern blot procedure was then carried out in the same manner as in Example 5-2 (Figure 7d). FIG. 7D is a northern blot photograph showing the results of EMSA analysis using each biotinylated RNA aptamer. As shown in Figure 7d, the cleaved 6N-M2 RNA aptamer, which was capable of forming a complex with the target protein (* indicated by *), but not one of the hairpin structures, And it was confirmed that it could not form a complex.

From the above results, it was found that both of the two hairpin structures are essential for RNA aptamers for target proteins.

<110> Industry-Academic Cooperation Foundation, Dankook University <120> RNA aptamer that selectively binds to the extracellular domain of PAP <130> PA120415 / KR <160> 50 <170> Kopatentin 2.0 <210> 1 <211> 93 <212> RNA <213> Artificial Sequence <220> <223> 11N full length <400> 1 gggagagcgg aagcgugcug ggccuguguu uaagcacugu augaugugcg gcccggcuua 60 ucgucauaac cccagagguc gauggauccc ccc 93 <210> 2 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> 6N full length <400> 2 gggagagcgg aagcgugcug ggcuguguga gagccgugag uaaaaggccg cgacaaagau 60 cggacauaac ccagaggucg auggaucccc cc 92 <210> 3 <211> 50 <212> RNA <213> Artificial Sequence <220> <223> 6N minimization-2 <400> 3 ggguguguga gagccgugag uaaaaggccg cgacaaagau cggacauacc 50 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> DNA library <400> 4 gcggaagcgt gctgggccnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnca 60 taacccagag gtcgat 76 <210> 5 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 5 ggtaatacga ctcactatag ggagagcgga agcgtgctgg g 41 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 ggggggatcc atcgacctct gggttatg 28 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> minimization-1 forward <400> 7 ggtaatacga ctcactatag ggctgtgtga gag 33 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> minimization-1 reverse1 <400> 8 gggctgtgtg agagccgtga gtaaaaggcc gcgac 35 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> minimization-1 reverse2 <400> 9 taaaaggccg cgacaaagat cggacataac cc 32 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> minimization-2 forward <400> 10 ggtaatacga ctcactatag ggtgtgtgag agccgtgagt aaa 43 <210> 11 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> minimization-2 reverse <400> 11 gagagccgtg agtaaaaggc cgcgacaaag atcggacata cc 42 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> minimization-3 forward <400> 12 ggtaatacga ctcactatag ggagccgtga gtaaa 35 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> minimization-3 reverse <400> 13 gggagccgtg agtaaaaggc cgcgacaaag atccc 35 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> minimization-4 forward <400> 14 ggtaatacga ctcactatag ggcgtgagta 30 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> minimization-4 reverse <400> 15 tatagggcgt gagtaaaagg ccgcg 25 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> deletion-RD forward <400> 16 ggtaatacga ctcactatag ggtgtgtgat agccgtg 37 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> deletion-RD reverse <400> 17 gtgtgtgata gccgtgagta aaaggcctcg gacatacc 38 <210> 18 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> deletion-TD forward <400> 18 ggtaatacga ctcactatag ggtgtgtgag agccgc 36 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> deletion-TD reverse <400> 19 ggtgtgtgag agccgcggca aagaccggaa cataccc 37 <210> 20 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> deletion-RTD forward <400> 20 ggtaatacga ctcactatag ggtgtgtgag a 31 <210> 21 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> deletion-RTD reverse <400> 21 tatagggtgt gtgagagccg cggacatacc c 31 <210> 22 <211> 53 <212> RNA <213> Artificial Sequence <220> <223> 6N minimization-1 <400> 22 gggcugugug agagccguga guaaaaggcc gcgacaaaga ucggacauaa ccc 53 <210> 23 <211> 35 <212> RNA <213> Artificial Sequence <220> <223> 6N minimization-3 <400> 23 gggagccgug aguaaaaggc cgcgacaaag auccc 35 <210> 24 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> 6N minimization-4 <400> 24 gggcgugagu aaaaggccgc gc 22 <210> 25 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> 6N-M2-RD template F <400> 25 ggtaatacga ctcactatag ggtgtgtgat agccgtg 37 <210> 26 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> 6N-M2-RD template R <400> 26 ggtatgtccg aggcctttta ctcacggcta tcacacac 38 <210> 27 <211> 36 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 6N-M2-TD template F <400> 27 ggtaatacga ctcactatag ggtgtgtgag agccgc 36 <210> 28 <211> 37 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 6N-M2-TD template R <400> 28 gggtatgttc cggtctttgc cgcggctctc acacacc 37 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 6N-M2-RTD template F <400> 29 ggtaatacga ctcactatag ggtgtgtgag a 31 <210> 30 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 6N-M2-RTD template R <400> 30 gggtatgtcc gcggctctca cacaccctat a 31 <210> 31 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> 6N-M2-RD <400> 31 ggguguguga uagccgugag uaaaaggccu cggacauacc 40 <210> 32 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> 6N-M2-TD <400> 32 ggguguguga gagccgcggc aaagaccgga acauaccc 38 <210> 33 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> 6N-M2-RTD <400> 33 ggguguguga gagccgcgga cauaccc 27 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 8 <400> 34 ccttgttcct gcttttttaa gcgctgtatg atgcgtcagt ga 42 <210> 35 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 12 <400> 35 ccttgttcct gcttttttaa gcgctgtatg atgcgtcggt ga 42 <210> 36 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 2N <400> 36 tcttgttcct gcttttttaa gcgctgtatg atgcgtcagt ga 42 <210> 37 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 2 <400> 37 ctttgttcct gcttttttaa gcgctgtatg atgcgccagt ga 42 <210> 38 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 3N <400> 38 ccttgttcct gcttttttaa gcgctgtatg atgcgccagt gg 42 <210> 39 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 20N <400> 39 ccttgttctt gttcttttaa gcgctgtatg atgcgtcggt ga 42 <210> 40 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 10 <400> 40 ctttgttctt gcttttttaa gcgctgtatg atgcgtcgat ga 42 <210> 41 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 7 <400> 41 cctgttttta agcactgtat gatgtgtggc ccgccttatt cgt 43 <210> 42 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 11N <400> 42 cctgtgttta agcactgtat gatgtgcggc ccggcttatt cgt 43 <210> 43 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 13 <400> 43 tctgttttta agcactgtat gatgtgtggc ccggcttatt cga 43 <210> 44 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 9 <400> 44 cctgtgttta agcactgtat gatgtgtggc ccgccttgcg atc 43 <210> 45 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 11 <400> 45 tctgttttta agcactgtat gatgtgtggc ccgccttgcg atc 43 <210> 46 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 1N <400> 46 ccagcggtgg tggatcgaat agttcagtac taggccagag ca 42 <210> 47 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 6N <400> 47 ctgtgtgaga gccgtgagta aaaggccgcg acaaagatcg ga 42 <210> 48 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 19N <400> 48 tcgtgtgaga gccgtaagtg aaaggccgcg acaaagatcg ga 42 <210> 49 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 21N <400> 49 cccttaaggg ggaacgcatt gttgcgttct atcctctcag ta 42 <210> 50 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> 24N <400> 50 ccgttcattg gctcactgat tagcgcgggc agggtctttt gg 42

