KR20110069887A - 인자 ｖｉｉ 유전자의 발현을 저해하기 위한 조성물 및 방법 - Google Patents

인자 ｖｉｉ 유전자의 발현을 저해하기 위한 조성물 및 방법 Download PDF

Info

Publication number
KR20110069887A
KR20110069887A KR1020117011054A KR20117011054A KR20110069887A KR 20110069887 A KR20110069887 A KR 20110069887A KR 1020117011054 A KR1020117011054 A KR 1020117011054A KR 20117011054 A KR20117011054 A KR 20117011054A KR 20110069887 A KR20110069887 A KR 20110069887A
Authority
KR
South Korea
Prior art keywords
base
modified
mod
dsrna
artificial sequence
Prior art date
Application number
KR1020117011054A
Other languages
English (en)
Inventor
버지트 브람라게
라이너 콘스틴
자크 힘버
마르쿠스 호스바흐
파멜라 탄
한스-피터 본로처
Original Assignee
에프. 호프만-라 로슈 아게
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에프. 호프만-라 로슈 아게 filed Critical 에프. 호프만-라 로슈 아게
Publication of KR20110069887A publication Critical patent/KR20110069887A/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 인자 VII 유전자의 발현을 저해하기 위한 2중 스트랜드 리보핵산(dsRNA)에 관한 것이다. 본 발명은 또한 dsRNA 또는 핵산 분자 또는 이를 코딩하는 벡터를 약학적으로 허용가능한 담체와 함께 포함하는 약학 조성물; 상기 약학 조성물을 사용하여 인자 VII 유전자의 발현에 의해 야기되는 질병을 치료하는 방법; 및 세포에서 인자 VII의 발현을 저해하는 방법에 관한 것이다.

Description

인자 ＶＩＩ 유전자의 발현을 저해하기 위한 조성물 및 방법{COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENES}
본 발명은 2중 스트랜드 리보핵산(dsRNA: double-stranded ribonucleic acid), 및 인자 VII 유전자의 발현을 저해하기 위해 RNA 간섭을 조절하는데 있어서의 이들의 용도, 특히 인자 VII 자이모겐(zymogen) 발현을 간에서 저해하고 후속적으로 인자 VII 자이모겐 혈장 수준을 저하시키는데 있어서의 이들의 용도에 관한 것이다. 더욱이, 응고 인자 VIIa, IXa, Xa, XIIa, 트롬빈, 유사 동맥 및 정맥 혈전증, 염증, 동맥경화증 및 암의 활성화와 연관된 광범위한 혈전색전성 질병/질환의 치료/예방에 있어서의 상기 dsRNA의 용도 또한 본 발명의 일부이다.
인자 VII(FVII)는 혈액 응고의 외인성 경로의 저해에 참여하는 비타민 K-의존성 당단백질이다. FVII는 간에서 합성되고 주로 혈장에서 비활성 단일쇄 자이모겐으로서 순환한다. 혈관 손상에 의해 노출된 조직 인자(TF: Tissue Factor)에 결합될 경우, FVII는 단일 펩타이드 결합의 분할에 의해 그의 2개 쇄 활성 형태(FVIIa)로 분할되어 20-kDa의 경쇄 및 30-kDa의 중쇄를 만들어낸다. FVIIa의 경쇄는 2개의 상피 성장 인자-유사(EGF-1, EGF-2) 도메인 및 γ-카복시글루탐산(Gla) 도메인을 포함하고, 이는 칼슘 결합을 허용하여 분자중 배좌 변화를 일으켜, 새로운 에피토프를 노출시키고 TF로의 후속적 결합을 촉진시킨다. 중쇄는 응고에 대한 다른 세린 프로테아제에 구조적으로 상동성인 촉매작용 도메인을 포함한다. 다시, TF:FVIIa 착체는 제한된 단백질분해적 분할에 의해 FIX 및 FX를 활성화시켜 트롬빈 형성 및 최종적으로 피브린 응고물을 유도한다.
인간 FVII 유전자는 간세포에서 발현되지만, FVII mRNA의 정상 상태(steady state) 수준은 매우 낮다. 인간 FVII의 완전한 서열은 전장(full-length) cDNA 클론으로부터 추론되었다(하겐(Hagen F. S.) 등의 문헌[Proc . Natl . Acad . Sci. USA (1986) 83:2412-2416]). FVII의 상승된 수준은 심혈관 질환의 진행에 대해 독립적인 위험 인자와 연관되었다. 고콜레스테롤혈증 환자에서, FVII 수준은 염증촉진성 변수, 예컨대 C-반응성 단백질(CRP: C-reactive protein) 또는 사이토킨(IL-6)과 독립적으로 상관되었다. 그러나, 모든 연구에서 관상 심장 질병에서 독립적 위험 인자로서 FVII를 확인한 것은 아니다(로우(Lowe G. D. O.) 등의 문헌[Arterioscler . Thromb . Vase . Biol. (2004) 24:1529-1534]).
TF:FVIIa 착체는 응고 및 염증 반응 사이의 착체 교차응답(crosstalk)에서 중요한 역할을 한다. TF:FVIIa 착체는, 응고시 이의 확립된 역할에 더하여, 염증, 암의 혈관신생 및 병리생리 및 아테롬성경화증 등의 세포 과정에 영향을 주는 신호 변환과 같은 세포내 변화를 유도한다.
동물 모델에서의 개념 실험의 증거로부터 FVIIa의 특이적 저해 또는 혈장중 FVII 자이모겐 수준의 감소는 출혈 경향을 증진시키지 않으면서 항혈전성 및 항염증성 효과를 일으킴을 알 수 있었다(수(Xu H.) 등의 문헌[J. Pathol. (2006) 210:488-496]). 패혈증 모델에서, 내독소 유도된 응고 활성화의 저해, 염증성 중재자 인터류킨(interleukin)-6(Il-6), IL-8의 발현 감소 및 사망의 방지가 활성 부위-비활성화 FVIIa로 치료된 원숭이에서(테일러(Taylor F.) 등의 문헌[Blood . (1998) 91:1609-1615]) 또는 FVII/VIIa에 대한 단일클론 Fab 단편에서(비에몬드(Biemond B. J.) 등의 문헌[Thromb . Haemost. (1995) 73:223-230]) 관찰되었다. 또한 활성 부위-비활성화 FVIIa는 실험에 의한 급성 췌장염에서 강력한 항염증 특성을 나타내어(앤더슨(Andersson E.) 등의 문헌[Scand . J. Gastroenterology (2007) 42:765-770]), 폐, 회장 및 결장에서 호중구의 조직 침윤을 방지하고, 예컨대 IL-6 및 대식세포 염증성 단백질-2(MIP(macrophage inflammatory protein)-2)를 감소시켰다.
게다가, 마우스에서 TF:FVIIa 착체의 관절내 주사는 활액 조직으로의 단세포 침윤을 유도하고, 이는 연골 및 골 파쇄가 수반된다. 관절염 위중성은 TF 돌연변이 마우스에서 상당히 감소되었고, 이로부터 류마티스 관절염 환자의 관절에서 종종 골내에서 발견되는 TF/FVII 착체가 만성 파쇄성 관절염의 유도 및 진행 둘다에 있어서 중요한 요소임을 알 수 있다(양(Yang Y. H.) 등의 문헌[Am . J. Pathol . (2004) 164:109-117]).
TF:FVIIa 착체의 항-TF 단일클론 항체(뮬러(Mueller B. M.) 등의 문헌[Proc . Natl. Acad . Sci . USA (1992) 89:11832-11836]), 조직 인자 경로 억제제(아미르크호스라비(Amirkhosravi A.) 등의 문헌[Semin . Thromb . Hemost. (2007) 33:643-652])에 의한 차단 또는 TF 발현의 특이적 TF siRNA에 의한 넉다운(knock down)은 실험에 의한 폐 전이를 저해하는데(아마르즈귀위(Amarzguioui M.) 등의 문헌[Clin . Cancer Res . (2006) 12:4055-4061]), 이로부터 TF:FVIIa 착체가 종양 성장 및 전이의 촉진에도 관여함을 알 수 있고, 추가로 TF:FVIIa 착체의 저해가 암 치료를 위한 임상적으로 실현가능한 전략인 것으로 제안된다.
혈전증 및 염증 질환의 치료에서의 상당한 진전에도 불구하고, 예를 들어 관상 동맥 질환, 아테롬성경화증, 류마티스 관절염, 암/전이와 같은 증식 질환에 대한 현재의 이해상황은, 항혈전성 및 항염증성 특성 둘다를 갖는 치료 활성 안전성 물질이 표준 치료법에 대한 개선점임을 제안한다.
2중 스트랜드 RNA 분자(dsRNA)는 RNA 간섭(RNAi: RNA interference)으로 공지된 매우 보존적인 조절 기작으로 유전자 발현을 차단하는 것으로 보여졌다. 본 발명은 FVII의 발현을 선별적으로 및 효과적으로 감소시킬 수 있는 2중 스트랜드 리보핵산 분자(dsRNA)를 제공한다. FVII RNAi의 사용은 FVIIa의 형성, TF-FVIIa 착체, FVIIa 및 TF에 의해 직접적으로 또는 간접적으로 활성화되는 응고 인자, 예컨대 IXa, Xa, XIIa 및 트롬빈, 염증 인자, 예컨대 사이토킨 및 C-반응성 단백질(CRP)과 연관된 질병/질환을 치료적으로 및/또는 예방적으로 치료하는 방법을 제공한다. 특정 질병/질환 상태는 동맥 및 정맥 혈전증, 심부정맥 혈전증, 불안정 협심증, 급성 관상 증후군, 심근 경색, 심박 세동에 기인한 뇌졸중, 폐색전증, 뇌색전증, 신장색전증, 중증 사지 허혈, 급성 사지 허혈, 산재성 혈관내 응고(예를 들어 박테리아, 바이러스성 질병, 암, 패혈증, 다발성 외상에 기인함), 괴저, 겸상 적혈구 빈혈증(Sickle cell disease), 동맥주위염 결절(periateritis nodosale), 가와사키(Kawasaki) 증후군, 버거병(Buerger disease), 항인지질항체 증후군, 제한되지 않지만 급성 또는 만성 아테롬성경화증, 류마티스 관절염을 비롯한 염증 반응, 증식질환, 예컨대 암/전이, 췌장염의 치료적 및/또는 예방적 치료를 포함하고, 이러한 방법은 인간 또는 동물에게 FVII 표적화 dsRNA를 투여함을 포함한다. 본 발명의 화합물은, 혈액이 신체내 의료 장치(예를 들어, 기계적 및 생물학적 인공 심장 밸브, 혈관 스텐트, 혈관 카테터, 혈관 이식물) 또는 신체외 의료 장치(예를 들어, 혈액투석, 심장-폐 기계)와 접촉할 경우, 혈전증의 예방에 사용될 수도 있다.
본 발명은 FVII 유전자(들)의 침묵(silencing)에 의해 간세포에서 FVII의 발현을 선택적으로 및 효과적으로 감소시킴으로써 간에서 합성되는 FVII 단백질의 수준을 감소시키고 최종적으로 혈장에서 FVII 활성을 감소시킬 수 있는 2중 스트랜드 리보핵산 분자(dsRNA)를 제공한다. 한 바람직한 실시양태에서, 기재된 dsRNA 분자는 FVII 유전자 발현을 적어도 70% 저해할 수 있다. 본 발명은 또한 상기 기재된 증상 및 질병들을 비롯하여 FVII 유전자 발현에 의해 야기된 병리학적 증상 및 질병을 치료하기 위해 FVII dsRNA에 의해 특이적으로 간을 표적화하는 조성물 및 방법을 제공한다.
한 실시양태에서, 본 발명은 인자 VII의 발현, 특히 포유동물 또는 인간 인자 VII 유전자의 발현을 저해하기 위한 2중 스트랜드 리보핵산 분자(dsRNA)를 제공한다. dsRNA는 서로 상보성인 적어도 2개의 서열을 포함한다. dsRNA는 제1 서열을 포함하는 센스(sense) 스트랜드를 포함하고 안티센스(antisense) 스트랜드는 제2 서열을 포함할 수 있으며, 또한 첨부된 표 1, 4, 6 및 7에서 제공된 특정 dsRNA 쌍을 참조한다. 한 실시양태에서, 센스 스트랜드는 FVII를 코딩하는 mRNA의 적어도 일부와 적어도 90%의 동일성을 갖는 서열을 포함한다. 상기 서열은 안티센스 스트랜드에 대한 센스 스트랜드의 상보성 영역에 위치된다. 한 바람직한 실시양태에서 dsRNA는 특히 인간 인자 VII 유전자를 표적화하고, 또 다른 바람직한 실시양태에서, dsRNA는 기니 피그(카비아 포르셀러스(Cavia porcellus)) 또는 래트(래터스 노르베기커스(Rattus norvegicus)) 인자 VII 유전자를 표적화한다.
한 실시양태에서, 안티센스 스트랜드는 상기 인자 VII 유전자를 코딩하는 mRNA의 적어도 일부와 실질적으로 상보성인 뉴클레오티드 서열을 포함하고, 상보성 영역은 가장 바람직하게는 30개 미만의 뉴클레오티드 길이이다. 더욱이, 본원에 기재된 본 발명의 ds 분자의 길이(2중 길이)는 약 16 내지 30개 범위의 뉴클레오티드, 특히 약 18 내지 28개 범위의 뉴클레오티드이다. 약 19개, 20개, 21개, 22개, 23개 또는 24개 뉴클레오티드의 2중 길이가 본 발명의 관점에서 특히 유용하다. 19개, 21개 또는 23개 뉴클레오티드의 2중 연장부가 가장 바람직하다. dsRNA는, 인자 VII 유전자를 발현하는 세포와 접촉될 경우, 인자 VII 유전자의 발현을 시험관내에서 적어도 70% 저해한다.
