KR20130111779A - A method for the diagnosis of pancreatic cancer using alppl2 protein - Google Patents

Abstract

PURPOSE: A method for diagnosing pancreatic cancer is provided to accurately and early diagnose pancreatic cancer because alkaline phosphatase placental like-2 (ALPPL-2) protein is specifically secreted from various pancreatic cancer cell lines. CONSTITUTION: A method for providing information for diagnosing pancreatic cancer comprises the step of measuring the amount of ALPPL2 in a patient sample. The patient sample is selected from a pancreatic tissue, pancreatic cells, blood, serum, plasma, saliva, sputum, and urine. ALPPL2 contains an amino acid sequence of sequence number 2. The amount of ALPPL2 is measured by reverse transcriptase polymerase chain reaction (RT-PCR) or western blotting.

Description

A method for the diagnosis of pancreatic cancer using ALPPL2 protein}

The present invention relates to a method for diagnosing pancreatic cancer using ALPPL2 (alkaline phosphatase placental like-2) protein.

Pancreatic adenocarcinoma is a cancerous tissue in the pancreas. Pancreatic ductal adenocarcinoma accounts for about 90% of pancreatic adenocarcinoma. Pancreatic cancer generally refers to pancreatic adenocarcinoma (Bardeesy, N. and DePinho, RA, Nat Rev Cancer, (2002 ) 2:.. 897). Pancreatic cancer ranks 14th among the most common cancers in the world, and according to a report on the five-year survival rate of major Korean cancers published by the Ministry of Health and Welfare in 2009, the mortality rate of pancreatic cancer is 92.2%. This is because, in the case of pancreatic cancer, there is no subjective symptom, so it is difficult to diagnose early and is not easily observed even by using ultrasound or CT scan. In addition, pancreatic cancer is most likely to have a strong resistance to conventional chemotherapy treatment, and because it is not easy to remove through surgical surgery, unless it is diagnosed early, treatment is not easy.

On the other hand, in recent years, researches for actively selecting cancer-specific target proteins, that is, proteins as biomarkers, for the diagnosis and treatment of various cancers have been actively conducted. Since such biomarkers are specifically bound to cancer, studies are being actively conducted because they can be used for diagnosis, as well as can be used for cancer target specific treatment by combining the biomarkers with anticancer agents.

As described above, in order to effectively treat pancreatic cancer, it is necessary to discover pancreatic cancer specific biomarkers that can accurately diagnose pancreatic cancer early and develop a diagnostic method using the same.

The present invention has been made to solve the above-mentioned problems in the prior art, a pancreatic cancer specific biomarker Alkaline phosphatase placental like-2 (ALPPL2) protein, nucleic acid aptamer specifically binding to the ALPPL2 protein and using the same Its purpose is to provide a diagnostic method and the like.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention provides a method for providing information necessary for diagnosing pancreatic cancer, the method comprising measuring the amount of alkaline phosphatase placental like-2 (ALPPL2) in a patient's sample.

In one embodiment of the invention, the patient's sample is characterized in that it is selected from the group consisting of pancreatic tissue, pancreatic cells, blood, serum, plasma, saliva, sputum, and urine.

In another embodiment of the present invention, the ALPPL2 is characterized in that the protein comprising the amino acid sequence of SEQ ID NO: 2.

In another embodiment of the present invention, the step of measuring the amount of ALPPL2 is characterized by measuring by reverse transcriptase polymerase chain reaction or western blotting.

In another embodiment of the present invention, the step of measuring the amount of ALPPL2 is characterized in that the binding amount of the ALPPL2 protein with a target molecule that specifically binds to the ALPPL2 protein.

In another embodiment of the invention, the target molecule is characterized in that it is selected from the group consisting of nucleic acid aptamers, peptides, antigens, antibodies, small molecule ligands, substrates, enzymes and receptors.

In another embodiment, the target molecule is characterized in that the nucleic acid aptamer comprising the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a kit for diagnosing pancreatic cancer comprising a target molecule that specifically binds to ALPPL2 protein, which measures the amount of ALPPL2 (alkaline phosphatase placental like-2) protein in a patient's sample.

