JP2017086027A - Aptamer which binds to cell nuclear transport receptor kpna2 protein, and kpna2 protein functional inhibition using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel agent effective for the detection, concentration, purification and functional inhibition of nuclear transport receptor KPNA2 protein frequently exhibited in cancer cells.SOLUTION: Disclosed are a novel RNA aptamer which binds to nuclear transport receptor KPNA2 protein with high affinity showing a dissociation constant (K) of 200 nM or less, as well as a detection reagent containing the same, a carrier to which an RNA aptamer is immobilized, an inhibitor and a pharmaceutical composition. Furthermore, a double stranded DNA vector which can produce an RNA aptamer by transcription having an RNA polymerase recognition sequence added to the 3' end is disclosed. A particular nucleic acid sequence, or an RNA aptamer having a nucleic acid sequence in which one or more bases is deleted, substituted, inserted or added to the nucleic acid sequence is disclosed.SELECTED DRAWING: None

Description

  The present invention relates to a novel substance effective for detection, concentration, purification, quantification, and function inhibition of the nuclear transport receptor KPNA2 protein highly expressed in cancer cells. Specifically, the present invention relates to a novel RNA aptamer that binds with high affinity to the nuclear transport receptor KPNA2 protein. Furthermore, a detection reagent, a carrier, an inhibitor and a pharmaceutical composition containing the RNA aptamer, and a detection method, a concentration method, a purification method, a cell nuclear transport function inhibition method of the KPNA2 protein using the RNA aptamer, And a method for inhibiting the growth of KPNA2 protein-expressing cells.

  Eukaryotic cell nuclei are covered with a nuclear envelope, limiting molecular transport between the cytoplasm and the nucleus. Genes are stored in cell nuclei, and it is essential for various cellular activities to carry necessary functional molecules from the cytoplasm to the cell nucleus and act on the genes at appropriate timing.

  The nuclear membrane has a nuclear membrane pore, and many proteins having a molecular size of 40 kDa go back and forth inside and outside the cell nucleus by selective molecular transport through specific transport receptors. Transport receptors responsible for such selective transport are called importins and exportins. Of these, importin recognizes an amino acid sequence called a nuclear localization signal (hereinafter referred to as NLS) of a protein, binds to the protein, and transports the protein from the cytoplasm into the cell nucleus. In addition, although a nuclear translocation signal may be called a nuclear localization signal or a nuclear localization signal, these terms used by those skilled in the art are considered synonymous in this specification.

  Importin α (Karyopherin α, KPNA), which is one of the nuclear transport receptors, recognizes NLS rich in basic amino acids and forms a complex of three types of proteins with importin β. This complex passes through the nuclear pore by the affinity between importin β and the constituent protein of the nuclear pore (a schematic diagram is shown in FIG. 1). The complex that has entered the cell nucleus is dissociated, and importin α and importin β move to the cytoplasm and are reused.

There are multiple types of family molecules in importin α, and seven types of genes have been identified in humans (KPNA1 (importin α5), KPNA2 (importin α1), KPNA3 (importin α4), KPNA4 (importin α3), KPNA5) (Importin α6), KPNA6 (importin α7), and KPNA7 (importin α8)). These family molecules have different expression levels depending on the cell type. Each of these family molecules exhibits substrate specificity according to the NLS sequence. At least 75 types of proteins that are transported to the cell nucleus by importin α have been reported (Non-patent Document 1). Nucleoproteins include many proteins containing NLS sequences that are expected to be transported by importin α. Considering these, various proteins can be transported by using at most 7 kinds of family molecules. Therefore, cell type-specific expression of importin α and specificity of various importin α molecular species and NLS possessed by the protein serving as a transport substrate are all important properties for maintaining and regulating cell functions. Conceivable.
The importin molecular species may be shown with or without a hyphen, such as importin α1, importin-α1, and importin α-1, but they are synonymous.

  Importin α has been reported to play a role in determining cell fate by transporting transcription factors to the cell nucleus during the differentiation of mouse embryonic stem cells. In particular, it is known that the KPNA2 protein in the importin α family is highly expressed in undifferentiated embryonic stem cells, and the expression level decreases with the progress of cell differentiation. And if this fall is inhibited, cell differentiation will also be suppressed, Therefore It is suggested that KPNA2 protein is required for the maintenance of the undifferentiation property of a stem cell (nonpatent literature 2).

  Furthermore, since KPNA2 is highly expressed in human tumors and cancer tissues (for example, malignant melanoma, cervical cancer, esophageal cancer, lung cancer, ovarian cancer, prostate cancer, brain tumor, liver cancer, and bladder cancer), it is a cancer marker. (Non-Patent Document 3).

  As inhibitors targeting importin α, at present, importin α-specific antibodies, peptides corresponding to the NLS portion of importin α-specific substrates, and the like have been reported (Non-patent Documents 4 and 5). However, since the homology between importin α families is high, it has been difficult to perform molecular species-specific detection using anti-importin α antibodies under conditions where a plurality of molecular species importin α families coexist. For example, it can be said that there are almost no antibodies against the KPNA2 protein that are strictly species-specific. In addition, although a peptide corresponding to the NLS portion of the importin α-specific substrate has been reported as a peptide that exhibits binding to the KPNA1 protein, the peptide exhibits weak binding to other importin α molecular species. It was. It is the same as in the case of an antibody in that a sufficiently strict species-specific reaction is not found. Attempts have also been made to specifically suppress the expression of the KPNA gene with SiRNA. However, SiRNA cannot be used for detection of molecular species-specific expression of KPNA protein, and cannot be used as a diagnostic agent using the expression level of KPNA protein as an index. For these reasons, the development of importin α-binding substances with higher molecular species specificity has been demanded. In addition, there has been a demand for the development of a molecular species-specific importin α function inhibitor containing an importin α-binding substance using a highly specific binding property.

  On the other hand, an aptamer that is a functional nucleic acid has a function similar to an antibody in that it specifically binds to a substrate. Comparing the two, aptamers have a wider range of applications than antibodies in that they can target small molecules such as ions to large targets such as huge protein complexes and virus particles. In particular, RNA aptamers have a complex tertiary structure, and can highly identify and bind target compounds (Non-patent Document 6). Therefore, the high discrimination function of aptamers may be used as a very effective tool for identifying closely related proteins. However, there have been no reports on specific aptamers for the importin α family of proteins, and it was not clear whether the importin α molecular species could be strictly distinguished by the use of aptamers. Is it possible to inhibit the function of importin α of the specific molecular species by using the binding between the aptamer and the specific importin α molecular species, or to regulate the physiological function of the cell by the inhibition? Neither was clear.

Pumroy RA, Cingolani G. Diversification of importin-alpha isoforms in cellular trafficking and disease states.Biochem. J. (2015.2) 466: 13-28. Yasuhara N, Shibazaki, N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H, Yoneda Y. Triggering neural differentiation of ES cells by subtype switching of importin-alpha. Nat. Cell Biol. (2007) 9: 72-79. Christiansen A, Dyrskjot L. The functional role of the novel biomarker karyopherin alpha-2 (KPNA2) in cancer.Cancer Lett. (2013) 331: 18-23. Lin YZ, Yao SY, Veach RA, Torgerson TR, Hawiger J. Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence.J. Biol. Chem. (1995 ) 270: 14255-14258. Zienkiewicz J, Armitage A, Hawiger J. Targeting nuclear import shuttles, importins / karyopherins alpha by a peptide mimicking the NFkappaB1 / p50 nuclear localization sequence.J. Am. Heart Assoc. (2013) 2: e000386. Jenison R.D., Gill S.C., Pardi A., and Polisky B. High-resolution molecular discrimination by RNA. Science (1994) 263: 1425-1429.

  The object of the present invention is to focus on the KPNA2 protein highly expressed in tumor and cancer tissues among the nuclear transport receptor importin α, and to develop a novel substance effective for the detection, concentration, purification, quantification and functional inhibition of the KPNA2 protein. It is to provide. More specifically, an object of the present invention is to provide a novel RNA aptamer that binds to the nuclear transport receptor KPNA2 protein with high affinity. And a detection reagent, a carrier, an inhibitor and a pharmaceutical composition containing the RNA aptamer, a detection method, a concentration method, a purification method, a cell nuclear transport function inhibition method using the RNA aptamer, and An object of the present invention is to provide a method for inhibiting the growth of KPNA2 protein-expressing cells. Furthermore, in view of the high expression of KPNA2 protein in tumors and cancer tissues, it is an object to provide a cancer test drug containing the RNA aptamer and an anticancer drug having a KPNA2 protein function inhibitory effect containing the RNA aptamer.