선택된 dsRNA 분자는 첨부된 표 6 및 7에 제공되고, 바람직한 dsRNA 분자는 서열 번호 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437 및 438의 뉴클레오티드 1개 내지 19개를 포함한다.
한 실시양태에서 상기 dsRNA 분자는 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부(overhang)를 갖는 안티센스 스트랜드를 포함한다. 바람직하게는 안티센스 스트랜드의 상기 돌출부는 우라실, 또는 인자 VII를 코딩하는 mRNA에 적어도 90% 상보성인 뉴클레오티드를 포함한다.
또 다른 바람직한 실시양태에서, 상기 dsRNA 분자는 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부를 갖는 센스 스트랜드를 포함한다. 바람직하게는 센스 스트랜드의 상기 돌출부는 우라실, 또는 인자 VII를 코딩하는 mRNA에 적어도 90% 상보성인 뉴클레오티드를 포함한다.
또 다른 바람직한 실시양태에서, 상기 dsRNA 분자는 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부를 갖는 센스 스트랜드, 및 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부를 갖는 안티센스 스트랜드를 포함한다. 바람직하게는 센스 스트랜드의 상기 돌출부는 우라실, 또는 인자 VII를 코딩하는 mRNA에 적어도 90% 상보성인 뉴클레오티드를 포함하고, 안티센스 스트랜드의 상기 돌출부는 우라실, 또는 인자 VII를 코딩하는 mRNA에 적어도 90% 상보성인 뉴클레오티드를 포함한다.
바람직한 dsRNA 분자에서, 무엇보다도 바람직하게는, 센스 스트랜드는 서열 번호 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 및 437로 도시된 핵산 서열로 구성된 군에서 선택되고 안티센스 스트랜드는 서열 번호 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436 및 438로 도시된 핵산 서열로 구성된 군에서 선택된다. 따라서, 본 발명의 dsRNA 분자는, 무엇보다도, 서열 번호 413/414, 415/416, 417/418, 419/420, 421/422, 423/424, 425/426, 427/428, 429/430, 431/432, 433/434, 435/436 및 437/438로 구성된 군에서 선택된 서열 쌍을 포함한다. 본원에 제공된 특정 dsRNA 분자에 있어서, 서열 번호의 쌍은 또한 첨부된 표에 제시된 바와 같은 상응하는 센스 및 안티센스 스트랜드 서열(5'에서 3')에 관련된다.
또한 변형된 dsRNA 분자가 본원에 제공되고, 특히 본 발명의 변형된 dsRNA 분자의 예를 제공하는 첨부된 표 1 및 4에 나타나 있다.
표 2 및 3은 본 발명의 특정 dsRNA 분자의 선택적, 생물학적, 임상학적 및 약학적 관련 매개변수를 제공한다.
상기 본원에 지시된 바와 같이, 표 1은 본 발명의 변형된 dsRNA의 예를 제공한다(이로 인해 상응하는 센스 스트랜드 및 안티센스 스트랜드가 이러한 표에 제공된다). 하지만, 본 발명의 dsRNA의 이들 구성요소의 예시적인 변형은 변형의 예로서 본원에 제공된다. 또한 이들 dsRNA(및 이의 구성요소)의 추가의 변형은 본 발명의 한 실시양태로서 이루어진다. 상응하는 예는 본 발명의 보다 상세한 설명에서 제공된다.
첨부된 표 4 및 7은 또한 본 발명에 있어서 유용한 추가의 siRNA 분자/dsRNA를 제공하고, 여기서 표 4는 표 7에 제시된 바와 같이 본 발명의 변형된 siRNA 분자/dsRNA 분자의 특정한 생물학적 및/또는 임상적으로 연관된 놀라운 특징을 제공한다. 이들 RNA 분자는 예시적인 뉴클레오티드 변형을 포함한다.
가장 바람직한 dsRNA 분자는 첨부된 표 1 및 4에 제공되고, 무엇보다도, 바람직하게는, 센스 스트랜드는 서열 번호 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 및 25로 도시된 핵산 서열로 구성된 군에서 선택되고, 안티센스 스트랜드는 서열 번호 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 및 26으로 도시된 핵산 서열로 구성된 군에서 선택된다. 따라서, 본 발명의 dsRNA 분자는, 무엇보다도, 서열 번호 1/2, 3/4, 5/6, 7/8, 9/10, 11/12, 13/14, 15/16, 17/18, 19/20, 21/22, 23/24 및 25/26으로 구성된 군에서 선택된 서열 쌍을 포함한다. 가장 바람직한 dsRNA 분자는 서열 쌍 19/20 및 11/12를 포함한다. 본원에 제공된 특이적 dsRNA 분자의 경우, 서열 번호 쌍은 또한 첨부되고 포함된 표에 제시된 바와 같은 상응하는 센스 및 안티센스 스트랜드 서열(5'에서 3')에 관련된다.
한 실시양태에서 본 발명의 dsRNA 분자는 센스 및 안티센스 스트랜드를 포함하고, 여기서 상기 스트랜드중 적어도 하나는 적어도 24시간의 반감기를 갖는다. 또 다른 실시양태에서, 본 발명의 dsRNA 분자는 비면역자극성이고, 예를 들어 INF-α 및 TNF-α를 시험관내에서 자극하지 않는다.
본 발명의 dsRNA 분자는 자연 발생 뉴클레오티드로 구성될 수 있거나, 또는 적어도 하나의 변형된 뉴클레오티드, 예컨대 2'-O-메틸 변형된 뉴클레오티드, 5'-포스포로티오에이트 기를 포함하는 뉴클레오티드, 및 콜레스테릴 유도체 또는 도데카노산 비스데실아미드 기에 연결된 말단 뉴클레오티드로 구성될 수 있다. 2' 변형된 뉴클레오티드는, 본 발명의 dsRNA 분자가 생체내, 예를 들면 의학적 세팅에서 사용될 경우, 특정 면역자극 인자 또는 사이토킨이 억제되는 추가의 이점을 갖는다. 다르게는 비제한적으로, 변형된 뉴클레오티드는 2'-데옥시-2'-플루오로 변형된 뉴클레오티드, 2'-데옥시-변형된 뉴클레오티드, 잠긴(locked) 뉴클레오티드, 무염기 뉴클레오티드, 2'-아미노-변형된 뉴클레오티드, 2'-알킬-변형된 뉴클레오티드, 모폴리노 뉴클레오티드, 포스포아미데이트, 및 비천연 염기 포함 뉴클레오티드로 구성된 군에서 선택될 수 있다. 한 바람직한 실시양태에서 dsRNA 분자는 다음의 변형된 뉴클레오티드중 적어도 하나를 포함한다: 2'-O-메틸 변형된 뉴클레오티드, 5'-포스포로티오에이트 기 및 데옥시티미딘을 포함하는 뉴클레오티드. 변형된 뉴클레오티드를 포함하는 바람직한 dsRNA 분자는 표 1 및 4에 제공된다.
본 발명은 또한 적어도 하나의 본 발명의 dsRNA를 포함하는 세포를 제공한다. 세포는 바람직하게는 포유동물 세포, 예컨대 인간 세포이다. 더욱이, 본원에 정의된 dsRNA 분자를 포함하는 조직 및/또는 인간 이외의 기관이 본 발명에 포함되고, 여기서 상기 인간 이외의 기관은 리서치 목적을 위해 또는 리서치 투울(tool)로서, 예를 들면 약물 시험에서 특히 유용하다.
더욱이, 본 발명은 하기 단계를 포함하는, 세포, 조직 또는 유기체에서 FVII 유전자, 특히 포유동물 또는 인간 FVII 유전자의 발현을 저해하는 방법에 관한 것이다:
(a) 본원에 정의된 바와 같은 2중 스트랜드 리보핵산(dsRNA)을 세포, 조직 또는 유기체에 도입하는 단계;
(b) FVII 유전자의 mRNA 전사체의 분해를 수득하기에 충분한 시간 동안 단계 (a)에서 생산된 상기 세포, 조직 또는 유기체를 유지함으로써 제공된 세포에서 FVII 유전자의 발현을 저해하는 단계.
본 발명은 또한 본 발명의 dsRNA를 포함하는 약학 조성물에 관련된다. 이들 약학 조성물은 세포, 조직 또는 유기체에서 FVII 유전자의 발현을 저해하는데에 특히 유용하다. 하나 이상의 본 발명의 dsRNA를 포함하는 약학 조성물은 또한 (a) 약학적으로 허용가능한 담체(들), 희석제(들) 및/또는 부형제(들)를 포함할 수 있다.
또 다른 실시양태에서, 본 발명은 치료학적 또는 예방학적 효과량의 하나 이상의 본 발명의 dsRNA를 응고 인자, 염증 또는 증식 질환의 활성화와 연관된 혈전 질환의 치료, 예방 또는 치유가 필요한 피험체에게 투여함을 포함하는, 응고 인자, 염증 또는 증식 질환의 활성화와 연관된 혈전 질환을 치료, 예방 또는 치유하는 방법을 제공한다. 바람직하게는, 상기 피험체는 포유동물이고, 가장 바람직하게는 인간 환자이다.
한 실시양태에서, 본 발명은 인자 VII 유전자의 발현에 의해 중재된 병리학적 증상을 갖는 피험체를 치료하는 방법을 제공한다. 이러한 증상은 예컨대 혈전색전증, 원치않는 염증 또는 증식성 질환 및 상기 기재된 질환 등의 질환을 포함한다. 이러한 실시양태에서, dsRNA는 인자 VII 유전자의 발현을 조절하기 위한 치료제로서 작용한다. 이 방법은 본 발명의 약학 조성물을 환자(예를 들어, 인간)에게 투여하여, 인자 VII 유전자의 발현을 침묵시킴을 포함한다. 이들의 높은 특이성으로 인해, 본 발명의 dsRNA는 인자 VII 유전자의 mRNA를 특이적으로 표적화한다. 한 바람직한 실시양태에서, 기재된 dsRNA는 FVII mRNA 수준을 특이적으로 감소시키고, 세포에서 오프-표적(off-target) 유전자의 발현 및/또는 mRNA 수준에 직접적으로 영향주지 않는다.
한 바람직한 실시양태에서, 기재된 dsRNA는 인자 VII mRNA 수준을 생체내 간에서 적어도 80% 감소시키고, 인자 VII 자이모겐 수준을 생체내 혈장에서 적어도 95% 감소시킨다. 또 다른 실시양태에서, 기재된 dsRNA는 프로트롬빈 시간을 연장시키고 생체내 트롬빈 생성 및 혈전 형성을 억제한다. 또 다른 바람직한 실시양태에서, 기재된 dsRNA 분자에 의해 중재된 이러한 항혈전 효과는 감소된 생체내 혈장 FVII 수준 및 감소된 생체내 간 FVII mRNA 수준과 연관된다.
한 실시양태에서, 기재된 dsRNA 분자는 생체내에서 혈액 응고 시간을 적어도 2배 증가시킨다.
치료적 dsRNA와 관련하여, 기니 피그 또는 세포 배양 모델에서 개별 dsRNA에 대한 독성, 치료 효능 및 효과적 투여량 및 생체내 반감기를 추정하기 위해 사용될 수 있는 기니 피그 인자 VII 표적화 dsRNA 세트가 특히 유용하다.
또 다른 실시양태에서, 본 발명은 세포중 인자 VII 유전자, 특히 본 발명의 dsRNA중 하나의 적어도 1개 스트랜드를 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함하는 인자 VII 유전자의 발현을 저해하는 벡터를 제공한다.
또 다른 실시양태에서, 본 발명은 세포에서 인자 VII 유전자의 발현을 저해하기 위한 벡터를 포함하는 세포를 제공한다. 이러한 벡터는 본 발명의 dsRNA중 하나의 적어도 1개 스트랜드를 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함한다. 다시, 상기 벡터는, 상기 조절 서열 이외에, 본 발명의 dsRNA의 적어도 하나의 "센스 스트랜드" 및 상기 dsRNA의 적어도 하나의 "안티센스 스트랜드"를 코딩하는 서열을 포함하는 것이 바람직하다. 또한 청구된 세포는, 상기 조절 서열 이외에, 본 발명의 dsRNA중 하나의 적어도 1개 스트랜드를 코딩하는 본원에 정의된 서열(들)을 포함하는 2개 이상의 벡터를 포함하는 것이 고려된다.