In one embodiment of the invention, the patient's sample is characterized in that it is selected from the group consisting of pancreatic tissue, pancreatic cells, blood, serum, plasma, saliva, sputum, and urine.

In another embodiment of the invention, the target molecule is characterized in that it is selected from the group consisting of nucleic acid aptamers, peptides, antigens, antibodies, small molecule ligands, substrates, enzymes and receptors.

In another embodiment, the target molecule is characterized in that the nucleic acid aptamer comprising the nucleotide sequence of SEQ ID NO: 1.

Since the ALPPL2 protein according to the present invention is specifically secreted by Panc-1, an early pancreatic cancer cell line, Capan-1, a late pancreatic cancer cell line, and various other pancreatic cancer cell lines, it can be used as a biomarker for accurate diagnosis of pancreatic cancer. Since it is secreted externally, it can be used for in vivo and / or in vitro diagnosis, and can also be used for circulating tumor cell detection technology that can detect pancreatic cancer cells contained in blood. In addition, since the SQ2 nucleic acid aptamer according to the present invention specifically binds only to the ALPPL2 protein, the SQ2 nucleic acid aptamer may be variously used for diagnosing and / or treating pancreatic cancer using the SQ2 nucleic acid aptamer targeting the ALPPL2 protein. It can also be used for diagnosing in vivo images. In addition, it is expected that ALPPL2 protein may be used to selectively select substances that selectively bind to ALPPL2 protein in addition to SQ2 6-30 nucleic acid aptamer and be freely applied for diagnosis and / or treatment of pancreatic cancer.

1 is a diagram showing the results of separating proteins bound with SQ2 6-30 nucleic acid aptamer.
2 is a diagram showing the results of confirming a protein specifically reacting with the SQ2 6-30 nucleic acid aptamer.
3 shows the results of confirming whether the SQ2 6-30 nucleic acid aptamer selectively binds to the ALPPL2 protein.
4 is a diagram showing the results of confirming that ALPPL2 protein is secreted into the cells.
Fig. 5 shows the results of confirming the ALPPL2 protein target orientation of the SQ2 6-30 nucleic acid aptamer.
Fig. 6 shows the results of confirming that SQ2 6-30 nucleic acid aptamer selectively binds to ALPPL2 protein.
7 shows the results of quantifying the amount of SQ2 6-30 nucleic acid aptamer bound to ALPPL2 protein.
8 shows the results of confirming ALPPL2 protein expression in various cancers.

The present inventors have completed the present invention by studying pancreatic cancer-specific biomarkers capable of accurately and accurately diagnosing pancreatic adenocarcinoma and pancreatic cancer diagnostic methods using the same.

The present invention provides an ALPPL2 (alkaline phosphatase placental like-2) protein, which is a pancreatic cancer specific biomarker.

In one embodiment of the present invention, it was confirmed that the expression of ALPPL2 protein is not increased in other cancer cells and normal cells, but is specifically increased in various types of pancreatic cancer cells. In another embodiment, the ALPPL2 protein is secreted into cells (See Examples 2 and 3).

From the above results, it was confirmed that ALPPL2 protein is a pancreatic cancer-specific biomarker and secreted out of the cells, and thus can be diagnosed in vitro using blood, serum, plasma, saliva, sputum, urine, as well as pancreatic tissue and pancreatic cells.

Accordingly, the present invention provides a method for providing information necessary for diagnosing pancreatic cancer, the method comprising measuring the amount of ALPPL2 (alkaline phosphatase placental like-2) protein in a patient's sample.

There is no restriction on the method of measuring the amount of ALPPL2 protein, but the amount of mRNA or protein of the gene can be measured according to the method used in the field of biotechnology. Preferably it is quantitative real-time polymerase chain reaction (qRT-PCR), western blotting, etc. More preferably, it is a method of measuring the binding amount of the ALPPL2 protein with a target molecule that specifically binds to ALPPL2 protein.

The type of target molecule that specifically binds to the ALPPL2 protein is not limited as long as it specifically binds to the ALPPL2 protein, RNA, and / or DNA. Preferably, the peptide, the substrate, the antigen, Antibodies, ligands, nucleic acid aptamers, enzymes, and the like. More preferably, the nucleic acid aptamer comprises a nucleotide sequence of SEQ ID NO: 1. Since the nucleotide sequence of SEQ ID NO: 1 selectively binds to the ALPPL2 protein, it may be a nucleic acid aptamer including one or more SEQ ID NOs. In addition, the target molecule may be labeled with biotin, fluorescent materials, and the like.