  As a result of studies to solve the above problems, the present inventors have obtained a plurality of RNA aptamers that bind to the KPNA2 protein among the nuclear transport receptor importin α. And, the RNA aptamer binds to the KPNA2 protein with high affinity, has no substantial binding ability to the KPNA1 protein, the expression of the KPNA2 protein can be detected by the aptamer, and the RNA aptamer The administration has found that the function of transporting a substance (NLS-containing protein) to the cell nucleus dependent on KPNA2 protein in cells expressing KPNA2 protein is inhibited, and the present invention has been completed based on these findings.

  The present invention relates to an RNA aptamer capable of binding to KPNA2 protein. Specific examples thereof include an aptamer 76, an aptamer 72, a modified form thereof, or an RNA aptamer that is very similar in structure (sequence) and functionally equivalent thereto. Further, a carrier formed by immobilizing the RNA aptamer, a reagent containing the RNA aptamer, a pharmaceutical composition, or a function inhibitor of KPNA2 protein, a detection method using the RNA aptamer, a concentration method, a purification method, and in vivo Alternatively, the present invention relates to a method for inhibiting the function of KPNA2 protein ex vivo. Furthermore, the present invention relates to DNA that can be converted into the RNA aptamer by transcription.

More specifically, it relates to the following (1) to (54).
(1) An RNA aptamer having a binding ability showing a dissociation constant (K _D ) of 200 nM or less for human KPNA2 protein.
(2) A) including the base sequence shown in SEQ ID NO: 1, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 1. The RNA aptamer according to (1) above,
(3) The RNA aptamer according to (1), comprising the base sequence represented by SEQ ID NO: 1.
(4) A) including the base sequence shown in SEQ ID NO: 2, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2. The RNA aptamer according to (1) above,
(5) The RNA aptamer according to (1), comprising the base sequence represented by SEQ ID NO: 2.
(6) The RNA aptamer according to any one of (1) to (5) above, which has a chemically modified nucleotide.
(7) The 2 ′ position of the ribose moiety in each pyrimidine nucleotide is the same or different and is unsubstituted or consists of a fluorine atom, a methoxy group, an amino group, a 2 ′, 4′-BNA group, and a hydrogen atom. The RNA aptamer according to (6) above, which is substituted with any atom or group of the group.
(8) The RNA according to any one of (1) to (7) above, wherein the 3 ′ end and / or the 5 ′ end is modified with inburst deoxythymidine (idT) or polyethylene glycol. Aptamer.
(9) The RNA aptamer according to any one of (1) to (8), which is labeled.
(10) The RNA aptamer according to any one of (1) to (8), wherein a functional compound is bound thereto.

(11) A carrier formed by immobilizing the RNA aptamer according to any one of (1) to (10).
(12) DNA that can be converted into the RNA aptamer according to any one of (1) to (5) by transcription.
(13) A) including the base sequence shown in SEQ ID NO: 7, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 7. The DNA according to (12), wherein
(14) A) including the base sequence shown in SEQ ID NO: 8, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 8. The DNA according to (12), wherein
(15) The DNA according to any one of (12) to (14), wherein an RNA polymerase recognition sequence is added to the 3 ′ end.
(16) The DNA according to (15), wherein the RNA polymerase recognition sequence is a T7 promoter sequence.
(17) A complementary strand DNA having a base sequence complementary to the DNA according to any one of (12) to (16).
(18) A double-stranded DNA in which the DNA according to any one of (12) to (16) and its complementary strand DNA are hybridized in a complementary manner.

(19) A reagent for detecting a KPNA2 protein, comprising the RNA aptamer according to any one of (1) to (10).
(20) A step of bringing the RNA aptamer according to any one of (1) to (10), the carrier according to (11), or the reagent according to (19) into contact with a sample derived from a living body. A method for detecting a KPNA2 protein.
(21) Expressing the KPNA2 protein, characterized in that the RNA aptamer according to any one of (1) to (10) or the reagent according to (19) is applied to a sample derived from a living body. Cell detection method.
(22) The detection method according to (21), which is a method for detecting cancer cells.
(23) Detection of KPNA2 protein in a cell, comprising a step of bringing the RNA aptamer according to any one of (1) to (10) or the reagent according to (19) into contact with a sample derived from a living body. Method.
(24) The detection method according to (23), wherein the cell is a cancer cell.
(25) A detection method for diagnosing cancer, wherein A) an RNA aptamer according to any one of (1) to (10) above or a sample derived from a living body, or (19) A method comprising contacting a reagent; and B) detecting an RNA aptamer specifically bound to the sample.

(26) A pharmaceutical composition comprising the RNA aptamer according to any one of (1) to (10) as an active ingredient.
(27) The pharmaceutical composition according to the above (26), which is a composition for cancer treatment.
(28) A cell growth inhibitor for KPNA2 protein-expressing cells, comprising the RNA aptamer according to any one of (1) to (10) as an active ingredient.
(29) A function inhibitor for KPNA2 protein, comprising the RNA aptamer according to any one of (1) to (10) as an active ingredient.
(30) An in vitro or ex vivo method for inhibiting the nuclear translocation ability of the KPNA2 protein, wherein the RNA aptamer according to any one of (1) to (10) above with respect to a biological sample, Or a method comprising applying a function inhibitor for the KPNA2 protein according to (29) above.
(31) An in vitro or ex vivo method for suppressing proliferation of a cell expressing a KPNA2 protein, wherein the RNA according to any one of (1) to (10) above is applied to a sample derived from a living body A method comprising a step of applying an aptamer or a function inhibitor for the KPNA2 protein according to (29) above.

(32) A KPNA2 protein in a biological sample, comprising a step of contacting a sample derived from a living body with the RNA aptamer according to any one of (1) to (10) or the carrier according to (11). Quantification method.
(33) A step of contacting a sample derived from a living body with the RNA aptamer according to any one of (1) to (10) above, and measuring an interaction between the RNA aptamer and the KPNA2 protein in the sample A method for detecting a KPNA2 protein, comprising a step.
(34) The detection method according to (33), wherein the interaction is measured by a surface plasmon resonance method.
(35) The RNA aptamer according to (10), wherein the functional compound is an enzyme, a drug delivery vehicle, a drug, or a tag substance.
(36) The RNA aptamer according to (35), wherein the tag substance is biotin.
(37) The carrier according to (11) above, which is used for concentrating or purifying KPNA2 protein.
(38) The carrier according to any one of (11) and (36), wherein the carrier is a column.
(39) Separating and / or concentrating and / or purifying KPNA2 protein, including a step of applying a biological sample to the carrier according to any one of (11), (37) and (38). Method.
(40) A cancer diagnostic kit comprising the aptamer according to any one of (1) to (10) or the reagent according to (19).
(41) The function inhibitor according to (29) above, wherein the function inhibition is inhibition of transport of the KPNA2 protein-KPNA2 protein binding substance complex into the cell nucleus.
(42) A vector comprising the double-stranded DNA according to (18).
(43) A cell transformed with the vector according to (42).

(44) The aptamer according to any one of (1) to (10), for use in a method for treating cancer and / or preventing metastasis.
(45) Use of the aptamer according to any one of (1) to (10) in the manufacture of a medicament for treating cancer and / or preventing metastasis.
(46) A step of administering the aptamer according to any one of (1) to (10) above or the pharmaceutical composition according to (27) above to a patient in need of cancer treatment and / or metastasis prevention. A method for treating cancer and / or preventing metastasis.
(47) including a step of administering the aptamer according to any one of (1) to (10) or the pharmaceutical composition according to (27) above to a cancer patient including cells in which expression of KPNA2 protein is enhanced. A method for preventing proliferation and / or metastasis of cancer cells.

(48) An RNA aptamer that has binding ability to the KPNA2 protein and does not have substantial binding ability to the KPNA1 protein.
(49) An RNA aptamer that has an ability to bind to the KPNA2 protein and has an inhibitory activity with respect to cell nuclear transport through the KPNA2 protein of an NLS-containing protein.
(50) The RNA aptamer according to (49), which has no substantial binding ability to the KPNA1 protein.
(51) The RNA aptamer according to any one of (48) to (50), which has a binding ability showing a dissociation constant (K _D ) of 200 nM or less with respect to a human KPNA2 protein.
(52) A) including the base sequence shown in SEQ ID NO: 1, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 1. The RNA aptamer according to any one of (48) to (51), wherein
(53) A) including the base sequence shown in SEQ ID NO: 2, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2. The RNA aptamer according to any one of (48) to (51), wherein
(54) The RNA aptamer according to any one of (48) to (53), wherein the NLS-containing protein has no substantial inhibitory activity with respect to cell nuclear transport via the KPNA1 protein.