한 실시양태에서, 본 방법은 dsRNA를 포함하는 조성물을 투여하는 단계를 포함하고, 여기서 dsRNA는 치료되는 포유동물의 인자 VII 유전자의 RNA 전사체의 적어도 일부에 상보성인 뉴클레오티드 서열을 포함한다. 상기 지시된 바와 같이, 또한 본원에 정의된 dsRNA 분자의 적어도 하나의 스트랜드를 코딩하는 핵산 분자를 포함하는 세포 및 벡터가 약학 조성물로서 사용될 수 있고, 따라서 또한 의료적 개입이 필요한 피험체를 치료하는 본원에 개시된 방법에 사용될 수 있다. 또한, 약학 조성물 및 (인간) 피험체를 치료하는 상응하는 방법에 관한 이들 실시양태가 유전자 치료 연구법과 같은 연구법에 관련됨을 주지해야 한다. 본원에 제공된 바와 같은 인자 VII 특이적 dsRNA 분자 또는 본 발명의 dsRNA 분자의 개별 스트랜드를 코딩하는 핵산 분자는 벡터내로 삽입되어 인간 환자를 위한 유전자 치료 벡터로서 사용될 수도 있다. 유전자 치료 벡터는, 예를 들면 정맥주사, 국소 투여(미국 특허 제5,328,470호 참조) 또는 주촉성(stereotactic) 주사(예를 들어, 첸(Chen) 등의 문헌[(1994) Proc . Natl . Acad . Sci . USA 91 :3054-3057] 참조)에 의해 피험체에게 전달될 수 있다. 유전자 치료 벡터의 약학 제제는 허용가능한 희석제중에 유전자 치료 벡터를 포함할 수 있거나, 유전자 전달 비히클이 함침된 서방성 매트릭스를 포함할 수 있다. 다르게는, 완전한 유전자 전달 벡터는 재조합 세포로부터 손상되지 않고 생산될 수 있는데, 예를 들어 레트로바이러스벡터이고, 약학 제제는 유전자 전달 시스템을 생산하는 하나 이상의 세포를 포함할 수 있다.
본 발명의 또 다른 양태에서, 인자 VII 유전자 발현 활성을 조절하는 인자 VII 특이적 dsRNA 분자는 DNA 또는 RNA 벡터내로 삽입된 전사 단위로부터 발현된다(예를 들어, 스킬런(Skillern, A.) 등의 국제 PCT 공개공보 제WO 00/22113호 참조). 이들 이식유전자는 선형 구조물, 환형 플라스미드, 또는 바이러스 벡터로서 도입될 수 있고, 이는 숙주 게놈내로 삽입된 이식유전자로서 혼입되고 유전될 수 있다. 이식유전자는 이것이 염색체외 플라스미드로서 유전되도록 작성될 수도 있다(가스만(Gassmann) 등의 문헌[Proc . Natl . Acad . Sci . USA (1995) 92:1292]).
dsRNA의 개별 스트랜드는 2개의 별도의 발현 벡터 상의 프로모터에 의해 전사되고 하나의 표적 세포내로 공동 형질감염될 수 있다. 다르게는 dsRNA의 각각의 개별 스트랜드는 동일한 발현 플라스미드 상에 위치된 프로모터들에 의해 전사될 수 있다. 한 바람직한 실시양태에서, dsRNA는 dsRNA가 줄기 및 루우프 구조를 갖도록 링커 폴리뉴클레오티드 서열에 의해 연결된 역전된 반복부로서 발현된다.
재조합 dsRNA 발현 벡터는 바람직하게는 DNA 플라스미드 또는 바이러스 벡터이다. dsRNA 발현 바이러스 벡터는, 제한되지 않지만, 아데노-연결된 바이러스(조사를 위해, 무지츠카(Muzyczka) 등의 문헌[Curr . Topics Micro . Immunol. (1992) 158:97-129] 참조); 아데노바이러스(예를 들면, 베르크너(Berkner) 등의 문헌[BioTechniques (1998) 6:616], 로센펠드(Rosenfeld) 등의 문헌[1991, Science 252:431-434], 및 로센펠드 등의 문헌[(1992), Cell 68:143-155] 참조); 또는 알파바이러스(alphavirus) 뿐만 아니라 당분야에 공지된 다른 바이러스에 기초하여 작성될 수 있다. 레트로바이러스는 시험관내 및/또는 생체내에서 다양한 유전자를 많은 상이한 세포 유형, 예컨대 상피 세포에 도입하기 위해 사용될 수 있다(예를 들어 다노스(Danos) 및 뮬리간(Mulligan)의 문헌[Proc . Natl . Acad . Sci . USA (1998) 85:6460-6464] 참조). 세포의 게놈내로 삽입된 유전자를 형질도입하고 발현할 수 있는 재조합 레트로바이러스 벡터는 재조합 레트로바이러스 게놈을 적합한 패키지 세포주, 예컨대 PA317 및 Psi-CRIP 내로 형질감염시킴으로써 생산될 수 있다(코멧(Comette) 등의 문헌[1991, Human Gene Therapy 2:5-10]; 콘(Cone) 등의 문헌[1984, Proc . Natl . Acad . Sci . USA 81:6349]). 재조합 아데노바이러스 벡터는 감수성 숙주(예를 들어, 래트, 햄스터, 개 및 침팬지)에서 다양한 세포 및 조직을 감염시키기 위해 사용될 수 있고(수(Hsu) 등의 문헌[1992, J. Infectious Disease, 166:769]), 또한 감염을 위해 유사분열 활성 세포를 필요로하지 않는다는 이점을 갖는다.
본 발명의 DNA 플라스미드 또는 바이러스 벡터에서 dsRNA 발현을 구동하는 프로모터는 진핵생물 RNA 폴리머라아제 I(예를 들어 리보솜성 RNA 프로모터), RNA 폴리머라아제 II(예를 들어 CMV 초기 프로모터 또는 액틴(actin) 프로모터 또는 U1 snRNA 프로모터) 또는 바람직하게는 RNA 폴리머라아제 III 프로모터(예를 들어 U6 snRNA 또는 7SK RNA 프로모터) 또는 원핵생물 프로모터, 예를 들면 T7 프로모터일 수 있지만, 단 발현 플라스미드는 T7 프로모터로부터의 전사에 필요한 T7 RNA 폴리머라아제를 코딩해야 한다. 프로모터는 또한 이식유전자 발현을 췌장으로 유도할 수 있다(예를 들어 부치니(Bucchini) 등의 문헌["췌장을 위한 인슐린 조절 서열(the insulin regulatory sequence for pancreas)", 1986, Proc . Natl . Acad . Sci. USA 83:2511-2515)] 참조).
또한, 이식유전자의 발현은, 예를 들면, 유도성 조절 서열 및 발현 시스템, 예컨대 특정 생리학적 조절자, 예를 들어, 순환 글루코스 수준 또는 호르몬에 감수성인 조절 서열을 사용함으로써 정밀하게 조절될 수 있다(도처티(Docherty) 등의 문헌[1994, FASEB J. 8:20-24]). 세포 또는 포유동물에서 이식유전자 발현의 조절에 적합한 이러한 유도성 발현 시스템은, 엑디손(ecdysone), 에스트로겐, 프로게스테론, 테트라사이클린, 이량체화의 화학 유도제, 및 이소프로필-베타-D1-티오갈락토피라노사이드(EPTG: isopropyl-beta-D1-thiogalactopyranoside)에 의한 조절을 포함한다. 당분야의 숙련가라면 dsRNA 이식유전자의 의도된 용도에 기초하여 적절한 조절/프로모터 서열을 선택할 수 있을 것이다.
바람직하게는, dsRNA 분자를 발현할 수 있는 재조합 벡터는 이후 기재된 바와 같이 전달되고, 표적 세포에서 지속된다. 다르게는, dsRNA 분자의 일시적 발현을 제공하는 바이러스 벡터가 사용될 수 있다. 이러한 벡터는 필요시 반복적으로 투여될 수 있다. 일단 발현되면, dsRNA는 표적 RNA에 결합하여 그의 기능 또는 발현을 조절한다. dsRNA 발현 벡터의 전달은, 예컨대 정맥내 또는 근육내 투여에 의해, 환자로부터 외식된 표적 세포에 투여된 후 환자내로 재도입됨으로써, 또는 목적하는 표적 세포내로의 도입을 허용하는 임의의 다른 수단에 의해 전신적일 수 있다.
dsRNA 발현 DNA 플라스미드는 양이온성 지질 담체(예를 들어 올리고펙타민(Oligofectamine)) 또는 비양이온성 지질계 담체(예를 들어 트랜짓(Transit)-TKO(등록상표))와의 착체로서 표적 세포내로 형질감염되는 것이 전형적이다. 일주일 이상의 기간에 걸친 단일 A 인자 VII 유전자 또는 다중 A 인자 VII 유전자의 상이한 범위를 표적화하는 dsRNA-중재된 넉다운을 위한 다중 지질 형질감염도 본 발명에 의해 고려된다. 본 발명의 벡터의 숙주 세포내로의 성공적인 도입은 다양한 공지된 방법을 사용하여 모니터링될 수 있다. 예를 들면, 일시적인 형질감염은 리포터(reporter), 예컨대 형광물질 마커, 예컨대 그린 형광 단백질(GFP: Green Fluorescent Protein)에 의해 신호화될 수 있다. 생체외 세포의 안정한 형질감염은 특정 환경 인자(예를 들어, 항생물질 및 약물)에 대한 내성, 예컨대 하이그로마이신(hygromycin) B 내성을 갖는 형질감염된 세포를 제공하는 마커를 사용하여 확보될 수 있다.
하기 상세한 설명은 표적 인자 VII 유전자의 발현을 저해하기 위한 dsRNA 및 dsRNA를 함유하는 조성물의 제조 방법 및 용도, 뿐만 아니라 상기 인자 VII 유전자의 발현에 의해 야기되는 질병 및 질환을 치료하기 위한 조성물 및 방법을 개시한다.
정의
편리성을 위해, 명세서, 실시예 및 첨부된 특허청구범위에서 특정 용어 및 문구의 의미는 이후 제공된다. 본 명세서의 다른 부분들에서의 용어의 용법과 본 섹션에 제공된 그의 정의 사이에 분명한 차이가 존재할 경우, 본 섹션에서의 정의가 우세할 것이다.
"G," "C," "A", "U" 및 "T" 또는 "dT"는 개별적으로 각각 일반적으로 구아닌, 시토신, 아데닌, 우라실 및 데옥시티미딘을 염기로서 각각 포함하는 뉴클레오티드를 대표한다. 그러나, 용어 "리보뉴클레오티드" 또는 "뉴클레오티드"는 또한 이후 추가로 설명되는 바와 같이 변형된 뉴클레오티드, 또는 대용의 치환 잔기를 지칭한다. 이러한 치환 잔기를 포함하는 서열은 본 발명의 실시양태이다. 이후 설명되는 바와 같이, 본원에 기재된 dsRNA 분자는 "돌출부", 즉 "센스 스트랜드" 및 "안티센스 스트랜드"의 본원에 정의된 쌍에 의해 통상적으로 형성되는 RNA 2중 나선 구조에 직접 관여되지 않는, 쌍을 이루지 않고 돌출된 뉴클레오티드를 포함할 수도 있다. 종종, 이러한 돌출된 연장부는 데옥시티미딘 뉴클레오티드를, 대부분의 실시양태에서 2 데옥시티미딘을 3' 말단에서 포함한다. 이러한 돌출부는 이후 설명되고 예시될 것이다.
본원에 사용될 경우 용어 "인자 VII" 또는 "FVII"는 특히 "프로컨버틴(proconvertin)" 또는 "혈청 프로트롬빈 전환 가속화제"로서 이전에 기재된 응고 인자 VII에 관련되고, 이 용어는 상응하는 유전자, 코딩된 mRNA, 코딩된 단백질/폴리펩타이드 뿐만 아니라 이의 작용성 단편에 관련된다. 용어 "인자 VII 유전자/서열"은 야생형 서열(들) 뿐만 아니라 이러한 유전자/서열에 포함될 수 있는 돌연변이 및 변형에 관련된다. 따라서, 본 발명은 본원에 제공된 특정 dsRNA 분자로 제한되지 않는다. 본 발명은 또한 이러한 돌연변이/변형을 포함하는 인자 VII 유전자의 RNA 전사체의 상응하는 뉴클레오티드 연장부에 적어도 85% 상보성인 안티센스 스트랜드를 포함하는 dsRNA 분자에 관련된다.
본원에 사용될 경우, "표적 서열"은 인자 VII 유전자의 전사 동안 형성되는 mRNA 분자, 예컨대 주요 전사 산물의 RNA 가공의 산물인 mRNA의 뉴클레오티드 서열의 인접 부분을 지칭한다.
본원에 사용될 경우, 용어 "서열을 포함하는 스트랜드"는 표준 뉴클레오티드 명명법을 사용하여 지칭되는 서열에 의해 설명되는 뉴클레오티드의 쇄를 포함하는 올리고뉴클레오티드를 지칭한다. 그러나, 본원에 상세히 설명된 바와 같이, 이러한 "서열을 포함하는 스트랜드"는 또한 변형된 뉴클레오티드와 같은 변형을 포함할 수 있다.
본원에 사용될 경우, 달리 지시되지 않는 한, 용어 "상보성"은, 제1 뉴클레오티드 서열을 제2 뉴클레오티드 서열에 관하여 설명하기 위해 사용될 경우, 제1 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드 또는 폴리뉴클레오티드가 특정 조건하에 제2 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드 또는 폴리뉴클레오티드와 하이브리드화하여 2중 구조를 형성하는 능력을 지칭한다. "상보성" 서열은, 본원에 사용될 경우, 이들의 하이브리드화 능력에 관한 상기 요건이 충족되는 한, 비-왓슨 크릭(non-Watson-Crick) 염기 쌍 및/또는 비천연의 변형된 뉴클레오티드로부터 형성된 염기 쌍을 포함하거나 이로부터 전적으로 형성될 수 있다.