Claims (13)

RNA aptamer that binds to the extracellular domain of PAP (Prostatic acid phosphatase).
The method of claim 1,
RNA aptamer selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1-3 and 22.
3. The method of claim 2,
Wherein the 2'-hydroxyl group of U (uracil) and C (cytosine) of the nucleotide is replaced with a fluorine group.
A cancer diagnostic composition comprising the RNA aptamer of any one of claims 1 to 3.
A cancer diagnostic kit comprising the composition of claim 4.
The method of claim 5,
Wherein the cancer is prostate cancer.
The method of claim 5,
A buffer, and a container for performing and analyzing the detection.
The method of claim 5,
Lt; RTI ID = 0.0 &gt; imaging material. &Lt; / RTI &gt;
A pharmaceutical composition for treating cancer, comprising the RNA aptamer of any one of claims 1 to 3 as an active ingredient.
10. The method of claim 9,
Wherein the composition further comprises a cancer therapeutic agent.
10. The method of claim 9,
Lt; RTI ID = 0.0 &gt; pharmaceutically &lt; / RTI &gt; acceptable carrier.
10. The method of claim 9,
Wherein said cancer is prostate cancer.
(Iii) deriving a common sequence included in the RNA aptamer of any one of claims 1 to 3;
(Ii) searching the derived common nucleotide sequence in a DNA / RNA database to search for a new gene fragment comprising the common sequence; And
(Iii) screening a gene fragment interacting with the extracellular domain of PAP, comprising the step of measuring the activity of the searched gene fragment and selecting a gene fragment that interacts with the extracellular domain of PAP (Prostatic acid phosphatase) .

Images