  The RNA aptamer of the present invention enables specific detection, concentration, purification, quantification of KPNA2 protein, and inhibition of transport of NLS-containing substances to the cell nucleus via KPNA2 protein. Further, since the KPNA2 protein is a cancer marker, cancer cells can be detected. In other words, a cancer test reagent or kit can be provided by using the RNA aptamer of the present invention. Furthermore, by utilizing the inhibitory action, the RNA aptamer of the present invention or a composition containing the same can be used as a cell growth inhibitor. If the target cell is a cancer cell, the cell growth inhibitor can be used as a therapeutic agent for cancer or a pharmaceutical composition for suppressing metastasis of cancer.

FIG. 1 is a diagram schematically showing a transport mechanism of an NLS-containing substance into a nucleus through a nuclear membrane hole. Importin α-1 (KPNA2), one of the nuclear transport receptors, recognizes NLS rich in basic amino acids and forms a complex of three types of proteins with importin β (Importin-beta-KPNA2-NLS) Cargo complex). This complex passes through the nuclear pore due to the affinity between importin β and the constituent protein of the nuclear pore. FIG. 2 is a diagram showing the sequences of aptamers 76, 72 and 21, which are RNA aptamers obtained by the present invention, and the secondary structure model of each RNA aptamer molecule calculated by the BayesFold program. FIG. 3 is a diagram showing the results of analyzing the interaction between the KPNA2 protein and the aptamers 76, 72, or 21. When no protein was added and mouse KPNA2 protein 246 nM, 492 nM, or 984 nM was added, the interaction with various aptamers was confirmed by a filter binding assay on the membrane. When aptamer 76 or 72 was used, signal enhancement depending on the amount of KPNA2 protein added was observed. FIG. 4 a) is a diagram showing the results of analyzing the interaction between KPNA2 protein and aptamer 76 or 72. When no protein was added and mouse KPNA2 protein 37 nM, 74 nM, 148 nM, 296 nM, or 592 nM was added, the interaction with various aptamers was confirmed on the membrane by a filter binding assay. Even when either aptamer 76 or 72 was used, signal enhancement depending on the amount of KPNA2 protein added was observed. On the other hand, when the mouse KPNA1 protein was added at 72 nM, 144 nM, 288 nM or 576 nM, the signal of the binding between the aptamer and the protein was almost the same as the background, or was not observed at all. FIG. 4b) is a plot of the ratio of the protein bound to the aptamer in the KPNA2 protein based on the result shown in FIG. 4a) (% of binding) and the relationship with the concentration of the added KPNA2 protein. It is. The diagram on the left shows the results when aptamer 76 is used, and the diagram on the right shows the results when aptamer 72 is used.

FIG. 5 is a diagram schematically showing an experiment for analyzing the nuclear transport ability using the KLSNA2 protein of an NLS-containing substance and an experiment for inhibiting the nuclear transport ability using an aptamer. The upper row shows an experiment for analyzing nuclear transport ability. The cultured cells are solubilized by administration of Digitonin, and then incubated with NLS protein (GST-NLS-GFP), importin β-1 and importin α-1 (KPNA2) added thereto. NLS protein is nuclear transported, and its nuclear localization is confirmed by the localization of GFP fluorescence in the nucleus. The lower part shows an experiment for analyzing that the nuclear transport ability is inhibited by adding an aptamer that specifically binds to importin α-1 in the experimental system shown in the upper part. When importin α-1-aptamer complex is added instead of importin α-1, the nuclear transport ability of NLS protein is inhibited. In this case, GFP fluorescence indicating intracellular distribution of the protein indicates reduced nuclear localization. FIG. 6a) is a diagram showing the results of an actual analysis experiment of the nuclear transport ability of the NLS protein shown in the upper part of FIG. When KPNA2 protein, importin β-1 and NLS protein (NLS-GFP) are added, the fluorescence of GFP indicating the presence of NLS protein indicates nuclear localization. FIG. 6b) shows the results with the buffer control as a control of FIG. 6a). FIG. 6c) is a diagram showing the results of actually conducting an analysis experiment in which the nuclear transport ability of the NLS protein shown in the lower part of FIG. 5 is inhibited by an aptamer. When KPNA2 protein, importin β-1, NLS protein (NLS-GFP), and aptamer 76 are added, the fluorescence of GFP indicating the presence of NLS protein indicates reduced nuclear localization. FIG. 6d) is a diagram showing the results of actual analysis experiments in which the nuclear transport ability of the NLS protein shown in the lower part of FIG. 5 is inhibited by aptamers. When KPNA2 protein, importin β-1, NLS protein (NLS-GFP), and aptamer 72 are added, the fluorescence of GFP indicating the presence of NLS protein indicates reduced nuclear localization. Fig. 6e) is a control experiment of Fig. 6c) and d), and shows the result of an experiment in which tRNA was added instead of aptamer 76 or 72. GFP fluorescence indicating the presence of NLS protein indicates nuclear localization. FIG. 7a) is a diagram showing the results of an actual analysis analysis of the nuclear transport ability of the NLS protein shown in the upper part of FIG. When KPNA1 protein, importin β-1 and NLS protein (NLS-GFP) are added, the fluorescence of GFP indicating the presence of NLS protein indicates nuclear localization. FIG. 7b) shows the results with the buffer control as a control of FIG. 7a). FIG. 7c) is a diagram showing the results of an actual analysis experiment in which the nuclear transport ability of the NLS protein shown in the lower part of FIG. 5 is inhibited by an aptamer. When the KPNA1 protein, importin β-1, NLS protein (NLS-GFP), and aptamer 76 are added, unlike the case of FIG. 6c), the nuclear transport ability of the NLS protein is not inhibited, indicating the presence of the protein. GFP fluorescence indicates nuclear localization. FIG. 7d) is a diagram showing the results of actual analysis experiments in which the nuclear transport ability of the NLS protein shown in the lower part of FIG. 5 is inhibited by aptamers. When KPNA1 protein, importin β-1, NLS protein (NLS-GFP), and aptamer 72 are added, the nuclear transport ability of the NLS protein is not inhibited, indicating the presence of the protein, unlike the case of FIG. 6d). GFP fluorescence indicates nuclear localization. Fig. 7e) is a control experiment of Fig. 7c) and d), and shows the result of an experiment in which tRNA was added instead of aptamer 76 or 72. GFP fluorescence indicating the presence of NLS protein indicates nuclear localization. FIG. 8 a) shows the nuclear translocation ability observed in the experiment shown in FIG. 6 quantified by the fluorescence intensity of the GFP fluorescence in the cell nucleus portion and expressed as a relative value to the control. The GFP fluorescence of the cell nucleus portion derived from the NLS protein in the experimental system (Control) of FIG. In the figure, aptamer 76, aptamer 72, and tRNA represent the GFP fluorescence of the cell nucleus portion in the experimental system of FIGS. 6c), 6d), and 6e), respectively, relative to the control. The relative value is shown by the height of the bar, and the standard deviation is also shown. When aptamers 76 and 72 were used, it was shown that the nuclear transport ability of NLS protein was remarkably inhibited. FIG. 8 b) shows the nuclear translocation ability observed in the experiment shown in FIG. 7 quantified by the fluorescence intensity of the GFP fluorescence in the cell nucleus portion and expressed as a relative value with respect to the control. The GFP fluorescence of the cell nucleus portion derived from the NLS protein in the experimental system (Control) of FIG. In the figure, aptamer 76, aptamer 72, and tRNA show the GFP fluorescence of the cell nucleus portion in the experimental system of FIGS. 7c), 7d), and 7e), respectively, relative to the control. The relative value is shown by the height of the bar, and the standard deviation is also shown. When any of the aptamers 76, 72, and tRNA is used, no significant change is observed in the nuclear transport ability of the NLS protein as compared to the control.