On the other hand, the method for providing information necessary for diagnosing pancreatic cancer according to the present invention may be provided in the form of a kit to increase portability. Accordingly, the present invention provides a kit for diagnosing pancreatic cancer comprising a target molecule that specifically binds to an alkaline phosphatase placental like-2 (ALPPL2) protein, which measures the amount of ALPPL2 protein in a patient's sample.

The pancreatic cancer diagnostic kit of the present invention may include a reaction solution, a buffer solution, and containers for performing and analyzing the detection, if necessary, and the containers may be in the form of bottles, tubes, bags, ampoules, and the like. Do not. In addition, the diagnostic kit of the present invention may have a microarray in which the nucleic acid aptamer is immobilized on a substrate, and thus may be in the form of a chip such as a DNA chip or a protein chip.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  1. Nucleic Acids Specific to Binding to Pancreatic Cancer Cell Lines Abtamer's  Produce

In order to select pancreatic cancer specific biomarkers, nucleic acid aptamers that specifically bind to pancreatic cancer tissue were prepared. SQ2 6-30 nucleic acid aptamer (SEQ ID NO: 1: AGCUUAUUCAAUUGCCU) and nucleic acid aptamer (SEQ ID NO: AGQ) 4: After producing AGCUUAUUCAUUUUUUUGAAAAGCU), biotin-modified nucleic acid aptamers were prepared by binding biotin to the ends of the nucleic acid aptamers. In the case of the nucleic acid aptamer, all C and U sequences were designated as 2'-fluoro.

Example  2. Pancreatic Cancer Specific Biomarker  Selection

2-1. SQ2  6-30 nucleic acids Abtammer  Screening for Specific Binding Proteins

In order to select proteins specifically binding to SQ2 6-30 nucleic acid aptamers, human pancreatic cancer cell lines, Panc-1 and Capan-1 cell lines, were cultured. Panc-1 cell line was added Dulbeco's Modified Eagle's Medium (DMEM) containing 10% fetal bovine serum (FBS) and incubated at 37 ° C for 5% CO ₂ for a certain period of time before trypsin The cells were removed from the culture dish by washing, and then washed twice using DMEM to which 10% FBS was added to completely remove trypsin. After adding DMEM to which 10% fresh FBS was added and incubating for 1 hour at 37 ° C. and 5% CO ₂ conditions, the membrane protein was renaturated, and the SQ2 6-30 nucleic acid prepared by the method of Example 1 was prepared. 100 pmol of aptamer and yeast tRNA competitor (Invitrogen) at 100-fold concentration were treated together with the cells, followed by incubation at 4 ° C. and 5% CO ₂ for 30 minutes. Thereafter, 150 μg of magnetic dynabead (Invitrogen) to which streptavidin is bound was treated to the cells and incubated for 30 minutes at 4 ° C. and 5% CO ₂ conditions to the cells to which the SQ2 6-30 nucleic acid aptamer was bound. The dynabead was coupled to isolate the Panc-1-ve cell line, which was not bound to the Panc-1 + ve cell line to which the SQ2 6-30 nucleic acid aptamer was bound, from the Pacn-1 cell line. Panc-1-ve cell line obtained about 100% of Panc-1-ve cell line after three passages, and Panc-1 + ve cell line obtained about 100% of Panc-1 + ve cell line after 10 passages It was. In addition, DMEM containing 10% FBS was added to Panc-1 + ve, Panc-1-ve, Panc-1, and Capan-1 cell lines, respectively, and cultured to 1 × 10 ⁸ cells at 37 ° C. and 5% CO _2. It was. The cells were washed twice briefly with a hypotonic buffer (50mM Tris-HCl, pH 7.5), and then a hypotonic buffer containing a protease inhibitor was added and the mixture was kept at 4 ° C. for 30 minutes. After incubation, the solution was washed twice with a storage buffer. Cells or cell lysates that were detached from the culture dish during the washing were collected again through centrifugation and added again to the culture dish. Thereafter, lysis buffer (5 mM MgCl ₂ , 1% Triton X-100, phosphate buffered saline) containing protease inhibitors was added to the culture plates, followed by reaction at 4 ° C. for 30 minutes to lyse cells, and centrifugation. The supernatant was obtained through separation, and the supernatant was concentrated using a 10Kd centrifugal cut-off filter (Amicon). 200 pmol of SQ2 6-30 nucleic acid aptamer prepared by the method of Example 1 and yeast tRNA competitor (invitrogen) at 100-fold concentration, or the control biotinylated mutant oligo (St Pharma. Inc.) and 100-fold in the concentrated supernatant. After addition of a yeast tRNA competitor (invitrogen) in concentration, the reaction was allowed to react for 30 minutes at 4 ° C, followed by binding to SQ2 6-30 nucleic acid aptamer using streptavidin-bound agarose beads. Alternatively, proteins bound with biotinylated mutant oligo (SQ2 mut) were separated by centrifugation. The separated proteins were washed four times using lysis buffer, and then treated with 50 units of RNAse If (MBI-Fermentas) and incubated at 37 ° C. for 10 minutes to separate proteins from agarose beads. The separated proteins were analyzed using 4-15% SDS-PAGE. The results are shown in Fig.