"완전히 상보성"인 것으로 지칭되는 서열은, 제1 및 제2 뉴클레오티드 서열의 전체 길이에 걸친, 제1 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드 또는 폴리뉴클레오티드의 제2 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드 또는 폴리뉴클레오티드로의 염기 쌍 형성을 포함한다.
그러나, 제1 서열이 본원에서 제2 서열과 관련하여 "실질적으로 상보성"인 것으로 지칭되는 경우, 2개의 서열은 완전히 상보성이거나, 이들은 하이브리드화될 때 1개 이상, 그러나 바람직하게는 4개, 3개 또는 2개 이하의 부정합 염기 쌍을 형성할 수 있다.
본원에서 용어 "상보성", "완전히 상보성" 및 "실질적으로 상보성"은 dsRNA의 센스 스트랜드와 안티센스 스트랜드 사이의 염기 정합, 또는 표적 서열과 dsRNA의 안티센스 스트랜드 사이의 염기 정합에 대해 사용될 수 있고, 이들의 용도로부터 이해될 것이다.
용어 "2중 스트랜드 RNA" 또는 "dsRNA"는, 본원에 사용될 경우, 2개의 반평행(anti-parallel)의 실질적으로 상보성인 핵산 스트랜드를 포함하는 2중 구조를 갖는 리보핵산 분자, 또는 리보핵산 분자의 착체를 지칭한다. 2중 구조를 형성하는 2개의 스트랜드는 하나의 보다 큰 RNA 분자의 상이한 부분일 수 있거나, 이들은 별도의 RNA 분자일 수 있다. 2개 스트랜드가 하나의 보다 큰 분자의 일부이고, 이에 따라 2중 구조를 형성하는 1개의 스트랜드의 3'-말단 및 나머지 스트랜드의 5'-말단 사이에서 뉴클레오티드의 차단되지 않은 쇄에 의해 연결되는 경우, 연결 RNA 쇄는 "헤어핀 루우프(hairpin loop)"로 지칭된다. 2개의 스트랜드가 2중 구조를 형성하는 1개 스트랜드의 3'-말단 및 나머지 스트랜드의 5'-말단 사이에서 뉴클레오티드의 차단되지 않은 쇄 이외의 수단에 의해 공유 결합되는 경우, 연결 구조체는 "링커"로 지칭된다. RNA 스트랜드는 동일하거나 상이한 수의 뉴클레오티드를 가질 수 있다. 2중 구조에 더하여, dsRNA는 하나 이상의 뉴클레오티드 돌출부를 포함할 수 있다. 이러한 "돌출부"에서의 뉴클레오티드는 0 내지 5개의 뉴클레오티드를 포함할 수 있고, 여기서 "0"은 "돌출부"를 형성하는 추가의 뉴클레오티드(들)가 없음을 의미하는 반면, "5"는 dsRNA 2중체의 개별 스트랜드 상에 5개의 추가의 뉴클레오티드가 존재함을 의미한다. 이들 선택적 "돌출부"는 개별 스트랜드의 3' 말단에 위치된다. 이후 상세히 설명되는 바와 같이, 또한 2개 스트랜드중 하나에 단지 1개의 "돌출부"를 포함하는 dsRNA 분자가 본 발명에 있어서 유용하고 더 유리할 수 있다. "돌출부"는 바람직하게는 0 내지 2개의 뉴클레오티드를 포함한다. 가장 바람직하게는 2 "dT"(데옥시티미딘) 뉴클레오티드가 dsRNA의 양쪽 스트랜드의 3' 말단에서 발견된다. 따라서, "뉴클레오티드 돌출부"는 dsRNA의 하나의 스트랜드의 3' 말단이 나머지 스트랜드의 5' 말단을 지나 연장되거나 그 반대인 경우 dsRNA의 2중 구조로부터 튀어나온, 쌍을 이루지 않은 뉴클레오티드 또는 뉴클레오티드들을 지칭한다. "무딘(blunt)" 또는 "무딘 말단"은 dsRNA의 말단에 쌍을 이루지 않은 뉴클레오티드가 없음, 즉 뉴클레오티드 돌출부가 없음을 의미한다. "무딘 말단의" dsRNA는 그의 전체 길이에 걸쳐 2중 스트랜드를 갖는, 즉 분자의 어느 말단에도 뉴클레오티드 돌출부가 없는 dsRNA이다.
용어 "안티센스 스트랜드"는 표적 서열에 실질적으로 상보성인 영역을 포함하는 dsRNA의 스트랜드를 지칭한다. 본원에 사용될 경우, 용어 "상보성 영역"은 서열, 예를 들면 표적 서열에 실질적으로 상보성인 안티센스 스트랜드 상의 영역을 지칭한다. 상보성 영역이 표적 서열과 완전히 상보성이 아닌 경우, 부정합은 대부분 말단 영역에서 용인되고, 존재할 경우, 바람직하게는 말단 영역 또는 영역들, 예를 들어, 5' 및/또는 3' 말단의 6개, 5개, 4개, 3개, 또는 2개 뉴클레오티드 이내이다.
용어 "센스 스트랜드"는 본원에 사용될 경우, 안티센스 스트랜드의 영역에 실질적으로 상보성인 영역을 포함하는 dsRNA의 스트랜드를 지칭한다. "실질적으로 상보성인"은 센스 스트랜드 및 안티센스 스트랜드에서 돌출된 뉴클레오티드의 적어도 85%가 상보성임을 의미한다.
"세포내로 도입"은, dsRNA에 대해 언급될 경우, 당분야의 숙련가가 이해하는 바와 같이, 세포내로의 섭취(uptake) 또는 흡수를 촉진함을 의미한다. dsRNA의 흡수 또는 섭취는 보조되지 않은 확산성 또는 활성 세포 과정을 통해, 또는 보조제나 장치에 의해 야기될 수 있다. 이러한 용어의 의미는 시험관내 세포로 제한되지 않고; dsRNA는 또한 "세포내로 도입"될 수 있는데, 여기서 세포는 살아있는 유기체의 일부이다. 이러한 경우에, 세포내로의 도입은 유기체로의 전달을 포함할 것이다. 예를 들면, 생체내 전달의 경우, dsRNA는 조직 부위로 주사되거나 전신으로 투여될 수 있다. 예를 들면, 본 발명의 dsRNA 분자가 의료적 개입이 필요한 피험체에게 투여됨이 고려된다. 이러한 투여는 본 발명의 dsRNA, 벡터 또는 세포를 상기 피험체의 환부, 예를 들면 간 조직/세포내로 또는 암 조직/세포, 예컨대 간 암 조직으로 주사함을 포함할 수 있다. 그러나, 환부 조직의 매우 가까운 곳에 주사하는 것도 고려된다. 세포내로의 시험관내 도입은 전기천공 및 리포펙션(lipofection)과 같은 당분야에 공지된 방법을 포함한다.
용어 "침묵", "발현을 저해함" 및 "넉다운"은, 이들이 인자 VII 유전자를 지칭하는 한, 본원에서, 인자 VII 유전자가 전사되는 제1 세포 또는 세포 군으로부터 단리될 수 있고, 처리되지 않은 제1 세포 또는 세포의 군(대조 세포)과 실질적으로 동일한 제2 세포 또는 세포 군에 비해 인자 VII 유전자의 발현이 저해되도록 처리된 인자 VII 유전자로부터 전사된 mRNA의 양의 감소로 입증되는 바와 같이, 인자 VII 유전자의 발현의 적어도 부분적인 억제를 지칭한다.
Figure pct00001
다르게는, 저해도는 인자 VII 유전자 전사에 작용적으로 연결된 매개변수, 예를 들어 세포에 의해 분비되는 인자 VII 유전자에 의해 코딩된 단백질의 양, 또는 특정 표현형을 나타내는 세포의 수의 감소로 제시될 수 있다.
본원에 제공된 첨부된 실시예 및 첨부된 표에 예시된 바와 같이, 본 발명의 dsRNA 분자는 시험관내 분석법에서, 즉 시험관내에서 인간 인자 VII의 발현을 적어도 약 70% 저해할 수 있다. 또 다른 실시양태에서 본 발명의 dsRNA 분자는 기니 피그 인자 VII의 발현을 적어도 70% 저해할 수 있는데, 이는 또한 생체내에서 상당한 항혈전 효과를 유도한다. 당분야의 숙련가라면 이러한 저해율 및 관련된 효과를, 특히 본원에 제공된 분석법의 견지에서 쉽게 결정할 수 있다. 특히 바람직한 dsRNA가, 예를 들면 첨부된 표 1에, 특히 순위 1 내지 13(5'에서 3' 배향으로 본원에 제공된 센스 스트랜드 및 안티센스 스트랜드 서열)에 제공된다.
용어 "오프(off) 표적"은 본원에 사용될 경우 서열 상보성에 기초하여 기재된 dsRNA에 하이브리드화하기 위해 컴퓨터모의실험(in silico)에 의해 예측되는 전사체의 모든 비-표적 mRNA를 지칭한다. 본 발명의 dsRNA는 바람직하게는 인자 VII의 발현을 특이적으로 저해하고, 즉 어떠한 오프-표적의 발현도 저해하지 않는다.
용어 "반감기"는 본원에 사용될 경우 화합물 또는 분자의 안정성의 척도이고, 본원에 제공된 분석법의 견지에서 당분야의 숙련가에게 공지된 방법에 의해 평가될 수 있다.
용어 "비면역자극성"은 본원에 사용될 경우 본 발명의 dsRNA 분자에 의한 어떠한 면역 반응의 유도도 존재하지 않음을 지칭한다. 면역 반응을 결정하기 위한 방법은 당분야의 숙련가에게 공지되어 있고, 예를 들면 실시예에 기재된 바와 같이, 사이토킨의 방출을 평가함에 의해서이다.
용어 "치료하다", "치료" 등은, 본 발명에 있어서, 인자 VII 발현에 관련된 질환, 예컨대 혈전색전성 질환/질병, 염증 또는 증식 질환의 완화 또는 경감을 의미한다.
본원에 사용될 경우, "약학 조성물"은 약리학적 효과량의 dsRNA 및 약학적으로 허용가능한 담체를 포함한다. 그러나, 이러한 "약학 조성물"은 또한 이러한 dsRNA 분자의 개별 스트랜드 또는 본 발명의 dsRNA에 포함된 센스 또는 안티센스 스트랜드중 적어도 하나를 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함하는 본원에 기재된 벡터(들)를 포함할 수 있다. 또한, 본원에 정의된 dsRNA를 발현하거나 포함하는 세포, 조직 또는 단리된 기관이 "약학 조성물"로 사용될 수 있는 것으로 생각된다. 본원에 사용될 경우, "약리학적 효과량", "치료학적 효과량" 또는 단순히 "효과량"은 의도된 약리학적, 치료학적 또는 예방학적 결과를 생산하는데 효과적인 RNA의 양을 지칭한다.
용어 "약학적으로 허용가능한 담체"는 치료제의 투여를 위한 담체를 지칭한다. 이러한 담체로는, 제한되지 않지만, 염수, 완충된 염수, 덱스트로즈, 물, 글리세롤, 에탄올, 및 이의 조합을 포함한다. 이 용어는 구체적으로 세포 배양 배지를 배제한다. 경구적으로 투여되는 약물의 경우, 약학적으로 허용가능한 담체로는, 제한되지 않지만, 당분야의 숙련가에게 공지된 바와 같은 약학적으로 허용가능한 부형제, 예컨대 불활성 희석제, 붕해제, 결합제, 윤활제, 감미제, 풍미제, 착색제, 및 보존제가 포함된다.
특히 약학적으로 허용가능한 담체는 본 발명의 dsRNA, 벡터 또는 세포의 전신 투여를 허용하는 것으로 생각된다. 또한, 장성(enteric) 투여가 고려되는 한편, 약물의 비경구 투여 및 또한 경피 또는 경점막(예를 들어 흡입, 구강, 질, 항문) 투여 뿐만 아니라 흡인이 본 발명의 화합물의 의료적 개입이 필요한 환자에게 투여되는 실행가능한 방식이다. 비경구적 투여가 사용될 경우, 이는 본 발명의 화합물의 환부 조직 또는 적어도 근접부로의 직접적 주사를 포함할 수 있다. 그러나, 또한 본 발명의 화합물의 정맥내, 동맥내, 피하, 근육내, 복강내, 피내, 척수강내 및 기타 투여가 숙련가, 예를 들면 담당의사의 기술내에 속한다.
근육내, 피하 및 정맥내 사용의 경우, 본 발명의 약학 조성물은 적절한 pH 및 등장성으로 완충된 멸균 수용액 또는 현탁액으로 일반적으로 제공될 것이다. 한 바람직한 실시양태에서, 담체는 수성 완충액으로 유일하게 구성된다. 이와 관련하여, "유일하게"는 인자 VII 유전자를 발현하는 세포에서 dsRNA의 섭취에 영향을 주거나 이를 중재할 수 있는 보조제 또는 캡슐화 물질이 존재하지 않음을 의미한다. 본 발명에 따른 수성 현탁액은 현탁제, 예컨대 셀룰로즈 유도체, 알긴산 나트륨, 폴리비닐-피롤리돈 및 트라가칸트 고무, 및 습윤제, 예컨대 레시틴을 포함할 수 있다. 수성 현탁액에 적합한 보존제로는 에틸 및 n-프로필 p-하이드록시벤조에이트가 포함된다. 본 발명에 따른 유용한 약학 조성물은 신체로부터 dsRNA가 신속히 제거되는 것을 보호하기 위한 캡슐화 제형, 예컨대 방출 조절 제형을 포함하고, 예를 들면 이식물 및 미세캡슐화된 전달 시스템이다. 생분해가능한 생물화합성 중합체가 사용될 수 있고, 예컨대 에틸렌 비닐 아세테이트, 폴리무수물, 폴리글리콜산, 콜라겐, 폴리오르토에스터 및 폴리락트산이 있다. 이러한 제형의 제조 방법은 당분야의 숙련가에게 분명할 것이다. 리포좀성 현탁액이 또한 약학적으로 허용가능한 담체로서 사용될 수 있다. 이들은 당분야의 숙련가에게 공지된 방법, 예를 들면, 참고로 본원에 인용된 PCT 공개공보 제WO 91/06309호에 기재된 바와 같은 방법에 따라 제조될 수 있다.
