KR20120077156A - Dna aptamer binding to sulfadimethoxine with specificity - Google Patents

Abstract

PURPOSE: A DNA aptamer which specifically binds to sulfadimethoxine is provided to effectively detect sulfamethoxine and to easily manufacture a biosensor chip. CONSTITUTION: A DNA aptamer which specifically binds to sulfamethoxine has a base sequence selected from sequence numbers 1-13. A method for preparing the DNA aptamer comprises: a step of fixing sulfadimethoxine onto beads; a step of step of reacting the beads with ssDNA library for binding; a step of isolating ssDNA conjugated to the sulfadimethoxine-fixed beads; and a step of amplifying the ssDNA.

Description

DNA aptamer binding to sulfadimethoxine with specificity

The present invention relates to antibiotic detection aptamers, and more particularly to DNA aptamers that specifically bind to sulfadimethoxine.

Antibiotics have been widely used to kill or inhibit microorganisms. However, the abuse of antibiotics has caused a variety of side effects in humans, leading to the emergence of antibiotic-resistant superbacteria. Therefore, the proper use of the appropriate amount of antibiotics is of great importance and it should be checked whether the food contains residues of antibiotics exceeding the Maximum Residue Limits (MRL) before distribution or sale on the market. Since the excess of antibiotic residue in food creates serious problems, a more reliable, accurate and easy detection system is required.

Sulfadimethoxine is a white crystalline powder of sulfonamide-based antibiotic, produced by Pfizer Animal Health, and used in various forms such as oral suspension, tablets, and bolus. It is used for the treatment of various infections such as respiratory, urinary tract, enteric and soft tissue infection.

Aptamers are single-stranded DNA (ssDNA) or RNA that have high specificity and affinity for specific targets. Aptamers are superior in cost to detection materials used in the field of sensors because of their high affinity for their targets, their excellent thermal stability and their ability to be synthesized in vitro . In addition, there is no restriction in the target material, aptamers for various targets such as proteins, biomolecules such as amino acids, small organic chemicals such as environmental hormones or antibiotics, and bacteria can be synthesized. Due to the properties of aptamers that specifically bind to target materials, a lot of research has recently been conducted to use aptamers in new drug development, drug delivery systems, and biosense.

Among the various sensing materials used in the existing biosense field, the superiority in sensitivity is the detection of the target material using the antibody. The first problem is that the injection of the target substance (antigen) to be detected into the body of the animal to secure the antibody made through the immune system of the living body and then undergo a purification process is time-consuming and expensive. In addition, the target material that can be used as an antigen is limited compared to the aptamer which has little restrictions on the target material, which makes it difficult to prepare antibodies to low molecular weight compounds such as toxic substances. In general, since antibodies are very large proteins having a size of 150 K Da or more, there are limitations in signal detection when applied to biosensors such as electrochemistry, and thermal stability is inferior to DNA or other chemicals. have. Therefore, the existing technology using antibodies in the diagnosis of blood biomarkers is not cost and time efficient, the range of application is limited, there are limited problems in the application as a biosensor. As a new sensing material for improving these problems, a lot of researches using aptamers that show high affinity and safety specifically for various target materials and are easier to chemically synthesize and change than antibodies. In addition, since the Systematic Evolution of Ligands by EXponential enrichment (SELEX) was developed in 1990 by the Gold's and Ellington's groups, large macromolecules, such as proteins, have been the main experimental targets, but affinity chromatography, capillary Advances in evolved SELEX technology using capillary electrophoresis and magnetic beads have made it possible to diversify target molecules, including small molecules, such as hormones or organic molecules, which are small in size, making antibodies difficult to make. . Therefore, a lot of research is being conducted to select aptamers for small molecules and use them in various fields.

Accordingly, the present inventors have tried to develop a new aptamer for sulfadimethoxin, and thus show a high affinity to sulfadimethoxin from a chemically synthesized ssDNA library using the SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology. DNA aptamers were selected and the present invention was completed by establishing the sequence and structure of the DNA aptamers.

It is an object of the present invention to provide a novel DNA aptamer that specifically binds to sulfadimethoxine, a method for preparing the same, and a composition and kit for sulfadimethoxine detection using the DNA aptamer.

In order to achieve the above object, the present invention provides a DNA aptamer (aptamer) that specifically binds to sulfadimethoxine (sulfadimethoxine), characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13. do.