As shown in FIG. 1, in the Capan-1 cell line, a B1 protein of about 57Kd and a B2 protein of about 130Kd, which are proteins not specifically bound to SQ2 mut used as a control but specifically bound to SQ2 6-30, were identified. In addition, B1 protein was not detected in Panc-1-ve cell line, but B1 protein was detected in Panc-1 + ve cell line. Through the above results, it was confirmed that the B1 and B2 proteins were proteins to which SQ2 6-30 nucleic acid aptamer specifically binds.

In order to identify the sequence of the protein to which the SQ2 6-30 nucleic acid aptamer specifically binds, the amino acid sequence of the isolated protein was confirmed through LC-ESI-MS / MS, and then the type of protein was predicted through the MASCOT database. The results are shown in Table 1.

As shown in Table 1, the predicted B1 protein was confirmed to have akaline phosphatase placental like-2 (ALPPL2, SEQ ID NO: 2), and the same ALPPL2 protein was confirmed to be predicted to the B2 protein. Since the two ALPPL2 proteins may be present in dimer form by binding to each other, the B2 protein could be expected to be a combination of two ALPPL2 (B1) proteins.

[Table 1]

2-2. Pancreatic Cancer Specific Biomarker Screening

In order to select pancreatic cancer-specific biomarkers, differences in protein expression in normal pancreatic cells and pancreatic cancer cells were confirmed by DNA microarrays. For the DNA microarray, DMEM containing 10% FBS was added to Panc-1-ve, Panc-1 + ve, and Capan-1 cell lines (control) and HPDE6c6 cell line (control), a normal pancreatic cell line, at 37 ° C. After incubation at 5% CO ₂ for a certain time, total RNA was extracted from each cell line using TRI Reagent (Qiagen) and RNeasy mini kit (Qiagen), and then 10 μg of total RNA was used as a template to reverse transcriptase ( Double strand cDNA was synthesized by reverse transcriptase. The synthesized cDNA was labeled with Cy3, a fluorescent substance, and microarray was performed using a Nimblegen 385K 4-plex human microarray chip, and the top 20 proteins among 329 genes increased more than two times in Panc-1 + ve. Table 2 shows.

As shown in Table 2, it was confirmed that the expression of ALPP and ALPPL2 protein was significantly increased in Panc-1 + ve cell line and Capan-1 cell line compared to normal pancreatic cell line, and also in the Panc-1-ve cell line. It was confirmed that expression was not increased. Through the above results, it was confirmed that ALPP and ALPPL2 proteins are proteins whose expression is specifically increased in pancreatic cancer.