본원에 사용될 경우, "형질전환(transformed) 세포"는 적어도 하나의 벡터가 도입되어진 세포로서, 이로부터 dsRNA 분자 또는 이러한 dsRNA 분자의 적어도 하나의 스트랜드가 발현될 수 있다. 이러한 벡터는 바람직하게는 본 발명의 dsRNA에 포함된 적어도 하나의 센스 스트랜드 또는 안티센스 스트랜드를 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함하는 벡터이다.
하나 또는 양쪽 말단에 단지 소수의 뉴클레오티드를 빼고 표 1 및 4의 서열중 하나를 포함하는 보다 짧은 dsRNA가 상기 기재된 dsRNA와 비교할 경우 유사하게 효과적일 수 있음이 합리적으로 예측된다. 상기 지시된 바와 같이, 본 발명의 대부분의 실시양태에서, 본원에 제공된 dsRNA 분자는 약 16 내지 약 30개의 뉴클레오티드의 2중 길이를 포함한다(즉, "돌출부"가 없다). 특히 유용한 dsRNA 2중 길이는 약 19 내지 약 25개 뉴클레오티드이다. 19개 뉴클레오티드의 길이를 갖는 2중 구조가 가장 바람직하다. 본 발명의 dsRNA 분자에서, 안티센스 스트랜드는 센스 스트랜드에 적어도 부분적으로 상보성이다.
본 발명의 dsRNA는 표적 서열에 하나 이상의 부정합을 포함할 수 있다. 한 바람직한 실시양태에서, 본 발명의 dsRNA는 3개 이하의 부정합을 포함한다. dsRNA의 안티센스 스트랜드가 표적 서열에 부정합을 포함하면, 부정합의 영역이 상보성 영역의 중심에 위치하지 않는 것이 바람직하다. dsRNA의 안티센스 스트랜드가 표적 서열에 부정합을 포함하면, 부정합이 말단 영역에, 바람직하게는 5' 및/또는 3' 말단의 6개, 5개, 4개, 3개 또는 2개 뉴클레오티드로 제한되는 것이 바람직하다. 예를 들면, 인자 VII 유전자의 영역에 상보성인 23개 뉴클레오티드 dsRNA 스트랜드의 경우, dsRNA는 중심의 13개 뉴클레오티드 내에 어떠한 부정합도 포함하지 않는 것이 바람직하다.
상기 언급된 바와 같이, dsRNA의 적어도 하나의 말단/스트랜드는 1개 내지 5개, 바람직하게는 1개 또는 2개의 뉴클레오티드의 단일 스트랜드 뉴클레오티드 돌출부를 가질 수 있다. 적어도 하나의 뉴클레오티드 돌출부를 갖는 dsRNA는 무딘 말단의 그의 대응물에 비해 예상치 못하게 탁월한 저해 특성을 갖는다. 게다가, 본 발명으로부터, 단지 1개의 뉴클레오티드 돌출부의 존재가 그의 전체 안전성에 영향을 주지 않으면서 dsRNA의 간섭 활성을 강화시킴이 밝혀졌다. 단지 하나의 돌출부를 갖는 dsRNA는 생체내, 뿐만 아니라 다양한 세포, 세포 배양 배지, 혈액 및 혈청에서 특히 안정하고 효과적인 것으로 입증되었다. 바람직하게는, 단일 스트랜드 돌출부는 안티센스 스트랜드의 3'-말단에, 또는 다르게는, 센스 스트랜드의 3'-말단에 위치된다. dsRNA는 또한 무딘 말단을 가질 수 있고, 바람직하게는 안티센스 스트랜드의 5'-말단에 위치된다. 바람직하게는, dsRNA의 안티센스 스트랜드는 3'-말단에 뉴클레오티드 돌출부를 갖고, 5'-말단은 무딘 말단이다. 또 다른 실시양태에서, 돌출부중의 하나 이상의 뉴클레오티드는 뉴클레오시드 티오포스페이트로 대체된다.
본 발명의 dsRNA는 화학적으로 변형되어 안정성을 증진시킬 수 있다. 본 발명의 핵산은 당분야에 확립된 방법, 예컨대 본원에 참고로 인용된 뷰케이지(Beaucage, S.L.) 등의 문헌[Current protocols in nucleic acid chemistry, John Wiley & Sons, Inc., New York, NY, USA]에 기재된 방법에 의해 합성 및/또는 변형될 수 있다. 화학적 변형으로는, 제한되지 않지만, 2' 변형, 비천연 염기의 도입, 리간드로의 공유 결합, 및 포스페이트 연결부의 티오포스페이트 연결부로의 치환이 포함된다. 이러한 실시양태에서, 2중 구조의 완전성은 적어도 1개, 바람직하게는 2개의 화학적 연결부에 의해 강화된다. 화학적 연결은 임의의 다양한 공지된 기법에 의해, 예를 들면 공유 결합, 이온 결합 또는 수소 결합; 소수성 상호작용, 반데르 발스(van der Waals) 또는 스태킹(stacking) 상호작용을 도입함으로써; 금속 이온 배위에 의해, 또는 퓨린 유사체의 사용을 통해 달성될 수 있다. 바람직하게는, dsRNA를 변형시키기 위해 사용될 수 있는 화학 기로는, 제한없이, 메틸렌 블루; 2작용성 기, 바람직하게는 비스-(2-클로로에틸)아민; N-아세틸-N'-(p-글리옥실벤조일)시스타민; 4-티오우라실; 및 프소랄렌이 포함된다. 한 바람직한 실시양태에서, 링커는 헥사-에틸렌 글리콜 링커이다. 이러한 경우에, dsRNA는 고체 상 합성에 의해 생산되고, 헥사-에틸렌 글리콜 링커는 표준 방법에 따라 혼입된다(예를 들어, 윌리암스(Williams, D.J.), 및 홀(K.B. Hall)의 문헌[Biochem. (1996) 35:14665-14670]). 특정 실시양태에서, 안티센스 스트랜드의 5'-말단 및 센스 스트랜드의 3'-말단은 헥사에틸렌 글리콜 링커를 통해 화학적으로 연결된다. 또 다른 실시양태에서, dsRNA의 적어도 하나의 뉴클레오티드는 포스포로티오에이트 또는 포스포로디티오에이트 기를 포함한다. dsRNA의 말단에서의 화학 결합은 3중 나선 결합에 의해 형성되는 것이 바람직하다.
특정 실시양태에서, 화학 결합은 1개 또는 수 개의 결합 기에 의해 형성될 수 있고, 여기서 이러한 결합 기는 바람직하게는 폴리-(옥시포스피니코옥시-1,3-프로판디올)- 및/또는 폴리에틸렌 글리콜 쇄이다. 다른 실시양태에서, 화학 결합은 또한 퓨린 대신에 2중 스트랜드 구조내로 도입되는 퓨린 유사체에 의해 형성된다. 추가의 실시양태에서, 화학 결합은 2중 스트랜드 구조내로 도입되는 아자벤젠 단위에 의해 형성될 수 있다. 또한 추가의 실시양태에서, 화학 결합은 2중 스트랜드 구조내로 도입되는 뉴클레오티드 대신에 분지화된 뉴클레오티드 유사체에 의해 형성될 수 있다. 특정 실시양태에서, 화학 결합은 자외선 광에 의해 유도될 수 있다.
한편 또 다른 실시양태에서, 2개의 단일 스트랜드중 하나 또는 둘 다에서의 뉴클레오티드는 세포 효소, 예를 들면 특정 뉴클레아제(nuclease)의 활성화를 방지 또는 저해하도록 변형될 수 있다. 세포 효소의 활성화를 저해하기 위한 기법은 당분야에 공지되어 있고, 제한되는 것은 아니지만, 2'-아미노 변형, 2'-아미노 당 변형, 2'-F 당 변형, 2'-F 변형, 2'-알킬 당 변형, 하전되지 않은 주쇄 변형, 모폴리노 변형, 2'-O-메틸 변형, 및 포스포아미데이트(예를 들어, 와그너(Wagner)의 문헌[Nat . Med . (1995) 1:1116-8] 참조)가 포함된다. 이와 같이, dsRNA 상의 뉴클레오티드의 적어도 하나의 2'-하이드록실 기는 화학 기, 바람직하게는 2'-아미노 또는 2'-메틸 기로 대체된다. 또한 적어도 하나의 뉴클레오티드는 변형되어 갇힌 뉴클레오티드를 형성할 수 있다. 이러한 갇힌 뉴클레오티드는 리보스의 2'-산소를 리보스의 4'-탄소와 연결시키는 메틸렌 가교를 포함한다. 갇힌 뉴클레오티드의 올리고뉴클레오티드로의 도입은 상보성 서열에 대한 친화도를 개선시키고 용융 온도를 수 도로 증가시킨다.
본원에 제공된 dsRNA 분자의 변형은 생체내 뿐만 아니라 시험관내에서 이들의 안정성에 긍정적인 영향을 주고, 또한 이들의 (환부) 표적 쪽으로의 전달을 개선시킨다. 더욱이, 이러한 구조적 및 화학적 변형은 투여시 dsRNA 분자로의 생리학적 반응, 예를 들어 바람직하게는 억제되는 사이토킨 방출에 긍정적인 영향을 줄 수 있다. 이러한 화학적 및 구조적 변형은 당분야에 공지되어 있고, 무엇보다도, 문헌[Nawrot (2006) Current Topics in Med Chem, 6, 913-925]에 예시되어 있다.
리간드의 dsRNA로의 컨쥬게이션(conjugation)은 그의 세포 흡수 뿐만 아니라 특정 조직으로의 표적화를 증진시킬 수 있다. 특정 경우에, 소수성 리간드는 dsRNA에 컨쥬게이트되어 세포 막의 직접적 침투를 조장한다. 다르게는, dsRNA에 컨쥬게이트된 리간드는 수용체 중재된 엔도시토시스(endocytosis)에 대한 기질이다. 이들 연구법은 안티센스 올리고뉴클레오티드의 세포 침투를 조장하기 위해 사용되었다. 예를 들면, 콜레스테롤은 다양한 안티센스 올리고뉴클레오티드에 컨쥬게이트되어 이들의 컨쥬게이트되지 않은 유사체에 비해 실질적으로 보다 활성인 화합물을 생성한다. 마노하란(M. Manoharan)의 문헌[Antisense & Nucleic Acid Drug Development 2002, 12, 103]을 참조한다. 올리고뉴클레오티드에 컨쥬게이트된 다른 친유성 화합물로는 1-피렌 부티르산, 1,3-비스-O-(헥사데실)글리세롤, 및 메탄올이 포함된다. 수용체 중재된 엔도시토시스에 대한 리간드의 한 예는 폴산이다. 폴산은 폴레이트-수용체 중재된 엔도시토시스에 의해 세포에 침투한다. 폴산을 갖는 RNA 화합물은 폴레이트-수용체 중재된 엔도시토시스를 통해 세포내로 효과적으로 수송될 수 있다. 올리고뉴클레오티드의 3'-말단으로의 폴산의 결합은 올리고뉴클레오티드의 증가된 세포 섭취를 일으킨다(리(Li, S.); 데쉬무크(Deshmukh, H. M.); 후앙(Huang, L.)의 문헌[Pharm . Res. 1998, 15, 1540]). 올리고뉴클레오티드에 컨쥬게이트되는 다른 리간드로는 폴리에틸렌 글리콜, 탄수화물 군, 가교결합제, 포피린(porphyrin) 컨쥬게이트, 및 전달 펩타이드가 포함된다.
특정 경우에, 올리고뉴클레오티드로의 양이온성 리간드의 컨쥬게이션은 종종 뉴클레아제에 대한 내성을 개선시킨다. 양이온성 리간드의 대표적인 예는 프로필암모늄 및 디메틸프로필암모늄이다. 흥미롭게도, 안티센스 올리고뉴클레오티드는, 양이온성 리간드가 올리고뉴클레오티드 전체에 분산된 경우, mRNA로의 이들의 높은 결합 친화도를 보유하는 것으로 보고되었다. 마노하란의 문헌[Antisense & Nucleic Acid Drug Development 2002, 12, 103] 및 이의 인용문헌을 참조한다.