In addition,

1) fixing sulfadimethoxine to beads;

2) inducing binding by reacting the sulfadimethoxine-immobilized beads with an ssDNA library having 30-50 arbitrary bases in the center having a primer region for PCR preserved in the sock end;

3) separating ssDNA bound to the beads to which sulfadimethoxine is immobilized;

4) separating the ssDNA from the ssDNA bound to the isolated sulfadimethoxin immobilized beads; And

5) amplifying ssDNA that specifically binds sulfadimethoxine by performing PCR using a primer pair complementary to the primer region for PCR;

It provides a method for producing a DNA aptamer specifically binding to sulfadimethoxine comprising a.

In another aspect, the present invention provides a composition for detecting sulfadimethoxin comprising a DNA aptamer specifically binding to sulfadimethoxin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

In addition, the present invention provides a kit for sulfadimethoxine detection comprising a DNA aptamer specifically binding to sulfadimethoxin, characterized in that it has a nucleotide sequence of any one of SEQ ID NOs: 1 to 13.

The present invention develops a DNA aptamer that shows specific high affinity for sulfadimethoxine from a random ssDNA library using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology using magnetic beads. It was. According to the present invention, it is expected that the use of DNA aptamers capable of specifically binding to sulfadimethoxin will allow sulfadimethoxins to be measured more sensitively and accurately than antibody-based assays used in the prior art. Compared with the low production cost and easy fixation on the surface, it is advantageous for the production of biosensor chips and can be effectively used for the development of the composition and kit for detecting the trace amount of sulfadimethoxin remaining in the human body, food, and water and sewage source.

1 is a diagram schematically illustrating a process of performing SELEX using magnetic beads.
Figure 2 is a graph showing the binding force of the aptamer (selectamer) selected for each step in the repeated screening process.
Figure 3 is a graph showing the result of confirming the binding degree with sulfadimethoxine (sulfadimethoxine) by using the fluorescent material labeled aptamer through fluorescence intensity.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer (aptamer) that specifically binds to sulfadimethoxine, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

The DNA aptamer more preferably has a nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 13, but is not limited thereto.

The DNA aptamer is preferably prepared in the following steps, but is not limited thereto.

1) fixing sulfadimethoxine to beads;

2) inducing binding by reacting sulfadimethoxine-fixed beads with an ssDNA library having 30-50 arbitrary bases in the center with primer regions for PCR conserved at both ends;

3) separating ssDNA bound to the beads to which sulfadimethoxine is immobilized;

4) separating the ssDNA from the ssDNA bound to the isolated sulfadimethoxin immobilized beads; And

5) Amplifying the ssDNA that specifically binds sulfadimethoxine by performing PCR using a primer pair complementary to the PCR primer region.

In the above method, the beads of step 1) are preferably sepharose beads or magnetic beads, but are not limited thereto.

In the above method, the primer region for PCR in step 2) is preferably SEQ ID NO: 14 and SEQ ID NO: 15, but is not limited thereto.

In the above method, the steps 3) to 5) are preferably performed by additionally repeating 5 to 15 times, and more preferably 8 to 13 times, but not limited thereto.

In order to select DNA aptamers that specifically bind to sulfadimethoxin, the present inventors used SELEX (Systematic Evolution of Ligands) using magnetic beads for the antibiotic sulfadimethoxin from a chemically synthesized ssDNA library. Aptamer candidate ssDNA was screened using by Exponential enrichment) (see FIGS. 1 to 2).

In addition, we analyzed DNA sequence and structure from the selected aptamer candidate ssDNA, and then identified DNA aptamers that specifically bind to sulfadimethoxin having sequence and structural similarity (see Table 1).

In addition, the inventors of the present invention, in order to confirm the binding degree of each DNA aptamer, by analyzing the binding force using a magnetic bead immobilized antibiotic and DNA aptamer immobilized with FAM fluorescent material, SEQ ID NO: 11 and SEQ ID NO: 13 It was confirmed that the binding degree of the DNA aptamer having a nucleotide sequence of significantly higher (see Fig. 3).

Therefore, the DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library to select a DNA aptamer specifically binding to the antibiotic sulfadimethoxin using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology. By analyzing the nucleotide sequence, characteristics and binding capacity of the DNA aptamers, DNA aptamers specifically binding to sulfadimethoxine having any one of SEQ ID NO: 1 to SEQ ID NO: 13 were identified.

In another aspect, the present invention provides a composition for detecting sulfadimethoxin comprising a DNA aptamer specifically binding to sulfadimethoxin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.

