KR20130075986A - Ssr primer for the identification of sweet potatoes and method for identifying sweet potatoes - Google Patents

Abstract

PURPOSE: A simple sequence repeat (SSR) primer for identifying sweet potato cultivar is provided to effectively detect DNA polymorphism of the sweet potato and to be used for DNA profiling of the sweet potato. CONSTITUTION: SSR primer pairs is selected from group which consist of; a primer pair represented by sequence number 1 and 2; a primer pair represented by sequence number 3 and 4; a primer pair represented by sequence number 5 and 6; a primer pair represented by sequence number 7 and 8; a primer pair represented by sequence number 9 and 10; and a primer pair represented by sequence number 11 and 12. A DNA polymorphism detecting method of sweet potato comprises; (a) a step of extracting DNA including the SSR primer pairs from the sweet potato cultivar; (b) a step of performing PCR using the SSR primer pairs and the extracted DNA as a template; (c) a step of analyzing the PCR result.

Description

Technical Field [0001] The present invention relates to a SSR primer for distinguishing a sweet potato from a variety of sweet potatoes,

The present invention relates to an SSR primer for discriminating sweet potato varieties and a method for distinguishing sweet potato varieties using the same.

Recently, the rapid development of molecular biology has made it possible to search for useful traits that enable the study of bio-diversity at the level of DNA (DNA), to identify species of organisms, to classify and identify cultivars, The developed nucleic acid fingerprint analysis technology has been developed and can be analyzed quickly and easily with little effect on the external environment. The nucleic acid fingerprinting method using PCR (Polymerase Chain Reaction) developed so far includes randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphic DNA (AFLP), and simple sequence repeat (SSR). The RAPD method has a disadvantage of poor reproducibility because the non-specific PCR product is amplified, and the AFLP method is spotlighted by high DNA polymorphism detection, but has a disadvantage of complicated appearance and analysis of a low reproducible band. On the other hand, the SSR method is based on the nucleotide sequence information in the microsatellite region, which is the DNA repeat sequence, and the PCR primer is constructed and used for easy analysis and high reproducibility. It is often used for identification.

Subsequently, the microsatellite analysis method is often used for fingerprinting of various species due to its ease of use and high reproducibility.

As a result of previous studies on the markers of the present invention, Ji Hyunso et al. Of agriculture department of Seoul National University reported 24 types of Japonica 24 varieties in Korea and 27 varieties of foreign varieties using Micro-satellite markers in 1998, A total of eight microsatellite markers, CT25, CT462, GA275, CT481, CT91, CT522, RM164 and GA479, which can identify 51 varieties of Japonica rice varieties, have been published.

The RAPD markers of OPA-07, OPC-09, OPE-04, OPF-13, OPP-11, OPP-16 and OPT- RM164, CT22, and CT522 were able to distinguish nine cultivars cultivated in Korea and 22 cultivars from other cultivars through the combination of five or six markers using four types of microsatellite markers.

In addition, a patent application was filed for a combination of markers composed of RM48, RM249, RM209, RM70, RM257, and OSR20 and a method of discrimination of cultivar discrimination, six markers which can be distinguished from 148 kinds of Japonica variety and unified type variety cultivated in Korea, (Korean Patent No. 0426467 and No. 0453568).

In the case of strawberries, the growth of strawberry seedlings depends on the reproduction of nutrients by the runner (stem). As long as mutation does not occur, the seedlings have the same DNA as mother lice. It is now possible to distinguish each breed using a point.

In the case of sweet potatoes, the demand for discrimination of sweet potato varieties is increasing rapidly due to patent rights and royalties problems. However, sweet potatoes are difficult to distinguish even in the same varieties.

In Japan, the identification of sweetpotato varieties has been carried out and the markers have been used ('06). However, Japan's method is based on so-called PCR-RFLP, which combines primers and restriction enzymes And it has a problem of low discrimination power because it is divided into electrophoresis.

Therefore, the inventors of the present invention found that a primer pair of six primer pairs excellent in reactivity to sweet potato varieties can be used for the identification of sweet potato varieties, in order to find a marker that can accurately and easily discriminate sweet potato varieties.

Accordingly, it is an object of the present invention to provide a SSR (Simple Sequence Repeat) primer pair used for discriminating sweet potato varieties.