(1) Nucleic acid aptamer acquisition method Aptamers, which are functional nucleic acids, are produced in vitro through a series of processes including “selection and amplification” from a nucleic acid library containing a myriad of molecular species, such as a method called “SELEX”. Can be obtained as a substance that specifically binds to the target compound (for example, JP 2006-320289 A, JP 2009-207491 A, or JP 2009- 165394).
(2) Preparation method of RNA aptamer RNA aptamer can be appropriately prepared by chemical synthesis or transcription of template DNA.
The method of chemically synthesizing nucleic acids is a technique well known to those skilled in the art, and RNA having a desired sequence can be artificially synthesized. It is also possible to use a contract synthesis service provided by a company.
DNA consisting of a sequence that produces a desired RNA aptamer by transcription can be cloned into a vector as a double-stranded DNA together with its complementary DNA. The vector can include sequences used for RNA transcription, such as a T7 RNA promoter. The desired RNA aptamer can be appropriately prepared in vitro by using a vector and an RNA polymerase such as T7 polymerase.
The vector can be stably stored in a dry state or dissolved in an appropriate buffer. In addition, host cells can be transformed with a vector, and the vector can be stably stored for a long time in the form of transformed cells.

(3) Importin α protein, importin α gene Information on the amino acid sequence of the KPNA2 (importin α-1) protein and the base sequence of the nucleic acid encoding the protein is known, and those skilled in the art can obtain it appropriately by accessing the database. it can. For example, the sequence information of human KPNA2 (alias QIP2, RCH1, IPOA1, or SRP1alpha) is registered in NCBI as accession numbers NM_002266 and NP_002257.
The sequence information regarding proteins other than KPNA2 protein such as KPNA1 protein and importin β-1, and the base sequence information of the nucleic acid encoding these proteins can also be appropriately obtained from the database as in the case of KPNA2.
Various nucleic acids related to the present invention such as the KPNA2 gene can be appropriately prepared by gene cloning techniques well known to those skilled in the art.
Various proteins related to the present invention such as KPNA2 protein can be prepared as recombinant proteins by gene recombination techniques well known to those skilled in the art.

(4) RNA aptamer of the present invention The RNA aptamer of the present invention is derived from a clone obtained by the SELEX method and has the ability to specifically bind to the KPNA2 protein.
(4-1)
In one embodiment, the RNA aptamer of the present invention has a binding ability to a human KPNA2 protein having a dissociation constant (K _D ) of 2 μM or less, preferably 600 nM or less, more preferably 200 nM or less, and most preferably 150 nM or less. RNA aptamer. Here, the RNA aptamer of the present invention can bind to a KPNA2 protein derived from a mammal species other than human, for example, a mouse or rat-derived KPNA2 protein with an affinity equivalent to that of the human KPNA2 protein. Good. As another preferred embodiment, the RNA aptamer of the present invention may have a particularly high binding affinity for human KPNA2 protein among the molecular species of KPNA2 protein. Aptamers 76 and 72 described below as specific examples of RNA aptamers of the present invention are all exhibited high binding affinity for either human KPNA2 protein and mouse KPNA2 proteins, K _D value between the protein about 150 nM is indicated.

Here, the term dissociation constant (K _D ), as used herein, refers to the dissociation constant obtained from the ratio of K _d to K _a (ie, K _d / K _a ), Expressed as molarity (M). K _D values of the nucleic acid aptamers can be determined using methods well established in the art. A preferred method for determining the K _D of the nucleic acid aptamers, using surface plasmon resonance, preferably include using a biosensor system such as a Biacore (R) system. Incidentally, the term K _a, as used herein, specific RNA aptamer - shall refer to a substrate (importin -α protein) association rate of interaction. On the other hand, the term _Kd , as used herein, refers to the dissociation rate of a specific RNA aptamer-substrate (importin-α protein) interaction.

(4-2)
In one embodiment, the RNA aptamer of the present invention is an RNA aptamer that has a binding ability to the KPNA2 protein and does not have a substantial binding ability to the KPNA1 protein.
Examples of the binding ability desired for the KPNA2 protein include the affinity exemplified in the above (4-1).

  Here, “substantially does not bind” means that the RNA aptamer and the KPNA1 protein do not bind or do not bind with high affinity. For example, it does not bind to the KPNA1 protein at a detectable level (ie, the binding to the KPNA1 protein is below the background) or binds at a detectable level, but its binding is very weak. This means that it is clearly less than the binding to the KPNA2 protein, and it binds only to the extent that those skilled in the art determine that it is not binding to the KPNA1 protein. Preferably, the RNA aptamer of the present invention is an RNA aptamer that binds only to the KPNA2 protein and does not bind to the KPNA1 protein at a detectable level. For example, in the following examples, the radioaffinity-labeled RNA aptamer of the present invention interacts with KPNA1 protein or KPNA2 protein on a filter, and the binding affinity is examined by measuring the count on the filter. When binding is detected only at a background level when examined by the method, it can be determined that the binding is not possible at a detectable level. The RNA aptamer of the present invention is not limited to KPNA1 protein, and does not substantially bind to KPNA protein molecular species other than KPNA2 protein, and preferably does not bind at a detectable level.

(4-3)
In one aspect, the RNA aptamer of the present invention is an RNA aptamer that has an ability to bind to the KPNA2 protein and has an inhibitory activity on the nuclear transport of the NLS-containing protein via the KPNA2 protein.
Examples of the binding ability desired for the KPNA2 protein include the affinity exemplified in the above (4-1).
The inhibitory activity regarding cell nuclear transport can be evaluated by the percentage of inhibition of cell transport through the KPNA2 protein of GST-NLS (derived from SV40) -GFP, which is a model transport substrate. For example, when a sufficient amount of RNA aptamer is added to the system, the nuclear transport amount of the model transport substrate is at least 12% or more, preferably 24% or more, compared to when no RNA aptamer is added or when control tRNA is added. If it decreases, it can be said to have “inhibitory activity”. Here, for nuclear transport, for example, solubilized HeLa cells can be tested as materials. Moreover, the amount of nuclear transport can be converted or compared from the measured value of the fluorescence level derived from the GFP portion of the model transport substrate.

NLS is a specific amino acid sequence possessed by a protein that is selectively transported into the nucleus. It was first revealed in 1984 as the amino acid sequence present in the SV40T antigen. A typical example of NLS is a unipolar (monopartite) type consisting of one basic amino acid cluster like SV40T antigen, and two basic amino acid clusters sandwiching dozens of amino acids like nucleoplasmin. Examples include the existing bipolar (biperpite) type, as well as N-terminal and C-terminal motifs. Many of these NLS are thought to be directly recognized by specific receptors of the importin β family. Specific examples of NLS amino acid sequences are summarized in reviews and the like and are well known to those skilled in the art.
The RNA aptamer of the present invention binds to the KPNA2 protein with high affinity, and preferably has an activity of inhibiting the nuclear transport ability of the NLS-containing protein transported into the cell nucleus as a complex with the KPNA2 protein and importin β-1. Is.

(4-4)
In one embodiment, the RNA aptamer of the present invention is an RNA aptamer that has a binding ability to the KPNA2 protein and does not have a substantial inhibitory activity on the nuclear transport of the NLS-containing protein via the KPNA1 protein.
Examples of the binding ability desired for the KPNA2 protein include the affinity exemplified in the above (4-1).
The inhibitory activity regarding cell nuclear transport can be evaluated by the percentage of inhibition of cell transport through the KPNA2 protein of GST-NLS (derived from SV40) -GFP, which is a model transport substrate. For example, when a sufficient amount of RNA aptamer is added to the system, the decrease in the amount of nuclear transport of the model transport substrate is less than 12%, preferably 6%, compared to when no RNA aptamer is added or when control tRNA is added. When it is less than the above (in any case, the amount of transport in the nucleus may be increased), it can be said that it has no substantial inhibitory activity.

(4-5)
The RNA aptamer of the present invention is an RNA aptamer having any one or more properties among the above (4-1) to (4-4).

(4-6)
A specific example of the RNA aptamer of the present invention is an RNA aptamer comprising the base sequence of SEQ ID NO: 1 or an RNA aptamer consisting of the base sequence of SEQ ID NO: 1 (aptamer 76).
[Aptamer 76]
5'- ggauccugagcuacugacggguuaugugucaguccccagguaaugcugaggcuuuugguucauuuggccgguuguggcaccacuacugaccauacac -3 '(SEQ ID NO: 1)
As an equivalent of the above RNA aptamer, although it differs from the above RNA aptamer in that one or several bases are deleted, substituted, inserted or added to the base sequence of SEQ ID NO: 1, it binds to the KPNA2 protein. Among the above (4-1) to (4-4), those having any one or more properties are also included in the RNA aptamer of the present invention.
Here, “1 or several bases” means 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, Means either ~ 2 bases or 1 base.