본 발명의 리간드 컨쥬게이트된 dsRNA는 펜던트(pendant) 반응성 작용기를 갖는 dsRNA, 예컨대 dsRNA 상으로의 연결 분자의 결합으로부터 유도된 dsRNA의 사용에 의해 합성될 수 있다. 이러한 반응성 올리고뉴클레오티드는 상업적으로 입수가능한 리간드, 다양한 임의의 보호기를 갖는 합성된 리간드, 또는 연결 잔기가 결합된 리간드와 직접적으로 반응될 수 있다. 본 발명의 방법은, 몇몇 바람직한 실시양태에서, 리간드와 적절히 컨쥬게이트되고 추가로 고체 지지 물질에 결합될 수 있는 뉴클레오시드 단량체의 사용에 의해 리간드-컨쥬게이트된 dsRNA의 합성을 조장한다. 고체 지지 물질에 선택가능하게 결합된 이러한 리간드-뉴클레오시드 컨쥬게이트는 본 발명의 방법의 몇몇 바람직한 실시양태에 따라 뉴클레오시드 또는 올리고뉴클레오티드의 5' 위치 상에 위치된 연결 잔기와 선택된 혈청 결합 리간드의 반응을 통해 제조된다. 특정 경우에, 3' 말단에 아르알킬 리간드가 결합된 dsRNA는 우선 단량체 구성 요소를 제어된 기공 유리 지지체에 장쇄 아미노알킬 기를 통해 공유 결합시킴으로써 제조된다. 이어서, 뉴클레오티드는 표준 고체 상 합성 기법을 통해 고체 지지체에 결합된 단량체 구성 요소에 결합된다. 단량체 구성 요소는 뉴클레오시드 또는 고체 상 합성에 상용성인 다른 유기 화합물일 수 있다.
본 발명의 컨쥬게이트에 사용되는 dsRNA는 고체 상 합성의 공지된 기법을 통해 편리하고 일상적으로 제조될 수 있다. 또한 다른 올리고뉴클레오티드, 예컨대포스포로티오에이트 및 알킬화된 유도체를 제조하는 유사 기법을 사용함이 공지되어 있다.
특정한 변형된 올리고뉴클레오티드의 합성에 관하여 하기 미국 특허에 교시되어 있다: 폴리아민 컨쥬게이트된 올리고뉴클레오티드에 관한 미국 특허 제5,218,105호; 변형된 주쇄를 갖는 올리고뉴클레오티드에 관한 미국 특허 제5,541,307호; 키랄성 인 연결부를 갖는 올리고뉴클레오티드를 제조하는 방법에 관한 미국 특허 제5,521,302호; 펩타이드 핵산에 관한 미국 특허 제5,539,082호; β-락탐 주쇄를 갖는 올리고뉴클레오티드에 관한 미국 특허 제5,554,746호; 올리고뉴클레오티드의 합성을 위한 방법 및 재료에 관한 미국 특허 제5,571,902호; 뉴클레오시드의 임의의 다양한 위치에 결합된 다른 잔기에 링커로서 사용될 수 있는 알킬티오 기를 갖는 뉴클레오시드에 관한 미국 특허 제5,578,718호; 높은 키랄 순도의 포스포로티오에이트 연결부를 갖는 올리고뉴클레오티드에 관한 미국 특허 제5,587,361호; 2'-O-알킬 구아노신 및 관련 화합물, 예컨대 2,6-디아미노퓨린 화합물의 제조 방법에 관한 미국 특허 제5,506,351호; N-2 치환된 퓨린을 갖는 올리고뉴클레오티드에 관한 미국 특허 제5,587,469호; 3-데아자퓨린을 갖는 올리고뉴클레오티드에 관한 미국 특허 제5,587,470호; 컨쥬게이트된 4'-데스메틸 뉴클레오시드 유사체에 관한 미국 특허 제5,608,046호; 주쇄 변형된 올리고뉴클레오티드 유사체에 관한 미국 특허 제5,610,289호; 무엇보다도, 2'-플루오로-올리고뉴클레오티드의 합성 방법에 관한 미국 특허 제6,262,241호.
본 발명의 리간드 컨쥬게이트된 dsRNA 및 서열 특이적으로 연결된 뉴클레오시드를 갖는 리간드-분자에서, 올리고뉴클레오티드 및 올리고뉴클레오시드는 표준 뉴클레오티드 또는 뉴클레오시드 전구체, 또는 연결 잔기를 이미 갖는 뉴클레오티드 또는 뉴클레오시드 컨쥬게이트 전구체, 리간드-뉴클레오티드 또는 리간드 분자를 이미 갖는 뉴클레오시드-컨쥬게이트 전구체, 또는 구성 요소를 갖는 비-뉴클레오시드 리간드를 이용하여 적절한 DNA 합성기 상에서 조립될 수 있다.
연결 잔기를 이미 갖는 뉴클레오티드-컨쥬게이트 전구체를 사용할 경우, 서열 특이적으로 연결된 뉴클레오시드의 합성은 전형적으로 완료되고, 이어서 리간드 분자는 연결 잔기와 반응하여 리간드-컨쥬게이트된 올리고뉴클레오티드를 형성한다. 다양한 분자, 예컨대 스테로이드, 비타민, 지질 및 리포터 분자를 갖는 올리고뉴클레오티드 컨쥬게이트는 이전에 기재되어 있다(마노하란 등, PCT 출원 공개공보 제WO 93/07883호 참조). 한 바람직한 실시양태에서, 본 발명의 올리고뉴클레오티드 또는 연결된 뉴클레오시드는 상업적으로 입수가능한 포스포아미다이트에 더하여 리간드-뉴클레오시드 컨쥬게이트로부터 유도된 포스포아미다이트를 사용하여 자동화된 합성화기에 의해 합성된다.
올리고뉴클레오티드의 뉴클레오시드중 2'-O-메틸, 2'-O-에틸, 2'-O-프로필, 2'-O-알릴, 2'-O-아미노알킬 또는 2'-데옥시-2'-플루오로 기의 혼입은 올리고뉴클레오티드에 증진된 하이브리드화 특성을 부여한다. 추가로, 포스포로티오에이트 주쇄를 포함하는 올리고뉴클레오티드는 증진된 뉴클레아제 안정성을 갖는다. 이와 같이, 본 발명의 작용화되고 연결된 뉴클레오시드는 포스포로티오에이트 주쇄 또는 2'-O-메틸, 2'-O-에틸, 2'-O-프로필, 2'-O-아미노알킬, 2'-O-알릴 또는 2'-데옥시-2'-플루오로 기중 하나 또는 둘다를 포함하도록 증가될 수 있다.
몇몇 바람직한 실시양태에서, 5'-말단에 아미노기를 갖는 본 발명의 작용화된 뉴클레오시드 서열은 DNA 합성기를 사용하여 제조되고, 이어서 선택된 리간드의 활성 에스터 유도체와 반응된다. 활성 에스터 유도체는 당분야의 숙련가에게 공지되어 있다. 대표적인 활성 에스터로는 N-하이드로석신이미드 에스터, 테트라플루오로페놀산 에스터, 펜타플루오로페놀산 에스터 및 펜타클로로페놀산 에스터가 포함된다. 아미노 기와 활성 에스터의 반응으로 올리고뉴클레오티드가 생산되고, 여기서 선택된 리간드는 연결 기를 통해 5'-위치에 결합된다. 5'-말단에서의 아미노 기는 5'-아미노-모디파이어(Modifier)-C6 시약을 사용하여 제조될 수 있다. 한 바람직한 실시양태에서, 리간드 분자는 리간드-뉴클레오시드 포스포아미다이트를 사용하여 5'-위치에서 올리고뉴클레오티드에 컨쥬게이트될 수 있고, 여기서 리간드는 직접적으로 또는 링커를 통해 간접적으로 5'-하이드록시 기에 연결된다. 이러한 리간드-뉴클레오시드 포스포아미다이트는 전형적으로 자동화된 합성 절차의 종료시에 사용되어 5'-말단에 리간드를 갖는 리간드-컨쥬게이트된 올리고뉴클레오티드를 제공한다.
본 발명의 방법의 한 바람직한 실시양태에서, 리간드 컨쥬게이트된 올리고뉴클레오티드의 제조는 리간드 분자를 구성하는 적절한 전구체 분자의 선택으로 시작된다. 전형적으로, 전구체는 통상적으로 사용되는 뉴클레오시드의 적절히 보호된 유도체이다. 예를 들면, 본 발명의 리간드-컨쥬게이트된 올리고뉴클레오티드의 합성을 위한 합성 전구체로는, 제한되지 않지만, 분자의 핵염기 부분에서 보호될 수 있는 2'-아미노알콕시-5'-ODMT-뉴클레오시드, 2'-6-아미노알킬아미노-5'-ODMT-뉴클레오시드, 5'-6-아미노알콕시-2'-데옥시-뉴클레오시드, 5'-6-아미노알콕시-2-보호된-뉴클레오시드, 3'-6-아미노알콕시-5'-ODMT-뉴클레오시드, 및 3'-아미노알킬아미노-5'-ODMT-뉴클레오시드가 포함된다. 이러한 아미노-연결된 보호된 뉴클레오시드 전구체의 합성 방법은 당분야의 숙련가에게 공지되어 있다.
많은 경우에, 보호기는 본 발명의 화합물의 제조 동안 사용된다. 본원에 사용될 경우, 용어 "보호된"은 지시된 잔기가 그에 첨가된 보호기를 가짐을 의미한다. 본 발명의 몇몇 바람직한 실시양태에서, 화합물은 하나 이상의 보호기를 포함한다. 매우 다양한 보호기가 본 발명의 방법에 사용될 수 있다. 일반적으로, 보호기는 화학 작용기를 특정 반응 조건에 비활성으로 만들고, 분자의 나머지 부분에 실질적으로 손상을 주지 않으면서 분자중의 이러한 작용기에 첨가되거나 그로부터 제거될 수 있다.
대표적인 하이드록실 보호기, 뿐만 아니라 다른 대표적인 보호기는 그리네(Greene) 및 우츠(Wuts)의 문헌[Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991], 및 [Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N.Y, 1991]에 개시되어 있다.
산 처리에 안정한 아미노-보호기는 염기 처리에 의해 선택적으로 제거되고, 치환에 선택적으로 이용가능한 반응성 아미노 기를 만드는데 사용된다. 이러한 기의 예는 Fmoc(아테르톤(E. Atherton) 및 쉐파드(R. C. Sheppard)의 문헌[The Peptides, S. Udenfriend, J. Meienhofer, Eds., Academic Press, Orlando, 1987, volume 9, p.1]) 및 Nsc 기로 예시된 다양한 치환된 설포닐에틸 카바메이트(사무코브(Samukov) 등의 문헌[Tetrahedron Lett ., 1994, 35:7821])이다.
추가의 아미노-보호기로는, 제한되지 않지만, 카바메이트 보호기, 예컨대 2-트리메틸실릴에톡시카보닐(Teoc), 1-메틸-1-(4-비페닐일)에톡시카보닐(Bpoc), t-부톡시카보닐(BOC), 알릴옥시카보닐(Alloc), 9-플루오레닐메틸옥시카보닐(Fmoc), 및 벤질옥시카보닐(Cbz); 아미드 보호기, 예컨대 포밀, 아세틸, 트리할로아세틸, 벤조일, 및 니트로페닐아세틸; 설폰아미드 보호기, 예컨대 2-니트로벤젠설포닐; 및 이민 및 환형 이미드 보호기, 예컨대 프탈이미도 및 디티아석시노일이 포함된다. 이들 아미노-보호기의 당량은 또한 본 발명의 화합물 및 방법에 의해 포함된다.
많은 고형 지지체는 상업적으로 입수가능하고 당분야의 숙련가라면 고체 상 합성 단계에서 사용되는 고체 지지체를 쉽게 선택할 수 있을 것이다. 특정 실시양태에서, 보편적 지지체가 사용된다. 보편적 지지체는 올리고뉴클레오티드의 3'-말단에 위치된 일반적이지 않거나 변형된 뉴클레오티드를 갖는 올리고뉴클레오티드의 제조를 허용한다. 보편적 지지체에 대한 추가의 세부사항을 위해, 스콧(Scott) 등의 문헌[Innovations and Perspectives in solid - phase Synthesis, 3rd International Symposium, 1994, Ed. Roger Epton, Mayflower Worldwide, 115-124]을 참조한다. 또한, 올리고뉴클레오티드는 보다 쉽게 염기성 가수분해되는 syn-1,2-아세톡시포스페이트 기를 통해 올리고뉴클레오티드가 고체 지지체에 결합할 경우 보편적 지지체로부터 온화한 반응 조건하에 분할될 수 있는 것으로 보고되어 있다. 구자에브(Guzaev, A. L); 마노하란의 문헌[J. Am . Chem . Soc. 2003, 125, 2380]을 참조한다.
뉴클레오시드는 인을 포함하거나 인을 포함하지 않은 뉴클레오시드간 공유 결합에 의해 연결된다. 식별할 목적으로, 이러한 컨쥬게이트된 뉴클레오시드는 리간드 포함 뉴클레오시드 또는 리간드-뉴클레오시드 컨쥬게이트로 특징지워질 수 있다. 서열내에서 뉴클레오시드에 컨쥬게이트된 아르알킬 리간드를 갖는 연결된 뉴클레오시드는, 컨쥬게이트되지 않은 유사 dsRNA 화합물과 비교될 경우 증진된 dsRNA 활성을 나타낼 것이다.
본 발명의 아르알킬-리간드-컨쥬게이트된 올리고뉴클레오티드는 또한 올리고뉴클레오티드 및 연결된 뉴클레오시드의 컨쥬게이트를 포함하고, 여기서 리간드는 링커의 중개없이 뉴클레오시드 또는 뉴클레오티드에 직접 결합된다. 리간드는 바람직하게는 연결 기를 통해 리간드의 카복실, 아미노 또는 옥소 기에 결합된다. 전형적인 연결 기는 에스터, 아미드 또는 카바메이트 기일 수 있다.