It is another object of the present invention to identify a domestic sweet potato variety using molecular markers. The genomic DNA is isolated from each variety and PCR is carried out using fluorescently labeled SSR markers. And a method for analyzing the amplified PCR product using a DNA sequencer.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, a primer pair represented by SEQ ID NOS: 1 and 2; A pair of primers represented by SEQ ID NOS: 3 and 4; A pair of primers represented by SEQ ID NOS: 5 and 6; A pair of primers represented by SEQ ID NOS: 7 and 8; A pair of primers represented by SEQ ID NOS: 9 and 10; And a pair of primers represented by SEQ ID NOs: 11 and 12; and a SSR (simple sequence repeat) primer pair for distinguishing sweet potato varieties.

According to another aspect of the present invention, there is provided a method for producing an SSR primer comprising the steps of: (a) extracting DNA comprising a pair of SSR primers from a sweet potato variety to be analyzed;

(b) performing PCR using the extracted DNA as a template and using the SSR primer pair; And

(c) analyzing the amplified PCR product

Lt; RTI ID = 0.0 > polymorphism. ≪ / RTI >

The features and advantages of the present invention are summarized as follows.

(i) The SSR primer pair provided in the present invention can be very usefully used to effectively detect the DNA polymorphism of sweet potato and to create a DNA profile of sweet potato.

(ii) By efficiently evaluating the genetic resources of sweet potatoes through this process, it is possible to effectively perform the redundancy analysis and establishment of novelty with the existing resources and to identify the sweet potato varieties when introducing new genetic resources.

(iii) To create a DNA profile of sweet potatoes, to secure the integrity of domestic sweet potato distribution market, to contribute to increase consumer satisfaction through breed assurance, and to protect the rights and interests of breeders and growers in preparation for market opening such as FTA .

The present invention provides a pair of SSR (simple sequence repeat) primers having two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 12.

The present invention, the primer pair represented by SEQ ID NO: 1 and 2; A pair of primers represented by SEQ ID NOS: 3 and 4; A pair of primers represented by SEQ ID NOS: 5 and 6; A pair of primers represented by SEQ ID NOS: 7 and 8; A pair of primers represented by SEQ ID NOS: 9 and 10; And a pair of primers represented by SEQ ID NOs: 11 and 12; and a SSR (simple sequence repeat) primer pair for distinguishing sweet potato varieties.

Also, the present invention provides a method for detecting DNA polymorphism of sweet potatoes, which comprises performing PCR using the SSR primer pair, and a method for identifying a sweet potato.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing an SSR marker capable of specifically analyzing the genetic polymorphism of sweet potato.

Genomic DNA extracted from sweet potato was treated with restriction enzymes to prepare a DNA fragment. PCR was performed to amplify the DNA fragment, and the sequence was analyzed to obtain a DNA fragment containing a supersaturated sweet potato.

The resulting DNA fragments were analyzed to select fragments containing five or more repeating units and 200 pairs of bidirectional preamers capable of amplifying the supersaturated bodies based on the portion containing repeating units were designed. Using the above primer pair, DNA profiling through PCR of various sweet potato varieties was performed to select 6 pairs of SSR primer pairs showing a lot of polymorphic mutations.

The SSR marker provided in the present invention refers to a PCR primer pair, and includes a forward primer and a reverse primer. The SSR primer pair provided in the present invention has two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 12. (Primer pairs shown in SEQ ID NOS: 1 and 2), ITSSR08 (primer pairs shown in SEQ ID NOS: 3 and 4), IBSSR01 (primer pairs shown in SEQ ID NOS: 5 and 6), IBSSR15 And 8), BU691949 (primer pair shown in SEQ ID NO: 9 and 10), and BM878757 (primer pair shown in SEQ ID NO: 11 and 12). The ranges of the primer pairs provided in the present invention, the range of the size of the superscalar bodies amplified by them, Tm (° C), and information on the chromosomal alleles in which the superscalar bodies exist are shown in Table 1 below.

primer Base sequence SEQ ID NO: Repetitive motif Super satellites  size Tm (° C) ITSSR07 F: CACCATACCCAATTTTTACAGATGC One 53 R: GATTGAATGAATGATGGGG 2 ITSSR08 F: CAATCTGGGAGGAATGACATC 3 53 R: AAGTGTTTGAAGATCCTGCAAC 4 IBSSR01 F: CGTCACCCATTAACAGCTCTGAGTG 5 (GA) ₁₄ 188 55 R: CCATTCGCTGAGCATCTGGAAC 6 IBSSR15 F: TGGAGCAGATGTTCCTGGAC 7 178 55 R: GATTTGAAGCAGCAGTTCATCC 8 BU696949 F: CGTTCACCGCCATTTTTGTTTC 9 (CAC) ₇ 262 55 R: ATCTTGAAGAGGTACTCCTCCCCC 10 BM878757 F: AGAGAAAATGGCGCACCGT 11 (TC) ₈ TA (TC) ₅ 137 58 R: CAGATCAGAGATGACCGAAG 12

F: forward primer, R: reverse primer

The SSR primer pair provided in the present invention can be useful for detecting DNA polymorphism in sweet potato and for analyzing genetic diversity. The SSR primer according to the present invention can be used to efficiently evaluate or preserve the genetic resources and varieties of sweet potato. Accordingly, the present invention provides a method for detecting DNA polymorphism of sweet potato comprising performing PCR using the SSR primer pair.