(4-7)
Another specific example of the RNA aptamer of the present invention is an RNA aptamer comprising the base sequence of SEQ ID NO: 2 or an RNA aptamer comprising the base sequence of SEQ ID NO: 2 (aptamer 72).
[Aptamer 72]
5'- ggauccugagcuacugacuuugggucgaauugguuggcucgcccucuucuuggaauucaggagggcgauugaacggacaccacuacugaccauacac -3 '(SEQ ID NO: 2)
As an equivalent of the above RNA aptamer, although it differs from the above RNA aptamer in that one or several bases are deleted, substituted, inserted or added to the base sequence of SEQ ID NO: 2, it binds to the KPNA2 protein. Among the above (4-1) to (4-4), those having any one or more properties are also included in the RNA aptamer of the present invention.
Here, “1 or several bases” means 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, Means either ~ 2 bases or 1 base.

(4-8)
As long as the RNA aptamer of the present invention maintains at least one desired property, nucleotides in the sequence may be chemically modified.
As an example of chemical modification, the 2 ′ position (−0H group) of the ribose moiety in the pyrimidine nucleotide is a fluorine atom, a methoxy group, an amino group, or a 2 ′, 4′-BNA group (a bridging group between the 2 ′ position and the 4 ′ position). ), And any atom or group in the group consisting of hydrogen atoms. Since RNA is susceptible to degradation by ribonuclease, substitution of a part or all of the 2 ′ position in a pyrimidine nucleotide with the above atom or group (the aspect of chemical modification in each pyrimidine nucleotide may be the same or different) This is advantageous in protecting RNA aptamers from degradation by ribonucleases.
Another example of the chemical modification is that the 3 ′ end and / or the 5 ′ end is modified with inburst deoxythymidine (idT) or polyethylene glycol. Such modifications are also advantageous in protecting RNA aptamers from degradation by ribonucleases.
Modification at the 2 ′ position in the pyrimidine nucleotide and modification at the 3 ′ end and / or the 5 ′ end may coexist in one RNA aptamer molecular species.
Chemical modification of nucleic acids can be appropriately performed by those skilled in the art using known techniques. It is also possible to use modified nucleotides during chemical synthesis. For example, substitution of the 2 ′ position of a cytidine residue or uridine residue with a fluorine atom (fluorination) was described in Suenaga E and Kumar PKR, Acta Biomaterialia (2014) vol. 10, pp. 1314-1323. Techniques can be employed.

(4-9)
The RNA aptamer of the present invention can be labeled. Examples of labels include radioisotope (RI) labels and fluorescent labels. As the RI label, a label using a nucleotide containing ³² P is preferably exemplified. As a fluorescent label, a label using a fluorescent substance such as fluorescein, rhodamine, Texas red, or a derivative thereof is preferably exemplified. The RNA aptamer of the present invention can also be labeled by using a digoxigenin (DIG) -binding nucleotide.

(4-10)
The RNA aptamer of the present invention can bind a functional compound at an arbitrary position in the molecule. The bond between the RNA aptamer of the present invention and the functional compound may be either a covalent bond or a non-covalent bond. The RNA aptamer of the present invention may be a complex bound to one or more same or different functional compounds. Here, the functional compound is not particularly limited as long as it newly adds some function to the RNA aptamer of the present invention. As the functional compound, tag molecules such as biotin and maltose are preferably exemplified. Since biotin specifically binds to avidin and streptavidin, binding activity can be measured in the presence of an appropriate substrate by binding an enzyme such as alkaline phosphatase or horseradish peroxidase to avidin or streptavidin. Available. Biotin can be bound to the 5 ′ terminal site of the RNA aptamer via a linker. Other examples of functional compounds include steroids, cholesterol, lipids such as fatty acids, drug delivery vehicles such as polyethylene glycol, liposomes, microspheres, caffeine, vitamins, drugs, toxins, or enzymes. The functional compound is preferably bound to the 5 ′ end or 3 ′ end site of the RNA aptamer.

(5) Carrier comprising the RNA aptamer of the present invention The present invention provides a carrier comprising the RNA aptamer of the present invention. Here, the RNA aptamer may be unmodified, may be chemically modified as described above, may be labeled, and may be a functional compound as described above. A combined complex may also be used. The carrier is a solid phase carrier, and examples thereof include a column, a porous material, a filter, a substrate, a resin, a plate, and a filter. The carrier of the present invention can be used for, for example, concentration and purification of KPNA2 protein, and detection and quantification of KPNA2 protein. The RNA aptamer or complex containing the RNA aptamer of the present invention can be immobilized on a carrier by a known method. For example, there is a method in which a functional compound or a predetermined functional group is introduced into the RNA aptamer of the present invention or a complex containing an RNA aptamer and then immobilized on a solid phase carrier using the functional compound or the predetermined functional group. Can be mentioned.

(6) DNA that can be converted into the RNA aptamer of the present invention
DNA which produces the RNA aptamer of the present invention by transcription is provided as one embodiment of the present invention.
A specific example of the DNA of the present invention is DNA containing the base sequence of SEQ ID NO: 7 or DNA consisting of the base sequence of SEQ ID NO: 7. By transcription, an RNA aptamer 76 consisting of the base sequence of SEQ ID NO: 1 can be prepared from the DNA region corresponding to the base sequence of SEQ ID NO: 7.
As an equivalent of the above DNA, although it differs from the above DNA in that one or several bases are deleted, substituted, inserted or added to the base sequence of SEQ ID NO: 7, it has the ability to bind to the KPNA2 protein. The DNA of the present invention also includes DNA that is produced by transcription of the RNA aptamer of the present invention having any one or more of the above (4-1) to (4-4).
Another specific example of the DNA of the present invention is DNA comprising the base sequence of SEQ ID NO: 8, or DNA comprising the base sequence of SEQ ID NO: 8. By transcription, an RNA aptamer 72 consisting of the base sequence of SEQ ID NO: 2 can be prepared from the DNA region corresponding to the base sequence of SEQ ID NO: 8.
As an equivalent of the above DNA, although it differs from the above DNA in that one or several bases are deleted, substituted, inserted or added to the base sequence of SEQ ID NO: 8, it has the ability to bind to the KPNA2 protein. The DNA of the present invention also includes DNA that is produced by transcription of the RNA aptamer of the present invention having any one or more of the above (4-1) to (4-4).
Here, “1 or several bases” means 1 to 9 bases, 1 to 8 bases, 1 to 7 bases, 1 to 6 bases, 1 to 5 bases, 1 to 4 bases, 1 to 3 bases, Means either ~ 2 bases or 1 base.
Further, the DNA of the present invention may have an RNA polymerase recognition sequence at its 3 ′ end in order to prepare the RNA aptamer of the present invention by transcription. A T7 promoter sequence is preferably exemplified as the RNA polymerase recognition sequence.

(7) Other DNA of the present invention
A complementary strand DNA corresponding to the DNA of the above (6) and having a base sequence complementary thereto is also provided as another embodiment of the DNA of the present invention.
Furthermore, double-stranded DNA in which the DNA of (6) above and the corresponding complementary strand DNA are hybridized in a complementary manner is provided as another embodiment of the DNA of the present invention.
The double-stranded DNA can be appropriately amplified or modified by cloning into a cloning vector. Moreover, it can be stably stored for a long time in a dry form or in a state dissolved in an appropriate buffer.
Further, the cloned vector can be maintained in a form contained in the transformed cell by transforming the host cell. Transformed cells can be maintained, amplified or stored by known techniques.