본 발명의 리간드-컨쥬게이트된 올리고뉴클레오티드에 사용하기 위해 고려되는 바람직한 변형된 올리고뉴클레오티드의 특정 예는 변형된 주쇄 또는 비천연 뉴클레오시드간 연결부를 갖는 올리고뉴클레오티드를 포함한다. 본원에 정의된 바와 같이, 변형된 주쇄 또는 뉴클레오시드간 연결부를 갖는 올리고뉴클레오티드는 주쇄에 인 원자를 보유한 올리고뉴클레오티드 및 주쇄에 인 원자를 갖지 않는 올리고뉴클레오티드를 포함한다. 본 발명의 목적을 위해, 당간(intersugar) 주쇄에 인 원자를 갖지 않는 변형된 올리고뉴클레오티드도 올리고뉴클레오시드로 고려될 수 있다.
특정 올리고뉴클레오티드의 화학 변형이 이후 설명된다. 주어진 화합물에서 모든 위치가 균일하게 변형될 필요는 없다. 역으로, 하나 보다 많은 변형이 하나의 dsRNA 화합물에 또는 심지어 이의 하나의 뉴클레오티드에 혼입될 수 있다.
바람직한 변형된 뉴클레오시드간 연결부 또는 주쇄는, 예를 들면, 포스포로티오에이트, 키랄성 포스포로티오에이트, 포스포로디티오에이트, 포스포트리에스터, 아미노알킬포스포트리에스터, 메틸 및 기타 알킬 포스포네이트, 예컨대 3'-알킬렌 포스포네이트 및 키랄성 포스포네이트, 포스피네이트, 포스포아미데이트, 예컨대 3'-아미노 포스포아미데이트 및 아미노알킬포스포아미데이트, 티오노포스포아미데이트, 티오노알킬포스포네이트, 티오노알킬포스포트리에스터, 정상적 3'-5' 연결부를 갖는 보라노포스페이트, 이들의 2'-5' 연결된 유사체, 및 역전된 극성을 갖는 것들(여기서 뉴클레오시드 단위의 인접한 쌍은 3'-5'에서 5'-3' 또는 2'-5'에서 5'-2'로 연결됨)을 포함한다. 다양한 염, 혼합된 염 및 유리산 형태도 포함된다.
상기 인-원자 포함 연결부의 제조에 관한 대표적인 미국 특허로는, 제한되지 않지만, 미국 특허 제4,469,863호; 제5,023,243호; 제5,264,423호; 제5,321,131호; 제5,399,676호; 제5,405,939호; 제5,453,496호; 제5,455,233호 및 제5,466,677호가 포함되고, 이들 각각은 본원에 참고로 인용되어 있다.
여기에(즉, 올리고뉴클레오시드에) 인 원자를 포함하지 않은 바람직한 변형된 뉴클레오시드간 연결부 또는 주쇄는 단쇄 알킬 또는 사이클로알킬 당간 연결부, 혼합된 헤테로원자 및 알킬 또는 사이클로알킬 당간 연결부, 또는 하나 이상의 단쇄 헤테로원자 또는 헤테로환식 당간 연결부에 의해 형성되는 주쇄를 갖는다. 이들은 모폴리노 연결부를 갖는 것들(뉴클레오시드의 당 부분으로부터 부분적으로 형성됨); 실록산 주쇄; 설파이드, 설폭사이드 및 설폰 주쇄; 폼아세틸 및 티오폼아세틸 주쇄; 메틸렌 폼아세틸 및 티오 폼아세틸 주쇄; 알켄 포함 주쇄; 설파메이트 주쇄; 메틸렌이미노 및 메틸렌하이드라지노 주쇄; 설포네이트 및 설폰아미드 주쇄; 아미드 주쇄; 및 혼합된 N, O, S 및 CH2 성분 부분을 갖는 기타 주쇄를 포함한다.
상기 올리고뉴클레오시드의 제조에 관한 대표적인 미국 특허로는, 제한되지 않지만, 미국 특허 제5,034,506호; 제5,214,134호; 제5,216,141호; 제5,264,562호; 제5,466,677호; 제5,470,967호; 제5,489,677호; 제5,602,240호 및 제5,663,312호가 포함되고, 이들 각각은 본원에 참고로 인용되어 있다.
다른 바람직한 올리고뉴클레오티드 유사체에서, 당 및 뉴클레오시드간 연결부 둘다, 즉 뉴클레오시드 단위의 주쇄는 새로운 기로 치환된다. 핵염기 단위는 적절한 핵산 표적 화합물과의 하이브리드화를 위해 유지된다. 탁월한 하이브리드화 특성을 갖는 것으로 보여지는 이러한 올리고뉴클레오티드, 올리고뉴클레오티드 유사체는 펩타이드 핵산(PNA)으로 지칭된다. PNA 화합물에서, 올리고뉴클레오티드의 당-주쇄는 아미드 포함 주쇄, 특히 아미노에틸렌글리신 주쇄로 치환된다. 핵염기는 주쇄의 아미드 부분의 원자에 직접적으로 또는 간접적으로 결합된다. PNA 화합물에 대한 교시는 예를 들면 미국 특허 제5,539,082호에서 찾아볼 수 있다.
본 발명의 몇몇 바람직한 실시양태는 포스포로티오에이트 연결부를 갖는 올리고뉴클레오티드 및 헤테로원자 주쇄, 및 특히 상기 언급된 미국 특허 제5,489,677호의 --CH2--NH--O--CH2--, --CH2--N(CH3)--O--CH2--[메틸렌(메틸이미노) 또는 MMI 주쇄로 공지됨], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, 및 --O--N(CH3)--CH2--CH2--[여기서 고유 포스포디에스터 주쇄는 --O--P--O--CH2--로 표시됨], 및 상기 언급된 미국 특허 제5,602,240호의 아미드 주쇄를 갖는 올리고뉴클레오시드를 사용한다. 상기 언급된 미국 특허 제5,034,506호의 모폴리노 주쇄 구조를 갖는 올리고뉴클레오티드가 또한 바람직하다.
본 발명의 리간드-컨쥬게이트된 올리고뉴클레오티드에 사용된 올리고뉴클레오티드는 추가로 또는 다르게는 핵염기(종종 당분야에서 간단히 "염기"로 지칭됨) 변형 또는 치환을 포함한다. 본원에 사용될 경우, "변형되지 않은" 또는 "천연" 핵염기로는 퓨린 염기 아데닌(A) 및 구아닌(G), 및 피리미딘 염기 티민(T), 시토신(C), 및 우라실(U)을 포함한다. 변형된 핵염기는 다른 합성 및 천연 핵염기, 예컨대 5-메틸시토신(5-me-C), 5-하이드록시메틸 시토신, 잔틴, 하이포잔틴, 2-아미노아데닌, 아데닌과 구아닌의 6-메틸 및 기타 알킬 유도체, 아데닌과 구아닌의 2-프로필 및 기타 알킬 유도체, 2-티오우라실, 2-티오티민 및 2-티오사이토신, 5-할로우라실 및 사이토신, 5-프로피닐 우라실 및 사이토신, 6-아조우라실, 사이토신 및 티민, 5-우라실(의사우라실), 4-티오우라실, 8-할로, 8-아미노, 8-티올, 8-티오알킬, 8-하이드록실 및 기타 8-치환된 아데닌 및 구아닌, 5-할로, 특히 5-브로모, 5-트리플루오로메틸 및 기타 5-치환된 우라실 및 사이토신, 7-메틸구아닌 및 7-메틸아데닌, 8-아자구아닌 및 8-아자아데닌, 7-데아자구아닌, 및 7-데아자아데닌 및 3-데아자구아닌 및 3-데아자아데닌이 포함된다.
추가의 핵염기로는 미국 특허 제3,687,808호에 개시된 핵염기, 문헌[Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990]에 개시된 핵염기, 잉글리쉬(Englisch) 등의 문헌[Angewandte Chemie , International Edition, 1991, 30, 613]에 개시된 핵염기, 및 상비(Sanghvi, Y. S.)의 문헌[Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993]에 개시된 핵염기가 포함된다. 이들 핵염기중 몇몇은 본 발명의 올리고뉴클레오티드의 결합 친화도를 증가시키는데 특히 유용하다. 이들은 5-치환된 피리미딘, 6-아자피리미딘 및 N-2, N-6 및 O-6 치환된 퓨린, 예컨대 2-아미노프로필아데닌, 5-프로필우라실 및 5-프로피닐사이토신을 포함한다. 5-메틸사이토신 치환은 핵산 2중 안정성을 0.6-1.2℃ 증가시키는 것으로 나타났고(Id., 276-278쪽), 이는 현재 바람직한 염기 치환이고, 2'-메톡시에틸 당 변형과 조합될 경우 더욱 더 특히 바람직하다.
상기 주지된 변형된 특정 핵염기 뿐만 아니라 기타 변형된 핵염기의 제조에 관한 대표적 미국 특허로는, 제한되지 않지만, 상기 주지된 미국 특허 제3,687,808호, 뿐만 아니라 미국 특허 제5,134,066호; 제5,459,255호; 제5,552,540호; 제5,594,121호 및 제5,596,091호가 포함되고, 이들 모두는 본원에 참고로 인용되어 있다.
특정 실시양태에서, 본 발명의 리간드-컨쥬게이트된 올리고뉴클레오티드에 사용되는 올리고뉴클레오티드는 추가로 또는 다르게는 하나 이상의 치환된 당 잔기를 포함한다. 바람직한 올리고뉴클레오티드는 2' 위치에 다음중 하나를 포함한다: OH; F; O-, S-, 또는 N-알킬, O-, S-, 또는 N-알케닐, 또는 O, S- 또는 N-알키닐, 여기서 알킬, 알케닐 및 알키닐은 치환되거나 치환되지 않은 C1 내지 C10 알킬 또는 C2 내지 C10 알케닐 및 알키닐일 수 있다. O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, 및 O(CH2)nON[(CH2)nCH3)]2(여기서 n 및 m은 1 내지 약 10임)가 특히 바람직하다. 다른 바람직한 올리고뉴클레오티드는 2' 위치에 다음중 하나를 포함한다: C1 내지 C10 저급 알킬, 치환된 저급 알킬, 알크아릴, 아르알킬, O-알크아릴 또는 O-아르알킬, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, 헤테로사이클로알킬, 헤테로사이클로알크아릴, 아미노알킬아미노, 폴리알킬아미노, 치환된 실릴, RNA 분할기, 리포터 기, 삽입기(intercalator), 올리고뉴클레오티드의 약물동력학적 특성을 개선시키기 위한 기, 올리고뉴클레오티드의 약역학적 특성을 개선시키기 위한 기, 및 유사 특성을 갖는 기타 치환기. 바람직한 변형은 2'-메톡시에톡시[2'-0--CH2CH2OCH3, 또한 2'-O-(2-메톡시에틸) 또는 2'- MOE로서 공지됨], 즉 알콕시알콕시 기를 포함한다. 추가의 바람직한 변형은 1998년 1월 30일자로 출원된 미국 특허 제6,127,533호(이의 내용은 참고로 인용됨)에 기재된 바와 같은, 2'-DMAOE로서 공지된 2'-디메틸아미노옥시에톡시, 즉, O(CH2)2ON(CH3)2 기를 포함한다.
다른 바람직한 변형은 2'-메톡시(2'-0--CH3), 2'-아미노프로폭시(2'-OCH2CH2CH2NH2) 및 2'-플루오로(2'-F)를 포함한다. 유사한 변형이 또한 올리고뉴클레오티드 상의 다른 위치, 특히 3' 말단 뉴클레오티드 상에서 당의 3' 위치에서, 또는 2'-5' 연결된 올리고뉴클레오티드에서 이루어질 수 있다.
본원에 사용될 경우, 용어 "당 치환 기" 또는 "2'-치환 기"는 산소 원자의 존재 또는 부재하에 리보퓨라노실 잔기의 2'-위치에 결합된 기를 포함한다. 당 치환기로는, 제한되지 않지만, 플루오로, O-알킬, O-알킬아미노, O-알킬알콕시, 보호된 O-알킬아미노, O-알킬아미노알킬, O-알킬 이미다졸 및 식 (O-알킬)m(여기서, m은 1 내지 약 10임)의 폴리에터가 포함된다. 이들 폴리에터중 선형 및 환형 폴리에틸렌 글리콜(PEG), 및 (PEG)-포함 기, 예컨대 크라운 에터, 및 무엇보다도, 델가도(Delgardo)등의 문헌[Critical Reviews in Therapeutic Drug Carrier Systems 1992, 9:249](이는 본원에 참고로 이의 전체가 인용됨)에 개시된 것들이 바람직하다. 추가로, 당 변형은 쿡(Cook)의 문헌[Anti - fibrosis Drug Design, 1991, 6:585-607]에 개시되어 있다. 플루오로, O-알킬, O-알킬아미노, O-알킬 이미다졸, O-알킬아미노알킬, 및 알킬 아미노 치환은 본원에 참고로 그의 전체가 인용된 "2' 및 5' 치환된 피리미딘 뉴클레오티드(들)를 갖는 올리고머 화합물(Oligomeric Compounds having Pyrimidine Nucleotide(s) with 2' and 5' Substitutions)"이란 명칭의 미국 특허 제6,166,197호에 기재되어 있다.