[Table 2]

2-3. Screening for Proteins Specific to Binding to SQ2 6-30 Nucleic Acid Aptamers

ALPP and ALPPL2 Proteins in Panc-1-ve and Panc-1 + ve Cell Lines to Determine Whether ALPP and ALPPL2 Proteins with Increased Expression in Pancreatic Cancer Specificly Respond to SQ2 6-30 Nucleic Acid Aptamers The expression level of was confirmed by quantitative real-time PCR (qRT-PCR). For qRT-PCR, mRNA was extracted from each cell line using isol-RNA lysis reagent (5 PRIME Inc.), and then cDNA was synthesized using the High Capacity cDNA Reverse Transcription kit using 1 μg of the extracted mRNA as a template. In addition, qRT-PCR was performed using the cDNA, and RNA concentration was corrected using a house keeping gene (GAPDH) gene as a comparative group. The results are shown in Fig.

As shown in FIG. 2, the ALPP protein was found to be insignificant in the expression difference between Panc-1 + ve cell line and Panc-1-ve cell line, and in the case of ALPPL2 protein, Panc-1 + ve cell line. It was confirmed that expression was increased 100 times or more than in the -1-ve cell line. The results confirmed that although ALPPL and ALPPL2 proteins had 98% homology, only ALPPL2 protein specifically reacted to binding of SQ2 6-30 nucleic acid aptamer.

Western blotting was performed to confirm that the SQ2 6-30 nucleic acid aptamer selectively binds to the ALPPL2 protein. The ALPPL2 protein is a group of GPI anchored protein (glycosylphosphatidyl inositol-ahchored proteins) that is linked to the cell membrane surface through specific glycolipids. Since the GPI anchor protein group is generally located in the lipid rafts portion of the cell membrane, the non-ionic detergent commonly used to extract the protein is not known to be effective. Extracting proteins at 4 ° C and 37 ° C using a -100 solution and a 1% Triton X-100 solution containing 0.2% saponin results in a 1% Triton X-100 solution containing 0.2% saponin. When the protein was extracted at 37 ℃ using it was confirmed that the protein is most efficiently extracted. Therefore, the following experiment was performed by extracting the membrane protein at 37 ℃ using 1% Triton X-100 solution containing 0.2% saponin. To extract the protein, DMEM containing 10% FBS was added to Panc-1 + ve, Panc-1-ve, Capan-1 cell line, and HPDE cell line (control), respectively, at 37 ° C. and 5% CO ₂ conditions. Incubated at 1X10 ⁸ cells. The cells were washed twice briefly with a hypotonic buffer (50mM Tris-HCl, pH 7.5), and then a hypotonic buffer containing a protease inhibitor was added and the mixture was kept at 4 ° C. for 30 minutes. After incubation, the solution was washed twice with a storage buffer. Then, the cells were scraped from the culture dish and collected, followed by addition of lysis buffer (150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.2% saponin, 20 mM Tris-HCl, pH 8) containing a protease inhibitor. After reaction at 37 ° C. for 30 minutes, the cells were lysed, proteins were separated by centrifugation, and Western blotting was performed using an anti-ALPPL2 monoclonal antibody. The results are shown in Fig.

As shown in FIG. 3A, it was confirmed that the amount of ALPPL2 protein was significantly higher in the Capan-1 cell line and the Panc-1 + ve cell line compared to the HPDE cell line and the Panc-1-ve cell line. In addition, as shown in Figure 3B, it was confirmed that the protein that specifically binds to the SQ2 6-30 nucleic acid aptamer is ALPPL2 protein.

These results confirm that the expression of ALPPL2 protein is specifically increased in pancreatic cancer, and since the ALPPL2 protein specifically binds to the SQ2 6-30 nucleic acid aptamer, the ALPPL2 protein using SQ2 6-30 nucleic acid aptamer It was confirmed that pancreatic cancer can be diagnosed by measuring the amount of.

Example  3. Pancreatic Cancer Diagnosis As a biomarker ALPPL2  Identify the efficacy of protein

3-1. ALPPL2  Extracellular protein Secretory function  Measure

In order to use ALPPL2 protein as an effective pancreatic diagnostic biomarker, it must be secreted extracellularly, and Western blotting was performed to confirm that ALPPL2 protein is secreted extracellularly. To perform western blotting, Capan-1 and HPDE cell lines were added with DMEM each containing 10% FBS and incubated at 37 ° C. and 5% CO ₂ conditions until 80% of the culture plate was filled, and the cells After washing twice with PBS (phosphate buffered saline), FMEM-containing DMEM was added and incubated for 24 hours at 37 ° C. and 5% CO ₂ . The culture medium was collected, cells were completely removed by centrifugation, and the conditioned media was concentrated using a 10,000 Kd centrifugal filter (Millipore). Western blotting was performed using the concentrated supernatant. The results are shown in Fig.