(8) Detection of KPNA2 protein Since the RNA aptamer of the present invention has the ability to specifically bind to KPNA2 protein with high affinity, a composition containing the RNA aptamer is provided as a reagent for detecting KPNA2 protein. Is done. Here, the RNA aptamer contained in the reagent may be an RNA aptamer of any aspect described in the above (4-1) to (4-10). When the RNA aptamer of the present invention is included as a solution in the reagent, its concentration can be appropriately determined according to the purpose and use mode. For example, it is in the range of 1 nM to 10 mM, 0.1 μM to 1 mM, 1 μM to 0.1 mM. To decide. The solvent may be water or a buffer solution. The reagent can be obtained by appropriately combining components such as KPNA2 protein as a standard sample, auxiliary components such as detection probe or substrate, tRNA for negative control, buffer solution, preservative, diluent, instruction manual, etc. It can also be set as the kit for protein detection.
By applying the reagent to a biological sample, the KPNA2 protein in the sample can be detected. The specific method of detection is to use appropriate detection means depending on whether the RNA aptamer is labeled with a radioisotope, labeled with a fluorescent substance, or bound to a tag substance. It can be implemented by combining. At this time, it is also possible to use a substrate on which either a labeled aptamer or a test sample is immobilized. When quantitative detection is desired, a combination of a signal type capable of quantitative measurement and a detector is adopted, and a standard KPNA2 protein with a known content is used to perform calibration in advance in the combination of the signal and the detector. It can be carried out by creating a line and comparing the amount of signal derived from the sample with the calibration curve. For example, detection can be performed by adsorbing or fixing a sample on a membrane filter or plate, applying a reagent of the present invention containing a radiolabeled RNA aptamer, and measuring the radioactive signal after washing. The detection can also be performed in situ for cells or tissues containing cells.
The detection or quantification method may include a step of measuring the interaction between the RNA aptamer of the present invention and the KPNA2 protein in the sample. In the measurement of the interaction, surface plasmon resonance is used, and preferably, a biosensor system such as a Biacore (registered trademark) (GE Healthcare) system is used. The measurement for the interaction analysis can be performed by immobilizing either the aptamer of the present invention or the test sample on the gold thin film surface of the sensor chip by a well-known method and adding the test sample or the aptamer thereto.

(9) Detection of cancer using KPNA2 protein as an index QPNA2 is a human tumor or cancer tissue (for example, malignant melanoma, cervical cancer, esophageal cancer, lung cancer, ovarian cancer, prostate cancer, brain tumor, liver cancer, and bladder cancer) Therefore, the reagent of the present invention and the detection method using the reagent can also be used as a cancer detection reagent and a cancer cell detection method, respectively. In addition, the kit may be a kit for detecting cancer cells. In order to assist in determining whether or not it is a cancer cell, a non-cancerous normal tissue can be prepared in advance as a negative control according to the tissue from which the sample is derived, and can be tested together with the sample. As a positive control, a tissue that has been confirmed to be cancerous in advance according to the tissue of the sample can also be used in parallel. By appropriately combining with a positive control and / or a negative control, the detection method of the present invention can be used as a detection method for diagnosing cancer.

(10) Functional inhibitor of KPNA2 protein containing the RNA aptamer of the present invention The RNA aptamer of the present invention has a high affinity for the KPNA2 protein as described in, for example, (4-1) to (4-10). As described in (4-3), a preferable embodiment thereof has an inhibitory activity with respect to nuclear transport via the KPNA2 protein of the NLS-containing protein, as described in (4-3). A composition comprising an RNA aptamer having the inhibitory activity as an active ingredient is provided as a function inhibitor for KPNA2 protein. Here, the function inhibition can be said to be inhibition of transport of the KPNA2 protein-KPNA2 protein binding substance complex into the cell nucleus. Examples of the desired degree of function inhibition include the inhibition rate described in (4-3). The concentration of the RNA aptamer of the present invention contained in the function inhibitor can be appropriately determined from the same range as the concentration range in the reagent described in (8). The inhibitor may contain auxiliary components as required, such as a pH buffer. By applying the function inhibitor to cells or tissues taken out from a living body, an in vitro or ex vivo method for inhibiting the transport function (nuclear translocation ability) of the KPNA2 protein into the cell nucleus can be obtained. The application amount can be appropriately adjusted according to the shape and properties of cells and tissues, the assumed expression level of KPNA2 protein, and the like. For example, the function inhibitor of the present invention can be applied in a range of 1 to 300 μL, 3 to 100 μL, or 10 to 30 μL with respect to 1 g of raw weight.

(11) Cell growth inhibitor containing the RNA aptamer of the present invention When the nuclear aptamer of the present invention is used as an active ingredient to inhibit nuclear transport through the KPNA2 protein of the NLS-containing protein, the nucleus of the NLS-containing protein is obtained by means other than the aptamer. By analogy with the results of research examples that selectively inhibit transport, it is reasonably expected that cell homeostasis cannot be maintained, cell growth is inhibited, and in some cases, growth is completely stopped. . Therefore, the function inhibitor of KPNA2 protein of the present invention can be a cell growth inhibitor for KPNA2 protein-expressing cells. Moreover, the method of inhibiting the transport function (nuclear translocation ability) of the KPNA2 protein into the cell nucleus using the function inhibitor is an in vivo or ex vivo method for suppressing the growth of cells expressing the KPNA2 protein. can do.

(12) Pharmaceutical composition containing RNA aptamer of the present invention as an active ingredient KPNA2 is a human tumor or cancer tissue (for example, malignant melanoma, cervical cancer, esophageal cancer, lung cancer, ovarian cancer, prostate cancer, brain tumor, liver) Cancer and bladder cancer), the above-mentioned cell growth inhibitor of the present invention can be used as a pharmaceutical composition for cancer treatment and / or metastasis prevention. Moreover, by carrying out the above-described cell growth inhibition method on a living body, it can also be used as a method for treatment of proliferative diseases such as cancer and / or prevention of cancer metastasis.
The pharmaceutical composition of the present invention can be made into dosage forms such as injections, suppositories, tablets, capsules, granules, and powders. In the case of the purpose of treating cancer and / or preventing metastasis, it is desirable to use an injection for target-specific action, or to formulate it by applying DDS technology. These preparations can be produced by known methods. For example, in the case of preparing a preparation for injection, it can be prepared by dissolving or diluting a dry product or storage solution of the RNA aptamer of the present invention aseptically stored with a physiological saline or buffer for injection.
The effective dose of the RNA aptamer serving as an active ingredient as a pharmaceutical composition for treating cancer and / or preventing metastasis of the present invention is appropriately changed depending on various conditions such as the patient's condition and symptoms. Usually 0.001 to 10 mg / kg / day, preferably 0.003 to 1 mg / kg / day, more preferably 0.003 to 0.1 mg / kg / day, most preferably 0.003 to 0.03 mg / day. kg / day. This can be administered in 1 to several times a day, but conversely, by administering doses for several days at a time, the dosing interval can also be in the range of 2 days to 4 weeks or less.
The method for administering the medicament of the present invention is not particularly limited. As an administration method, it is preferable to directly inject an injection into the affected area, but it is not limited thereto. It is also possible to inject the DDS formulation intravenously.
The administration period can be adjusted as appropriate according to the condition of the patient. However, since cell proliferative diseases such as cancer are diseases that require continuous control, it is appropriate to carry out continuous administration, and it is suitable for 2 weeks or more, preferably 4 weeks or more, more preferably 8 weeks or more. Administration is performed in units of time.
The dose during the administration period can be adjusted as appropriate, but it is possible to administer a constant amount continuously, or to administer a dosage form in which a relatively high dose is administered only at the beginning of administration and then a lower maintenance amount is transferred to a constant dose. preferable.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, this invention is not limited at all by these examples.

Example 1 Importin protein and NLS protein The importin α family, KPNA2 protein, KPNA1 protein, and importin-β1 protein were prepared by Imamoto et al. (Imamoto et al., EMBO J. (1995) vol. 14, pp. 3617). -3626), O'Neill et al. (O'Neill et al., Virology (1995) vol. 206, pp. 116-125), Kose et al. (Kose et al., J. Cell Biol. (1997) vol. 139 , pp. 841-849) as a recombinant protein and purified.
NLS protein (GST-NLS-GFP), which is a model substrate for nuclear transport, is assembled according to the description of Nagoshi et al. (Nagoshi et al., Mol. Biol. Cell (1999) vol. 10, pp. 2221-2233). Manufactured and purified as a recombinant protein.

Example 2 Preparation of RNA Random Library A single-stranded DNA (ssDNA) random library having a central region of 60 bases as a random region was synthesized using an automatic DNA synthesizer, and used as template DNA. Similarly, a DNA having the following sequence was synthesized using an automatic DNA synthesizer, and used as a 5 ′ primer and a 3 ′ primer. Nucleic acids were amplified by PCR using these primers and template DNA.

[Template DNA]
5'-ag taatacgactcactatagg atcctgagctactgac-N60-caccactactgaccatacac-3 '(SEQ ID NO: 3)
(Here, N60 indicates a 60-mer sequence in which any one of A, G, C, or T is randomly arranged.)
[5'end primer]
5'-ag taatacgactcactatagg atcctgagctactgac-3 '(SEQ ID NO: 4)
[3'end primer]
5'-gtgtatggtcagtagtggtg-3 '(SEQ ID NO: 5)
In the above sequence, the underlined portion is the T7 promoter region.