Specifically, the DNA polymorphism detection method of sweet potato

(a) extracting DNA comprising SSR primer pairs from the sweetpotato variety to be analyzed;

(b) performing PCR using the extracted DNA as a template and using the SSR primer pair; And

(c) analyzing the amplified PCR product.

The extraction of the genomic DNA in the step (a) can be carried out by a conventional phenol / chloroform extraction method, SDS extraction method (Tai et al., Plain Mol. Biol. Reporter, 8: 297-303), CTAB separation method Trimethyl Ammonium Bromide; Murray et al., Nucleic Acid Res., 4321-4325, 1980) or commercially available DNA extraction kits.

In the step (b), the PCR may be performed using a PCR reaction mixture containing various components known in the art and necessary for the PCR reaction.

The term " PCR " as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT- , The method of Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822), the method of ligase chain reaction (Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press ligase chain reaction (LCR) (17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) WO 88/10315), self sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276) , Consensus sequence primed polymerase chain reaction (C P-PCR (US Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA) (U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification (21,22) and loop- mediated isothermal amplification; (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

PCR is the best known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, traditional PCR procedures can be modified to enhance the specificity or sensitivity of PCR, such as touchdown PCR 24, hot start PCR 25, 26, nested PCR 2 ) And a booster PCR 27 were developed. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL-PCR) and multiplex PCR have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer solution and water (dH ₂ O) in addition to the genomic DNA extracted from the sweet potato to be analyzed and the SSR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification, and may be preferably used in the range of 1.5 to 2.5 mM. Generally, when Mg ^{2 +} is excessive, nonspecific PCR amplification product is increased, and when Mg ^{2 +} is insufficient, the yield of PCR product is decreased. The PCR buffer solution may further contain an appropriate amount of Triton X-100 (Triton X-100). PCR also denatures the template DNA at 94-95 ° C., and then denatures it; Annealing; Followed by a cycle of amplification and extension followed by final elongation at 72 ° C. In the above modification and amplification may be performed at 94 ~ 95 ℃ and 72 ℃, respectively. The temperature at the time of binding may vary depending on the type of the primer. Preferably 55 to 60 < 0 > C. The time and number of cycles in each step can be determined according to the conditions commonly practiced in the art. The optimal reaction conditions for the PCR using the SSR primer pair according to the present invention are as follows. Template denaturation for 5 minutes at 94 ° C., followed by 30 seconds at 94 ° C .; 30 seconds at 55 ° C .; And 72 ° C for 60 seconds, followed by final reaction at 72 ° C for 5 minutes.

In step (c), the DNA of the PCR product can be separated by size according to a method well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or an ABI prism 3100 genetic analyzer-electropherogram. PCR amplification results can be preferably confirmed by polyacrylamide gel electrophoresis, more preferably modified polyacrylamide gel electrophoresis. After electrophoresis, electrophoresis results can be analyzed by silver staining and fluorescence staining. Methods for performing general PCR and analyzing the results are well known in the art.

In addition, the present invention provides a method for identifying a sweet potato including PCR using the SSR primer pair.

Specifically, the method of identification of sweet potatoes

(a) extracting genomic DNA from a sweet potato and a control sweet potato variety to be analyzed;

(b) performing PCR using the extracted genomic DNA as a template and the SSR primer pair;

(c) electrophoresis of the PCR product; And

(d) comparing the electrophoresis results of the sweet potato and the control sweet potato.

Genomic DNA extraction, PCR and isolation of the PCR products in the steps (a) to (c) were as described above. In the step (d), the sweet potatoes and the control sweet potato cultivars were compared in the same combination of SSR primers And comparing the sizes of the PCR products of the sweet potatoes and the control sweet potato varieties, which are the samples for the pair, with each other. A comparison of the size comparison results for each pair of SSR primers reveals that the sweet potatoes to be sampled can be identified as the same variety as the control sweet potato varieties if they are consistent with the results of the sweet potato samples and the control sweet potato cultivars. The method of identification of such varieties can be usefully used when identification of varieties is required, such as determination of duplication when introducing a new genetic resource, and determination of violation of indication of origin through identification of origin.