As shown in FIG. 4, ALPPL2 protein was not detected in the HPDE cell line, but ALPPL2 protein bound to SQ2 6-30 nucleic acid aptamer was confirmed in the Capan-1 cell line. Through the above results, the ALPPL2 protein was bound to the membrane, but it was confirmed that it is secreted outside the cell, through which it was confirmed that in vitro diagnosis using not only pancreatic tissue and pancreatic cells but also urine, blood, saliva, etc. .

3-2. SQ2  6-30 nucleic acids Abtamer's  Target Orientation Check

In order to confirm that the SQ2 6-30 nucleic acid aptamer has a target orientation that specifically binds to the ALPPL2 protein, the siRNA (SEQ ID NO: 5-10) of the ALPPL2 protein was introduced into the Panc-1 + ve cell line to reduce the expression of the ALPPL2 protein. Inhibited siALPPL2 mutants were prepared. SiGFP mutants were prepared using siGFP (SEQ ID NO: 11-12) as a control. The siRNAs were synthesized in the ST biofarm. QRT-PCR and Western blotting were performed in the same manner as in Example 2 using the prepared mutants to confirm the target orientation of the SQ2 6-30 nucleic acid aptamer. The results are shown in Fig.

As shown in FIG. 5A, in the case of siALPPL2 mutants, expression of ALPP mRNA having high homology with ALPPL2 protein was not inhibited, but only expression of ALPPL2 mRNA was selectively inhibited. In addition, as shown in Figure 5B, it was confirmed that not only mRNA but also the expression of ALPPL2 protein 90% or more was suppressed. Through the above results, it was confirmed that siALPPL2 mutants in which expression of ALPPL2 protein was effectively suppressed using siRNA were prepared.

50 nM of SQ2 6-30 nucleic acid aptamer (3'-TAMRA-labelled SQ2) labeled with Carboxytetramethylrhodamine (TAMRA) was added to the Panc-1 + ve cell line, siGFP mutant line, and siALPPL2 mutant line, and 37 ° C, 5% CO. After incubation for 20 minutes under ₂ conditions, binding was performed under a fluorescence microscope. Cell nuclei were stained with Hoechst33342 at 10 μg / mL and analyzed for 5,000 cells in each cell line using Nucleocounter NC3000 (Chemometec) to quantify the mean fluorescent intensity (MFI). The results are shown in FIGS. 6 and 7.

As shown in FIG. 6 and FIG. 7, in the siGFP mutant strain, SQ2 6-30 nucleic acid aptamer was bound to the cell surface, and fluorescence was observed. In the siALPPL2 mutant strain, SQ2 6-30 nucleic acid aptamer did not bind. It was confirmed that this was not observed. Through the above results, it was confirmed that SQ2 6-30 nucleic acid aptamer selectively binds to ALPPL2.

3-3. SQ2  6-30 nucleic acids Abtamer's  Identify pancreatic cancer specificity

In order to confirm that SQ2 6-30 nucleic acid aptamer specifically binds to pancreatic cancer, 3'-TAMRA-labelled SQ2 nucleic acid aptamer was added to the pancreatic cancer cell lines Capan-1, Panc-1, MiaPaCa-2, Bxpc3, AsPC-1, Hpaf. -II, and Cfpac-1 cell line and other cancer cell lines SK-BR-3 (breast cancer), LnCap (prostate cancer), Hep G2 (liver cancer), HeLa (cervical cancer), A549 (lung cancer), SK-N-SH (Neural cancer), and T98G (glioblastoma) were used to observe whether SQ2 6-30 nucleic acid aptamers were bound using fluorescence microscopy. HPDE cell line was used as a control. The results are shown in Table 3 and FIG.