The DNA aptamer more preferably has a nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 13, but is not limited thereto.

DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select a DNA aptamer that specifically binds to the antibiotic sulfadimethoxin, and sequence, characteristics and binding capacity of the selected DNA aptamer Through analysis, it was confirmed that the DNA aptamer specifically binding to sulfadimethoxine having any one of SEQ ID NO: 1 to SEQ ID NO: 13, useful as a composition for detecting or removing sulfadimethoxin comprising the same Can be used.

The present invention also provides a kit for sulfadimethoxine detection comprising a DNA aptamer specifically binding to sulfadimethoxin, characterized in that it has a nucleotide sequence of any one of SEQ ID NOs: 1 to 13. do.

The DNA aptamer more preferably has a nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 13, but is not limited thereto.

DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select a DNA aptamer that specifically binds to the antibiotic sulfadimethoxin, and sequence, characteristics and binding capacity of the selected DNA aptamer By analyzing the DNA aptamer specifically binding to sulfadimethoxin having any one of SEQ ID NO: 1 to SEQ ID NO: 13, so that it can be usefully used as a sulfadimethoxin detection kit comprising the same Can be.

The kit of the present invention may include a buffer solution and containers for performing and analyzing the detection, if necessary, such as a bottle, a tub, a small sachet, an envelope, a tube or an ampoule. And the like, and they may be formed, in part or in whole, from plastic, glass, paper, foil or wax, and the like. The container may be equipped with a fully or partially separable stopper that may initially be part of the container or attached to the container by mechanical, adhesive or other means. The container may also be equipped with a stopper to access the contents by a needle. The kit may include an external package, which may include instructions for use of the components.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

< Example  1> ssDNA ( single strand DNA ) Library Preparation

Synthetic ssDNA library [5'-CACCTAATACGACTCACTATAGCGGATCCGA (SEQ ID NO: 14) -N40-CTGGCTCGAACAAGCTTGC (SEQ ID NO: 14) having a binding sequence of conserved primers for PCR amplification and cloning at both ends and comprising a sequence of 40 random nucleotides in the middle) : 15) -3 ']. In addition, forward primer [5'-CACCTAATACGACTCACTATAGCGGA-3 '(SEQ ID NO: 16)], reverse primer [5'-GCAAGCTTGTTCGAGCCAG-3' (SEQ ID NO: 17) for PCR amplification and ssDNA generation. )] And biotin-bound reverse primer [5'-Biotin-GCAAGCTTGTTCGAGCCAG-3 '(SEQ ID NO: 18)] was used, and FAM-labeled forward primer [5'-FAM-CACCTAATACGACTCACTATAGCGGA-3' for binding analysis (SEQ ID NO: 19)]. In addition, all oligonucleotides were synthesized and PAGE-purified by Bionics (Korea).

< Example  2> Sulfadimethoxin ( sulfadimethoxine ) Fixed Bead  Produce

Sulfadimethoxine (Sigma-Aldrich, USA) was immobilized on the beads using a reaction of Tosyl-activated magnetic beads (Invitrogen, USA) with sulfadimethoxine's primary amine group (-NH 2).

Specifically, 20 μmole of sulfadimethoxine was mixed with 30 mg of magnetic beads, followed by gentle stirring in 1 mL of coupling buffer (0.1 M borate, 0.67 M (NH ₄ ) ₂ SO ₄ , pH 9.5). After incubation at 37 ° C. for 20 hours, 1 mL of blocking buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4) was used to stop the reaction of tosyl groups on the surface of the beads that were not bound to sulfadimethoxine. mM KH ₂ PO ₄ , 0.05% tween 20, pH 7.4) at 37 ° C. for 1 hour. Thereafter, using a magnet, washed _twice with 1 mL of washing buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH ₂ PO ₄ , 0.01% tween 20, pH 7.4) Magnetic beads immobilized with dimethoxine were obtained.

< Example  3> sulfadimethoxin on  Specific Aptamers  Selection

SELEX using magnetic beads was performed to select aptamers specific for sulfadimethoxin (FIG. 1).