PCR was performed using the above single-stranded DNA random library (about 10 ¹⁴ molecular species), 5′-end primer and 3′-end primer each 0.25 μM. PCR was limited to 8 cycles to maintain and amplify the DNA composition of the initial library.
Subsequently, in vitro transcription was performed using T7 Ampliscribe kit (Epicentre Technologies), and the amplified DNA random library was converted into an RNA random library.

Example 3 Selection in vitro Using the RNA random library 16 μg (about 10 ¹⁴ molecular species) obtained in Example 2 for selection, the RNA random library and the recombinant KPNA2 protein were mixed at a molar ratio of 7: 1. In an RNA binding buffer (10 mM HEPES, 150 mM NaCl, pH 7.4). During the sorting cycle, the protein concentration was decreased later in the cycle to sort out RNA molecules with high affinity. The RNA was heated to 95 ° C. after the selection cycle and then cooled to room temperature to form a stable structure. In the selection cycle, tRNA (total tRNA of E. coli (Roche)) was used as a competitor in order to remove non-specifically binding RNA.

After incubation with RNA and KPNA2 protein for 10 minutes at room temperature, the reaction solution containing the protein-RNA complex is pre-wetted nitrocellulose acetate immobilized in a “Pop-top” filter holder (Nucleopore). A filter (HAWP filter, pore size 0.45 μm, Merck Millipore) was applied and passed. Subsequently, the filter was washed with 1 ml of the above RNA binding buffer, and then the RNA remaining on the filter was eluted and recovered according to a conventional method. RNA recovered is, 50 mM Tris-HCl (pH 8.3), 50 mM KCl, 10 mM MgCl 2, 0.5 mM Spermidine, 10 mM DTT, 0.4 mM dNTPs, 0.4μM primers and AMV reverse transcriptase (WAKO) 25 U Reverse transcription was performed in 20 μL of the containing reaction mixture. Nucleotides and enzymes were added after the denaturation and annealing steps (10 minutes incubation at room temperature followed by 2 minutes at 90 ° C.). Reverse transcription was performed at 37 ° C. for 45 minutes.

  The resulting cDNA was amplified by PCR and used as a template to obtain RNA in the next selection round. For amplification by PCR, 20 μL of the reverse transcription mixture (cDNA reaction product) was diluted with 80 μL of PCR mixture (PrimeSTAR Max Premix (Takara, Japan), and 1 μM of each primer). The reaction mixture was detected by electrophoresis after each cycle of 95 ° C for 20 s, 54 ° C for 10 s, and 72 ° C for 20 s to obtain a product that binds with the correct molecular size. .

The PCR product was once ethanol precipitated and then dissolved and used for transcription. In vitro transcription was performed using T7 Ampliscribe kit (Epicentre Technologies) at 37 ° C. for 3 hours. After treatment with DNase I, fractionation was performed on an 8% denaturing polyacrylamide gel. RNA was extracted from the gel and purified by ethanol precipitation, then quantified and used in the next selection and amplification cycle.
During the selection process, pre-filtration was performed in the selection of each generation to avoid concentration of non-specifically binding RNA.

Example 4 Aptamer Isolation and Sequence Identification To isolate selected aptamers, the PCR product obtained in cycle 8 was cloned directly into the vector pCRII (Invitrogen). DNA was isolated from individual clones by the alkali miniprep method, and its nucleotide sequence was determined using a DNA sequencer. The secondary structure of the aptamer was predicted by the MFold program.
According to the sequence analysis of the obtained clones, aptamers were roughly divided into aptamer 76 (SEQ ID NO: 1) and aptamer 72 (SEQ ID NO: 2).
The sequences of aptamer 76 and aptamer 72 are shown below.
[Aptamer 76]
5'- ggauccugagcuacugacggguuaugugucaguccccagguaaugcugaggcuuuugguucauuuggccgguuguggcaccacuacugaccauacac -3 '(SEQ ID NO: 1)
[Aptamer 72]
5'- ggauccugagcuacugacuuugggucgaauugguuggcucgcccucuucuuggaauucaggagggcgauugaacggacaccacuacugaccauacac -3 '(SEQ ID NO: 2)
The abundance ratios of aptamer 76 and aptamer 72 in the pool were 22% and 4%, respectively. In addition, aptamer 21 (SEQ ID NO: 6) was identified as a minor molecular species among the sequenced clones.
The secondary structure model of these aptamers calculated by the MFold program is shown in FIG.

Example 5 Interaction between RNA aptamer and KPNA2 protein The affinity between KPNA2 protein and RNA aptamer was measured by a filter binding assay. The KPNA2 protein was transcribed with the recombinant protein of Example 1, and the RNA aptamer (aptamers 76, 72, and 21) was transcribed with T7 RNA polymerase from the DNA cloned into the vector of Example 4 (the procedure is the same as in Example 3). RNA was used for each.
The analysis used the method similar to the method of Kumar et al. (Kumar et al., Virology (1997) vol. 237, pp. 270-282). In this method, the RNA aptamer was used after being labeled with 0.5 mCi / ml [ ^α-32 P] ATP.
In the binding reaction, a 10-fold excess of E. coli tRNA at a molar concentration was added as a non-specific competitive inhibitor, and 20 nM labeled RNA aptamer and mouse KPNA2 protein (246 nM, 492 nM or 984 nM) were mixed and bound. After binding, the reaction solution was passed through a filter. The filter was washed with 1 mL of the above RNA binding buffer, dried in air, and then the radioactivity of labeled RNA remaining on the filter was detected and quantified with an image analyzer (BAS2000, manufactured by FUJIFILM Corporation) ( FIG. 3).
Both aptamer 76 and aptamer 72 showed high affinity with KPNA2 protein, and the dissociation constant (K _D ) thereof was 150 nM.
Furthermore, when a similar experiment was performed using a recombinant protein of human KPNA2, both aptamer 76 and aptamer 72 showed high affinity with human KPNA2 protein. The dissociation constant (K _D ) was almost the same as described above, and all were 150 nM. When the amino acid sequences of mouse KPNA2 protein and human KPNA2 protein are compared, the identity is about 94% (Tsuji et al., FEBS Lett. (1997) vol. 416, pp. 30-34). Both aptamers 76 and 72, which are RNA aptamers of the present invention, show the same high binding affinity for mouse and human-derived KPNA2 proteins.
On the other hand, aptamer 21 did not show high binding affinity with KPNA2 protein.

Example 6 Interaction between RNA aptamer and KPNA1 protein or KPNA2 protein As in Example 5, a filter binding assay was performed to test the interaction between the RNA aptamer of the present invention and KPNA protein. As the KPNA protein, not only the KPNA2 protein but also the KPNA1 protein was used. The concentration of KPNA protein reacted with 20 nM labeled RNA aptamer was 37, 74, 148, 296 or 592 nM for KPNA2 protein and 72, 144, 288 or 576 nM for KPNA1 protein. The signal detected on the filter is shown in FIG. 4a).
As is apparent from the signal amount shown in the figure, both aptamer 76 and aptamer 72 did not show high binding affinity with mouse KPNA1 protein, and were found to have substantially no binding ability with KPNA1 protein. .
Further, in the case of using the KPNA2 protein, the binding rate was calculated from the detected signal intensity, and the relationship between the concentration of each KPNA2 protein and the binding rate was plotted in FIG.
In addition, since practical binding activity between the aptamer 21 and the KPNA2 protein was not recognized in Example 5, the aptamer 21 was not tested in the examples after this example.