[Table 3]

As shown in Table 3 and FIG. 8, SQ2 6-30 nucleic acid aptamers do not bind to other cancer cell lines, and Capan-1, Panc-1, AsPC-1, Hpaf-II, and Bxpc3 cell lines among various pancreatic cancer cell lines. It was confirmed that it binds to but not to MiaPaCa-2 and Cfpac-1 cell lines.

These results confirm that SQ2 6-30 nucleic acid aptamer selectively binds to ALPPL2 protein that is specifically expressed in various pancreatic cancer cell lines, and that the ALPPL2 protein is secreted extracellularly for in vitro and / or in vitro diagnostic use. It has been confirmed that it can be used as a biomarker.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the embodiments described above are in all respects illustrative and not restrictive.

<110> SUNGKYUNKWAN UNIVERSITY Foundation for Corporate Collaboration <120> A method for the diagnosis of pancreatic cancer using ALPPL2          protein <130> PB12-10431 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> SQ2 6-30 <400> 1 agcuuauuca auugccugaa aagcu 25 <210> 2 <211> 532 <212> PRT <213> ALPPL2 <400> 2 Met Gln Gly Pro Trp Val Leu Leu Leu Leu Gly Leu Arg Leu Gln Leu   1 5 10 15 Ser Leu Gly Ile Ile Pro Val Glu Glu Glu Asn Pro Asp Phe Trp Asn              20 25 30 Arg Gln Ala Ala Glu Ala Leu Gly Ala Ala Lys Lys Leu Gln Pro Ala          35 40 45 Gln Thr Ala Ala Lys Asn Leu Ile Ile Phe Leu Gly Asp Gly Met Gly      50 55 60 Val Ser Thr Val Thr Ala Ala Arg Ile Leu Lys Gly Gln Lys Lys Asp  65 70 75 80 Lys Leu Gly Pro Glu Thr Phe Leu Ala Met Asp Arg Phe Pro Tyr Val                  85 90 95 Ala Leu Ser Lys Thr Tyr Ser Val Asp Lys His Val Pro Asp Ser Gly             100 105 110 Ala Thr Ala Thr Ala Tyr Leu Cys Gly Val Lys Gly Asn Phe Gln Thr         115 120 125 Ile Gly Leu Ser Ala Ala Ala Arg Phe Asn Gln Cys Asn Thr Thr Arg     130 135 140 Gly Asn Glu Val Ile Ser Val Met Asn Arg Ala Lys Lys Ala Gly Lys 145 150 155 160 Ser Val Gly Val Val Thr Thr Thr Arg Val Gln His Ala Ser Ser Ala                 165 170 175 Gly Ala Tyr Ala His Thr Val Asn Arg Asn Trp Tyr Ser Asp Ala Asp             180 185 190 Val Pro Ala Ser Ala Arg Gln Glu Gly Cys Gln Asp Ile Ala Thr Gln         195 200 205 Leu Ile Ser Asn Met Asp Ile Asp Val Ile Leu Gly Gly Gly Arg Lys     210 215 220 Tyr Met Phe Pro Met Gly Thr Pro Asp Pro Glu Tyr Pro Asp Asp Tyr 225 230 235 240 Ser Gln Gly Gly Thr Arg Leu Asp Gly Lys Asn Leu Val Gln Glu Trp                 245 250 255 Leu Ala Lys His Gln Gly Ala Arg Tyr Val Trp Asn Arg Thr Glu Leu             260 265 270 Leu Gln Ala Ser Leu Asp Pro Ser Val Thr His Leu Met Gly Leu Phe         275 280 285 Glu Pro Gly Asp Met Lys Tyr Glu Ile His Arg Asp Ser Thr Leu Asp     290 295 300 Pro Ser Leu Met Glu Met Thr Glu Ala Ala Leu Leu Leu Leu Ser Arg 305 310 315 320 Asn Pro Arg Gly Phe Phe Leu Phe Val Glu Gly Gly Arg Ile Asp His                 325 330 335 Gly His His Glu Ser Arg Ala Tyr Arg Ala Leu Thr Glu Thr Ile Met             340 345 350 Phe Asp Ala Ile Glu Arg Ala Gly Gln Leu Thr Ser Glu Glu Asp         355 360 365 Thr Leu Ser Leu Val Thr Ala Asp His Ser His Val Phe Ser Phe Gly     370 375 380 Gly Tyr Pro Leu Arg Gly Ser Ser Ile Phe Gly Leu Ala Pro Gly Lys 385 390 395 400 Ala Arg Asp Arg Lys Ala Tyr Thr Val Leu Leu Tyr Gly Asn Gly Pro                 405 410 415 Gly Tyr Val Leu Lys Asp Gly Ala Arg Pro Asp Val Thr Glu Ser Glu             420 425 430 Ser Gly Ser Pro Glu Tyr Arg Gln Gln Ser Ala Val Pro Leu Asp Gly         435 440 445 Glu Thr His Ala Gly Glu Asp Val Ala Val Phe Ala Arg Gly Pro Gln     450 455 460 Ala His Leu Val His Gly Val Gln Glu Gln Thr Phe Ile Ala His Val 465 470 475 480 Met Ala Phe Ala Ala Cys Leu Glu Pro Tyr Ala Cys Asp Leu Ala                 485 490 495 Pro Arg Ala Gly Thr Thr Asp Ala Ala His Pro Gly Pro Ser Val Val             500 505 510 Pro Ala Leu Leu Pro Leu Leu Ala Gly Thr Leu Leu Leu Leu Gly Thr         515 520 525 Ala Thr Ala Pro     530 <210> 3 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> SQ2 <400> 3 auaccagcuu auucaauugc cugaaaagcu aucgcccaau ucgcagugau auccuuuaag 60 auaguaagug caaucu 76 <210> 4 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> SQ2 mut <400> 4 agcuuauuca uuuuuuugaa aagcu 25 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA S1 <400> 5 aacccacccu cccagccaa 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA AS1 <400> 6 uuggcuggga ggguggguu 19 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA S2 <400> 7 caccacgccc uuugcuuua 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA AS2 <400> 8 uaaagcaaag ggcguggug 19 <210> 9 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA S3 <400> 9 ggcccaugag ucagagagg 19 <210> 10 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siRNA AS3 <400> 10 ccucucugac ucaugggcc 19 <210> 11 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siGFP S <400> 11 ggcuacgucc aggagcgca 19 <210> 12 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ALPPL2 siGFP AS <400> 12 ugcgcuccug gacguagcc 19