Specifically, in order to remove ssDNA that non-specifically binds to magnetic beads, it is first dissolved in a binding buffer (20 mM Tris-HCL, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0). The ssDNA library (500 pmole) was reacted with magnetic beads, and only the unbound supernatant was separated using a magnet. The isolated ssDNA library was reacted with magnetic beads of sulfadimethoxine immobilized at room temperature for 1 hour. After the reaction, the washed ssDNA was removed twice and the bound ssDNA was eluted with 20 mM NaOH. The eluted ssDNA was amplified by PCR using the biotin primer of <Example 1>. I was. Then, the magnetic beads immobilized with streptavidin were separated from dsDNA to ssDNA, and the separated ssDNA was reacted with the magnetic beads immobilized with sulfadimethoxin, and the above procedure was repeated. In addition, after the first screening, the screened ssDNA was used for the next screening, and this screening process was repeated. In the next screening process, the amount of ssDNA and the incubation time of ssDNA in the beads fixed in sulfadimethoxine were further reduced for strict screening. The concentration was measured to check the degree of sulfadimethoxin binding of the remaining ssDNA and proceed with the screening process.

As a result, as shown in FIG. 2, the binding force (%) was calculated through the following <Equation 1> for each stage of the selection process, and the binding force for each stage of the selection process was confirmed (FIG. 2).

< Example  4> Cloning  And sequencing

The 13th reselected ssDNA was amplified by PCR using unmodified forward and reverse primers, cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and the vector was then transferred to Escherichia. coli ( E. coli ) TOP10 cells (Invitrogen, USA) were transformed. Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result of the sequencing analysis, as shown in Table 1, the nucleotide sequence of DNA specifically binding to sulfadimethoxine with high affinity was confirmed.

SEQ ID NO: Base sequence SEQ ID NO: 1  TGAGCAGTCCCCATGCGTCGGTCTTCCCCCCACGTCCCAT SEQ ID NO: 2  AGTTCGAGAACGCGATCAAGCTGAAGTCATGTGGGTCCGT SEQ ID NO: 3  TCACGCCATCGCTCCTAAATACCGCATACACATTCTGATT SEQ ID NO: 4  TAGGCATTGGAGTAAGGTTTGCGTTCGGGTTGGAAGTCGG SEQ ID NO: 5  GGCTTTTGGTGAGGCTTGTCTATGTTTTCGGTGTAGGGGG SEQ ID NO: 6  ATCCGATCTTAGGGCGCGGGTTATGGAGGGTGCC SEQ ID NO: 7  CCTCCAGGTAAGGCAACGCAGTGGTGAGGGCGGACGGGGC SEQ ID NO: 8  TCAGGGGTTAAAGCACGGGCTGGTAATGTTTGGCGGCTAC SEQ ID NO: 9  TGACAGATGAAGCGTATGTCGTCTATCTATCTTAGCTAGC  SEQ ID NO: 10  TATAACGGTGGGCTTGAGACCTGTCTGTCCGTCTCTGG  SEQ ID NO: 11  GCGATGATGGGTTAGATGGGAGGTCATATAGCTGGATGGT  SEQ ID NO: 12  GCGGCTGAGGAAACTGTGTATCTAAGTAGGTCGGGTCGCG SEQ ID NO: 13  GGGCAACGAGTGTTTATAGAGGGAGGTGGGGGGCTACCAG

In addition, to analyze the structural similarity of the selected ssDNA, the secondary structure was investigated using the Mfold program ( http://mfold.bioinfo.rpi.edu/cgi-bin/dna-form1.cgi ).

As a result, it was confirmed that most DNA aptamers form a secondary structure in which the 'AT / TA' base pair and the '-GAG-' sequence part of the loop part are similarly present in the stem part. They also had the 'ATG / CTA' base pairs, confirming that these common moieties are involved in binding to sulfadimethoxin.

< Example  5> ssDNA Force of adhesion

In order to confirm the binding capacity of the selected ssDNA to sulfadimethoxin, it was analyzed using fluorescence measurement.

Specifically, 20 μmole of sulfadimethoxine was mixed with 30 mg of magnetic beads, followed by gentle stirring in 1 mL of coupling buffer (0.1 M borate, 0.67 M (NH ₄ ) ₂ SO ₄ , pH 9.5). After incubation at 37 ° C. for 20 hours, 1 mL of blocking buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4) was used to stop the reaction of tosyl groups on the surface of the beads that were not bound to sulfadimethoxine. mM KH ₂ PO ₄ , 0.05% tween 20, pH 7.4) at 37 ° C. for 1 hour. Then, using a magnet washed _twice with 1 mL of washing buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH ₂ PO ₄ , 0.01% tween 20, pH 7.4), 0.6 mg of the sulfadimethoxin-fixed magnetic beads were incubated with FAM-labeled ssDNA aptamer for 1 hour at room temperature with gentle stirring in 100 mL of binding buffer, and unbound aptamers were removed by washing. The amount of FAM-labeled ssDNA aptamer bound to sulfadimethoxin-fixed magnetic beads was measured by fluorescence by separating only ssDNA-labeled FAM bound to sulfadimethoxine using a magnet (1420 Victor multilabel counter, PerkinElmer, USA). Measured through.