Example 7 Transport of NLS-containing protein into cell nucleus Transport of NLS-containing protein into the cell nucleus is performed by solubilizing cultured cells such as HeLa cells with a drug, adding a labeled model substrate, and incubating. It can be tested by a method for confirming the transport of the model substrate into the cell nucleus (for example, the method of Adam et al. (Adam et al., J. Cell Biol. (1990) vol. 111, pp. 807-816)). A schematic diagram of this test system is shown in the upper part of FIG. Cultured cells (HeLa cells and the like) are solubilized by administration of Digitonin, and then added with NLS protein (GST-NLS-GFP), importin β-1, and importin α-1 (KPNA2). Incubate. Here, GST-NLS-GFP is a model substrate, and includes NLS derived from SV40 large T antigen (Example 1). NLS protein is nuclear transported, and its nuclear localization is confirmed by the localization of GFP fluorescence in the nucleus.
In the above experimental system, an experiment for analyzing whether or not the nuclear transport ability is inhibited by adding an aptamer that specifically binds to importin α-1 is schematically shown in the lower part of FIG. When importin α-1-aptamer complex is added instead of importin α-1, if the nuclear transport ability of NLS protein is inhibited, GFP fluorescence indicating intracellular distribution of the protein will be Or show reduced nuclear localization.
6 and 7 show specific results of the experimental system shown in the schematic diagram of FIG. In each figure, HeLa cells were seeded on a slide glass and then solubilized by treatment with 40 μM / mL digitonin (Nacalai Tesque) for 5 minutes. Solubilized cells, except for the experiment for buffer control (FIG. 6b) and FIG. 7b)), importin β-1 (600 nM) and NLS protein (shown as NLS-GFP in the figure) (400 nM), and KPNA2 Protein (400 nM) (FIG. 6) or KPNA1 protein (400 nM) (FIG. 7) was added. In addition, aptamer 76 (5 μM) is used in the systems of FIGS. 6c) and 7c), aptamer 72 (5 μM) is used in the systems of FIGS. 6d) and 7d), and tRNA of E. coli is used in the systems of FIGS. 6e) and 7e). 5 μM) was added respectively. In the system in which RNA aptamer or tRNA is added, a KPNA protein and aptamer or tRNA that have been pre-incubated at room temperature for 5 minutes were used for the addition. Furthermore, Ran protein (4 μM), NTF2 protein (350 nM), GTP (0.5 mM) and ATP regeneration system are added to each system. Following the addition of the elements, an incubation of 8 minutes at 37 ° C. was performed, and then the samples were fixed by treatment with formaldehyde solution (3.7% concentration) for 5 minutes. After fixation, washing with a phosphate buffer (PBS) was performed twice, and the localization of NLS protein was observed with an inverted fluorescence microscope. In addition, the fluorescence intensity of the GFP signal in the nucleus was also measured.
In FIG. 6, nuclear localization of the fluorescence signal of GFP was recognized only in the panels a) and e). On the other hand, in the panels c) and d), the fluorescence signal of the cell nucleus portion was relatively weak and a decrease in the cell nuclear localization was observed. Therefore, aptamers 76 and 72 had NLS in the presence of KPNA2 protein, respectively. It was confirmed that the contained protein has an activity to inhibit cell nuclear transport via NLS.
On the other hand, in FIG. 7, the nuclear localization of the GFP fluorescence signal was observed in all the panels except for the panel b) which is a buffer control. From this, aptamers 76 and 72 were not confirmed to have an activity of inhibiting NLS-mediated nuclear transport of NLS-containing proteins in the presence of KPNA1 protein.

Example 8 Quantification of cell nuclear transport function by aptamer Inhibition of nuclear transport ability of KPNA2 protein and KPNA1 protein by an aptamer was quantified. ImageJ analysis software (Schneider et al., NIH Image to ImageJ: 25 years of image analysis. Nature Meth. (2012) vol. 9, pp. 671-675) was used for the fluorescence microscope images obtained through Example 7. Then, the average value of luminance was obtained by histogram analysis of the nucleoplasmic part of the cell nucleus, and the numerical value converted to 1 when the aptamer as a control was not added was obtained (FIGS. 8a and 8b)).
As a result, 0.665 (66.5%) (standard deviation 0.056) when aptamer 76 was added to KPNA2 protein, and 0.714 (71.4%) (standard deviation 0. 6) when aptamer 72 was added. 051), the transportation decreased. Since the variation of the measured value in the control was about 0.12, the decrease observed when the aptamer 76 or 72 was added can be said to show a clear decrease in the nuclear transport function. On the other hand, when tRNA not binding to KPNA2 protein was added, it was 1.096 (standard deviation 0.13), and no decrease was observed (FIG. 8a)).
For KPNA1 protein, aptamer 76 (1.079 (standard deviation 0.17)), aptamer 72 (1.077 (standard deviation 0.20)) and tRNA (1.138 (standard deviation 0.14)). No decrease was observed with any addition of)) (FIG. 8b)).

  The RNA aptamer of the present invention has a specific binding ability to KPNA2 protein, can be used for detection, concentration, purification, and quantification of KPNA2 protein, and has nuclear transport activity of NLS-containing protein via NLS of KPNA2 protein. Since it can be inhibited and the physiological function of cells and tissues can be regulated by the inhibitory action, it has not only usefulness in biochemical tests but also physiological and / or pharmacological usefulness, and further cancer treatment It also has utility as a medicine such as drugs. Therefore, the present invention has industrial applicability.

Claims (31)

An RNA aptamer having a binding ability showing a dissociation constant (K _D ) of 200 nM or less for human KPNA2 protein. A) including the base sequence shown in SEQ ID NO: 1, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 1.
The RNA aptamer according to claim 1.   The RNA aptamer according to claim 1, comprising the base sequence represented by SEQ ID NO: 1. A) including the base sequence shown in SEQ ID NO: 2, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 2.
The RNA aptamer according to claim 1.   The RNA aptamer according to claim 1, comprising the base sequence represented by SEQ ID NO: 2.   The RNA aptamer according to any one of claims 1 to 5, which has a chemically modified nucleotide.   The 2 ′ position of the ribose moiety in each pyrimidine nucleotide is the same or different and is unsubstituted or any of the group consisting of a fluorine atom, a methoxy group, an amino group, a 2 ′, 4′-BNA group, and a hydrogen atom. The RNA aptamer according to claim 6, wherein the RNA aptamer is substituted with any atom or group.   The RNA aptamer according to any one of claims 1 to 7, wherein the 3 'end and / or the 5' end is modified with inburst deoxythymidine (idT) or polyethylene glycol.   The RNA aptamer according to any one of claims 1 to 8, which is labeled.   The RNA aptamer according to any one of claims 1 to 8, to which a functional compound is bound.   The support | carrier formed by fixing the RNA aptamer as described in any one of Claims 1-10.   DNA which can be converted into the RNA aptamer according to any one of claims 1 to 5 by transcription. A) including the base sequence shown in SEQ ID NO: 7, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 7.
The DNA according to claim 12. A) including the base sequence shown in SEQ ID NO: 8, or B) including the base sequence in which one or several bases are deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 8.
The DNA according to claim 12.   The DNA according to any one of claims 12 to 14, wherein an RNA polymerase recognition sequence is added to the 3 'end.   The DNA according to claim 15, wherein the RNA polymerase recognition sequence is a T7 promoter sequence.   A complementary strand DNA having a base sequence complementary to the DNA according to any one of claims 12 to 16.   A double-stranded DNA in which the DNA according to any one of claims 12 to 16 and its complementary DNA are hybridized in a complementary manner.   A reagent for detecting KPNA2 protein, comprising the RNA aptamer according to any one of claims 1 to 10.   A method for detecting a KPNA2 protein, comprising a step of bringing the RNA aptamer according to any one of claims 1 to 10, the carrier according to claim 11 or the reagent according to claim 19 into contact with a sample derived from a living body. .   A method for detecting a cell expressing a KPNA2 protein, wherein the RNA aptamer according to any one of claims 1 to 10 or the reagent according to claim 19 is applied to a sample derived from a living body.   The detection method according to claim 21, which is a method for detecting cancer cells.   A method for detecting KPNA2 protein in a cell, comprising a step of bringing the RNA aptamer according to any one of claims 1 to 10 or the reagent according to claim 19 into contact with a sample derived from a living body.   The detection method according to claim 23, wherein the cell is a cancer cell. A detection method for the diagnosis of cancer, comprising:
A) A step of contacting the RNA aptamer according to any one of claims 1 to 10 or the reagent according to claim 19 with a sample derived from a living body, and B) an RNA aptamer specifically bound to the sample. Including the step of detecting
Method.   The pharmaceutical composition which contains the RNA aptamer as described in any one of Claims 1-10 as an active ingredient.   27. The pharmaceutical composition according to claim 26, which is a composition for cancer treatment.   A cell growth inhibitor for KPNA2 protein-expressing cells, comprising the RNA aptamer according to any one of claims 1 to 10 as an active ingredient.   The function inhibitor with respect to KPNA2 protein which contains the RNA aptamer as described in any one of Claims 1-10 as an active ingredient.   An in vitro or ex vivo method for inhibiting the nuclear translocation ability of the KPNA2 protein, wherein the RNA aptamer according to any one of claims 1 to 10 or a sample derived from a living body is used. Applying a functional inhibitor against the described KPNA2 protein.   An in vitro or ex vivo method for suppressing the proliferation of a cell expressing a KPNA2 protein, wherein the RNA aptamer according to any one of claims 1 to 10 is applied to a sample derived from a living body. A method comprising applying a function inhibitor for the KPNA2 protein according to 29.