Claims (11)

A method for providing information necessary for diagnosing pancreatic cancer, the method comprising measuring the amount of alkaline phosphatase placental like-2 (ALPPL2) in a patient's sample. The method of claim 1,
The patient's sample is selected from the group consisting of pancreatic tissue, pancreatic cells, blood, serum, plasma, saliva, sputum, and urine. The method of claim 1,
The ALPPL2 is characterized in that the protein comprising the amino acid sequence of SEQ ID NO: 2. The method of claim 1,
Measuring the amount of ALPPL2, characterized in that the measurement by reverse transcriptase polymerase chain reaction (western blotting) or Western blotting. The method of claim 1,
Measuring the amount of ALPPL2, characterized in that for measuring the amount of binding of the ALPPL2 protein and the target molecule that specifically binds to the ALPPL2 protein. The method of claim 5, wherein
Wherein said target molecule is selected from the group consisting of nucleic acid aptamers, peptides, antigens, antibodies, low molecular ligands, substrates, enzymes, and receptors. The method of claim 5, wherein
The target molecule is characterized in that the nucleic acid aptamer comprising a nucleotide sequence of SEQ ID NO: 1. A pancreatic cancer diagnostic kit comprising a target molecule that specifically binds to ALPPL2 protein, which measures the amount of ALPPL2 (alkaline phosphatase placental like-2) protein in a patient's sample. The method of claim 8,
The patient's sample is selected from the group consisting of pancreatic tissue, pancreatic cells, blood, serum, plasma, saliva, sputum, and urine. The method of claim 8,
Wherein the target molecule is selected from the group consisting of nucleic acid aptamers, peptides, antigens, antibodies, low molecular ligands, substrates, enzymes, and receptors. The method of claim 8,
The target molecule is a kit, characterized in that the nucleic acid aptamer comprising the nucleotide sequence of SEQ ID NO: 1.

Images