As a result, as shown in Figure 3 as a result of comparing the binding degree of each DNA aptamer with sulfadimethoxin using the fluorescence intensity, the applicability of the DNA aptamer having a nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 13 is different It was confirmed that the high compared with the tammer (Fig. 3).

<110> iSENS <120> DNA aptamer binding to sulfadimethoxine with specificity <130> 10P-11-65 <160> 19 <170> Kopatentin 1.71 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 1 tgagcagtcc ccatgcgtcg gtcttccccc cacgtcccat 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 2 agttcgagaa cgcgatcaag ctgaagtcat gtgggtccgt 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 3 tcacgccatc gctcctaaat accgcataca cattctgatt 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 4 taggcattgg agtaaggttt gcgttcgggt tggaagtcgg 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 5 ggcttttggt gaggcttgtc tatgttttcg gtgtaggggg 40 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 6 atccgatctt agggcgcggg ttatggaggg tgcc 34 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 7 cctccaggta aggcaacgca gtggtgaggg cggacggggc 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 8 tcaggggtta aagcacgggc tggtaatgtt tggcggctac 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 9 tgacagatga agcgtatgtc gtctatctat cttagctagc 40 <210> 10 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 10 tataacggtg ggcttgagac ctgtctgtcc gtctctgg 38 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 11 gcgatgatgg gttagatggg aggtcatata gctggatggt 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 12 gcggctgagg aaactgtgta tctaagtagg tcgggtcgcg 40 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> sulfadimethoxine binding DNA aptamer <400> 13 gggcaacgag tgtttataga gggaggtggg gggctaccag 40 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> preserved region of ssDNA library <400> 14 cacctaatac gactcactat agcggatccg a 31 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> preserved region of ssDNA library <400> 15 ctggctcgaa caagcttgc 19 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification and ss DNA generation <400> 16 cacctaatac gactcactat agcgga 26 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification and ss DNA generation <400> 17 gcaagcttgt tcgagccag 19 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> biotinylated reverse primer for PCR amplification and ssDNA          generation <400> 18 gcaagcttgt tcgagccag 19 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> FAM labeled forward primer for binding assay <400> 19 cacctaatac gactcactat agcgga 26

Claims (7)

DNA aptamer (aptamer) that binds specifically to sulfadimethoxine, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 13.
1) fixing sulfadimethoxine to beads;
2) inducing binding by reacting the sulfadimethoxine-immobilized beads with an ssDNA library having 30-50 arbitrary bases in the center having a primer region for PCR preserved in the sock end;
3) separating the ssDNA bound to the beads to which sulfadimethoxine is immobilized;
4) separating the ssDNA from the ssDNA bound to the isolated sulfadimethoxin immobilized beads; And
5) amplifying ssDNA that specifically binds sulfadimethoxine by performing PCR using a primer pair complementary to the primer region for PCR;
Method for producing a DNA aptamer specifically binding to sulfadimethoxin of claim 1 comprising a.
The method of claim 2, wherein the bead is a sepharose bead (sepharose bead) or a magnetic bead (magnetic bead) characterized in that the method for producing a DNA aptamer specifically binding to sulfadimethoxin.
3. The sulfadimethoxine according to claim 2, wherein the primer region for PCR in step 2) has an amino acid sequence as shown in SEQ ID NO: 14 at the N-terminus and an amino acid sequence as shown in SEQ ID NO: 15 at the C-terminus. Method for producing a DNA aptamer specifically binding to.
The method of claim 2, wherein the steps of 2) to 5) are repeated 13 or more times.
A sulfadimethoxine detection composition comprising a DNA aptamer specifically binding to sulfadimethoxin, characterized in that it has a nucleotide sequence of any one of SEQ ID NOs: 1 to 13.
A sulfadimethoxine detection kit comprising a DNA aptamer specifically binding to sulfadimethoxin, characterized by having a nucleotide sequence of any one of SEQ ID NOs: 1 to 13.

Images