Genomic DNA extraction, PCR, and PCR product isolation for control sweetpotato varieties may be performed simultaneously with the sample sweet potato, but may be performed prior to the sample sweet potato and prepared as a reference for identification. Using these reference tables, genomic DNA extraction, PCR, and separation of the size of PCR products can be performed on the sweet potato as a sample.

The present invention also provides a kit for detecting DNA polymorphism of sweet potato comprising an SSR primer pair according to the present invention. In addition, in order to facilitate the PCR reaction, a DNA polymerase and a PCR reaction buffer solution having the composition described above may be further included, and components necessary for performing electrophoresis to confirm amplification of the PCR product May be further included in the kit of the present invention.

The present invention also provides a kit for identifying a sweet potato comprising the SSR primer pair according to the present invention. The method for identification of the breed is as described above. In addition, in order to facilitate the PCR reaction, a DNA polymerase and a PCR reaction buffer solution having the composition described above may be further included. In order to confirm whether amplification of the PCR product is amplified, Or identification standards for known varieties may be further included in the kit of the present invention.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are intended to illustrate the invention, and the content of the invention is not limited by the following examples.

(1) Analysis result of ISSR01

The final analysis of the results of the present invention is a DNA Sequencer, and Tables 2 to 3 and 6 show the results for three primers analyzed by instrument. The position and shape of the graph showed the same or different varieties. If one of the varieties is the same as the other, the two varieties are likely to be of the same variety. If so, the same analysis should be done using different primers to determine if they are really different or the same, and if the results of two or three primers are the same or different, the results can guarantee 100% certainty.

(2) Analysis results of IBSSR15

(3) ITSSR07 analysis result

number Breed name Identification locus (bp) 156 158 161 163 163.6 164 166 166.7 167 170 172 173 175 176 One Yulmi One One One One 2 Jin Hong-mi One One One One 3 Orange One One One One 4 Jami One One One One One One 5 Sincheon mi One 6 The One One One One 7 Sweetness One One 8 Healthy mi One One One One One One One One 9 Kite One One One One One One One 10 Shinja Mi One One One One One One One 11 White mi One One One One One One 12 Mazami 13 Shrink One One One One One One One 14 Shin Kun Mi One One One One One One One 15 Happy mi One One One One One One 16 Go Kun Mi One One One One One One One 17 Borami One One One One One One One One One 18 Biomi 19 Shin Hwangmi One One One One 20 Height One One One

Tables 4 and 5 are tabular illustrations of the positions of the peaks shown in the graphs of the varieties of Tables 2 and 3. Tables 4 and 5 can easily read the discriminated locus.

(4) Results of SSR15 analysis

number Breed name Identification locus (bp) 172 173 174 175 176 177 178 179 180 181 182 183 184 185 One Yulmi One One One One One 2 Jin Hong-mi One One One One One 3 Orange One One One One One 4 Jami One One One One One One 5 Sincheon mi One 6 The One One One One One 7 Sweetness One One One One 8 Healthy mi One One One One One 9 Kite One One One One 10 Shinja Mi One One One One One One 11 White mi One One One One 12 Mazami One One One 13 Shrink 14 Shin Kun Mi One One One One One 15 Happy mi One One One One 16 Go Kun Mi One One One One One 17 Borami One One One One 18 Biomi One One One One One One 19 Shin Hwangmi One One One One One One 20 Height One One One One One One 21 Dry flavor One One 22 Daumyumi One One One One One 23 Hong Mi One One One One One 24 pumpkin One One One One One 25 National One One One One One

(5) Analysis results of BM878757

Claims (5)

Primer pairs represented by SEQ ID NOs: 1 and 2; A pair of primers represented by SEQ ID NOS: 3 and 4; A pair of primers represented by SEQ ID NOS: 5 and 6; A pair of primers represented by SEQ ID NOS: 7 and 8; A pair of primers represented by SEQ ID NOS: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12;
A simple sequence repeat (SSR) primer pair for discriminating sweet potato DNA polymorphism selected from the group consisting of:
(a) extracting DNA comprising SSR primer pairs from sweet potato varieties to be analyzed;
(b) performing PCR using the extracted DNA as a template and using the SSR primer pair; And
(c) analyzing the amplified PCR product
Gt; polymorphism < / RTI >
The method of claim 2, wherein analyzing the PCR product amplified in step (c) is performed through a DNA sequencer.
A kit for discriminating sweet potato DNA polymorphism comprising the primer pair of claim 1.
The kit according to claim 4, wherein the kit further comprises a DNA polymerase and a buffer solution for PCR reaction.