본 발명을 가능하게 하는 추가의 당 치환 기는 2'-SR 및 2'-NR2 기를 포함하고, 여기서 R은 각각 독립적으로 수소, 보호기 또는 치환되거나 치환되지 않은 알킬, 알케닐 또는 알키닐이다. 2'-SR 뉴클레오시드는 미국 특허 제5,670,633호에 개시되어 있고, 이는 본원에 참고로 인용되어 있다. 2'-SR 단량체 신톤(synthon)의 혼입은 햄(Hamm) 등의 문헌[J. Org . Chem., 1997, 62:3415-3420]에 개시되어 있다. 2'-NR 뉴클레오시드는 괴틴겐(Goettingen, M.)의 문헌[J. Org . Chem ., 1996, 61, 6273-6281]; 및 폴루쉰(Polushin) 등의 문헌[Tetrahedron Lett ., 1996, 37, 3227-3230]에 개시되어 있다. 본 발명을 가능하게 하는 추가의 대표적인 2'-치환기는 하기 화학식 I 또는 II의 치환기를 포함한다:
[화학식 I]
Figure pct00002
[화학식 II]
Figure pct00003
,
상기 식에서,
E는 C1-C10 알킬, N(Q3)(Q4) 또는 N=C(Q3)(Q4)이고; 각각의 Q3 및 Q4는 독립적으로 H, C1-C10 알킬, 디알킬아미노 알킬, 질소 보호기, 제한되거나(tethered) 제한되지 않은 컨쥬게이트 기, 고체 지지체로의 링커이거나; Q3 및 Q4는 질소 보호기, 또는 N 및 O로부터 선택된 적어도 하나의 추가의 헤테로원자를 선택적으로 포함하는 고리 구조를 함께 형성하고;
q1은 1 내지 10의 정수이고;
q2는 1 내지 10의 정수이고;
q3은 0 또는 1이고;
q4는 0, 1 또는 2이고;
Z1, Z2 및 Z3은 각각 독립적으로 C4-C7 사이클로알킬, C5-C14 아릴 또는 C3-C15 헤테로사이클릴이고, 여기서 상기 헤테로사이클릴 기에서 헤테로원자는 산소, 질소 및 황으로부터 선택되고;
Z4는 OM1, SM1, 또는 N(M1)2이고; M1은 각각 독립적으로 H, C1-C8 알킬, C1-C8 할로알킬, C(=NH)N(H)M2, C(=0)N(H)M2 또는 0C(=0)N(H)M2이고; M2는 H 또는 C1-C8 알킬이고;
Z5는 C1-C10 알킬, C1-C10 할로알킬, C2-C10 알케닐, C2-C10 알키닐, C6-C14 아릴, N(Q3)(Q4), OQ3, 할로, SQ3 또는 CN이다.
화학식 I의 대표적인 2'-O-당 치환기는 본원에 참고로 전체가 인용되어 있는 "캐핑된 2'-옥시에톡시 올리고뉴클레오티드(Capped 2'-Oxyethoxy Oligonucleotide)"란 명칭의 미국 특허 제6,172,209호에 개시되어 있다. 화학식 II의 대표적인 환형 2'-O-당 치환기는 본원에 참고로 인용되어 있는 "배좌적으로 미리조직화된 RNA 표적화된 2'-변형된 올리고뉴클레오티드(RNA Targeted 2'-Modified Oligonucleotides that are Conformationally Preorganized)"란 명칭의 미국 특허 제6,271,358호에 개시되어 있다.
리보실 고리 상에 O-치환기를 갖는 당은 또한 본 발명에 따른다. 고리 O에 대한 대표적인 치환으로는, 제한되지 않지만, S, CH2, CHF, 및 CF2가 포함된다.
올리고뉴클레오티드는 또한 펜토퓨라노실 당 대신에 당 유사체, 예컨대 사이클로부틸 잔기를 가질 수 있다. 이러한 변형된 당의 제조에 관한 대표적인 미국 특허로는, 제한되지 않지만, 미국 특허 제5,359,044호; 제5,466,786호; 제5,519,134호; 제5,591,722호; 제5,597,909호; 제5,646,265호 및 제5,700,920호가 포함되고, 이들 모두는 본원에 참고로 그의 전체가 인용되어 있다.
추가의 변형은 또한 올리고뉴클레오티드 상의 다른 위치에서, 특히 3' 말단 뉴클레오티드 상의 당의 3' 위치에서 이루어질 수도 있다. 예를 들면, 본 발명의 리간드-컨쥬게이트된 올리고뉴클레오티드의 하나의 추가의 변형은 올리고뉴클레오티드의 활성, 세포 분포 또는 세포 섭취를 증진시키는 하나 이상의 추가의 비-리간드 잔기 또는 컨쥬게이트를 올리고뉴클레오티드에 화학적으로 연결함을 포함한다. 이러한 잔기로는, 제한되지 않지만, 지질 잔기, 예컨대 콜레스테롤 잔기(렛싱어(Letsinger) 등의 문헌[Proc . Natl . Acad . Sci . USA, 1989, 86, 6553]), 콜산(마노하란 등의 문헌[Bioorg . Med . Chem . Lett ., 1994, 4, 1053]), 티오에터, 예를 들어, 헥실-S-트리틸티올(마노하란 등의 문헌[Ann . N. Y. Acad . Sci., 1992, 660, 306]; 마노하란 등의 문헌[Bioorg . Med . Chem . Let, 1993, 3, 2765]), 티오콜레스테롤(오버하우저(Oberhauser) 등의 문헌[Nucl . Acids Res., 1992, 20, 533]), 지방족 쇄, 예를 들어, 도데칸디올 또는 운데실 잔기(세이슨-베흐모아라스(Saison-Behmoaras) 등의 문헌[EMBO J., 1991, 10, 111]; 카바노브(Kabanov) 등의 문헌[FEBS Lett., 1990, 259, 327]; 스비나추크(Svinarchuk) 등의 문헌[Biochimie , 1993, 75, 49]), 인지질, 예를 들어, 디-헥사데실-rac-글리세롤 또는 트리에틸암모늄 1,2-디-O-헥사데실-rac-글리세로-3-H-포스포네이트(마노하란 등의 문헌[Tetrahedron Lett., 1995, 36, 3651]; 쉐아(Shea) 등의 문헌[Nucl . Acids Res ., 1990, 18, 3777]), 폴리아민 또는 폴리에틸렌 글리콜 쇄(마노하란 등의 문헌[Nucleosides & Nucleotides, 1995, 14, 969]), 또는 아다만탄 아세트산(마노하란 등의 문헌[Tetrahedron Lett ., 1995, 36, 3651]), 팔미틸 잔기(미쉬라(Mishra) 등의 문헌[Biochim . Biophys . Acta, 1995, 1264, 229]), 또는 옥타데실아민 또는 헥실아미노-카보닐-옥시콜레스테롤 잔기(크루케(Crooke) 등의 문헌[J. Pharmacol . Exp. Ther ., 1996, 277, 923])가 포함된다.
본 발명은 또한 올리고뉴클레오티드 내의 특정 위치에 대하여 실질적으로 키랄성으로 순수한 올리고뉴클레오티드를 사용하는 조성물을 포함한다. 실질적으로 키랄성으로 순수한 올리고뉴클레오티드의 예로는, 제한되지 않지만, 적어도 75%의 Sp 또는 Rp인 포스포로티오에이트 연결부를 갖는 올리고뉴클레오티드(쿡(Cook) 등의 미국 특허 제5,587,361호) 및 실질적으로 키랄성으로 순수한 (Sp 또는 Rp) 알킬포스포네이트, 포스포아미데이트 또는 포스포트리에스터 연결부를 갖는 올리고뉴클레오티드(쿡의 미국 특허 제5,212,295호 및 제5,521,302호)가 포함된다.
특정 경우에, 올리고뉴클레오티드는 비-리간드 기에 의해 변형될 수 있다. 다수의 비-리간드 분자는 올리고뉴클레오티드의 활성, 세포 분포 또는 세포 섭취를 증진시키기 위해 올리고뉴클레오티드에 컨쥬게이트되고, 이러한 컨쥬게이션을 수행하기 위한 절차는 과학 문헌에서 이용가능하다. 이러한 비-리간드 잔기로는 지질 잔기, 예컨대 콜레스테롤(렛싱어 등의 문헌[Proc . Natl . Acad . Sci . USA, 1989, 86, 6553]), 콜산(마노하란 등의 문헌[Bioorg . Med . Chem . Lett ., 1994, 4, 1053]), 티오에터, 예를 들어, 헥실-S-트리틸티올(마노하란 등의 문헌[Ann . N. Y. Acad. Sci., 1992, 660, 306]; 마노하란 등의 문헌[Bioorg . Med . Chem . Let, 1993, 3, 2765]), 티오콜레스테롤(오버하우저 등의 문헌[Nucl . Acids Res., 1992, 20, 533]), 지방족 쇄, 예를 들어, 도데칸디올 또는 운데실 잔기(세이슨-베흐모아라스 등의 문헌[EMBO J., 1991, 10, 111]; 카바노브 등의 문헌[FEBS Lett., 1990, 259, 327]; 스비나추크 등의 문헌[Biochimie , 1993, 75, 49]), 인지질, 예를 들어, 디-헥사데실-rac-글리세롤 또는 트리에틸암모늄 1,2-디-O-헥사데실-rac-글리세로-3-H-포스포네이트(마노하란 등의 문헌[Tetrahedron Lett., 1995, 36, 3651]; 쉐아 등의 문헌[Nucl . Acids Res ., 1990, 18, 3777]), 폴리아민 또는 폴리에틸렌 글리콜 쇄(마노하란 등의 문헌[Nucleosides & Nucleotides, 1995, 14, 969]), 또는 아다만탄 아세트산(마노하란 등의 문헌[Tetrahedron Lett., 1995, 36, 3651]), 팔미틸 잔기(미쉬라 등의 문헌[Biochim . Biophys . Acta, 1995, 1264, 229]), 또는 옥타데실아민 또는 헥실아미노-카보닐-옥시콜레스테롤 잔기(크루케 등의 문헌[J. Pharmacol . Exp. Ther ., 1996, 277, 923])가 포함된다. 전형적인 컨쥬게이션 프로토콜은 서열의 하나 이상의 위치에 아미노링커를 갖는 올리고뉴클레오티드의 합성을 수반한다. 이어서 아미노 기는 적절한 커플링 또는 활성화 시약을 사용하여 컨쥬게이트된 분자와 반응된다. 컨쥬게이션 반응은 고체 지지체에 여전히 결합된 올리고뉴클레오티드에 의해 또는 올리고뉴클레오티드가 분할된 후 수행된다. HPLC에 의한 올리고뉴클레오티드 컨쥬게이트의 정제는 전형적으로 순수한 컨쥬게이트를 제공한다. 콜레스테롤 컨쥬게이트의 사용은, 이러한 잔기가 간 조직, 인자 VII 단백질 생산 부위로의 표적화를 증가시킬 수 있으므로, 특히 바람직하다.
다르게는, 컨쥬게이트된 분자는, 분자중에 존재하는 알코올 기를 통해, 또는 포스포릴화될 수 있는 알코올 기를 갖는 링커의 결합에 의해 구성 요소, 예컨대 포스포아미다이트로 전환될 수 있다.
중요하게는, 각각의 이들의 연구법은 리간드 컨쥬게이트된 올리고뉴클레오티드의 합성을 위해 사용될 수 있다. 아미노 연결된 올리고뉴클레오티드는 리간드와 직접적으로 커플링 시약의 사용을 통해, 또는 NHS 또는 펜트플루오로페놀레이트 에스터로서 리간드가 활성화된 후 연결될 수 있다. 리간드 포스포아미다이트는 아미노 헥산올 링커의 결합을 통해 카복실 기중 하나에 합성되고, 이후 말단 알코올 작용기가 포스피틸화된다. 다른 링커, 예컨대 시스테아민은 합성된 올리고뉴클레오티드 상에 존재하는 클로로아세틸 링커로의 컨쥬게이션을 위해 이용될 수도 있다.
본 발명의 주요 요점중 하나는 본 발명의 dsRNA 분자를 포함하는 약학 조성물을 제공하는 것이다. 이러한 약학 조성물은 dsRNA 분자의 개별 스트랜드, 또는 본 발명의 dsRNA 분자에 포함된 센스 스트랜드 또는 안티센스 스트랜드중 적어도 하나를 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함하는 벡터(들)를 포함할 수 있다. 또한 본원에 한정된 dsRNA 분자를 발현하거나 포함하는 세포 및 조직이 약학 조성물로서 사용될 수 있다. 이러한 세포 또는 조직은 이식 연구법에 특히 유용할 수 있다. 이러한 연구법은 이종 기관이식을 포함할 수도 있다.
한 실시양태에서, 본 발명은 본원에 기재된 바와 같은 dsRNA, 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 제공한다. dsRNA를 포함하는 약학 조성물은 FVII 유전자의 발현 또는 활성과 연관된 질병 또는 질환, 예컨대 혈전색전성 질환을 치료하기에 유용하다.
본 발명의 약학 조성물은 FVII 유전자의 발현을 저해하기에 충분한 투여량으로 투여한다. 본 발명자들은, 본 발명의 dsRNA를 포함하는 조성물이 이의 증진된 효능으로 인해 낮은 투여량으로 투여될 수 있음을 발견하였다.
일반적으로, dsRNA의 적합한 투약량은 1일 수여자의 체중 1kg당 0.01 내지 5.0 밀리그램의 범위, 바람직하게는 1일 체중 1kg당 0.1 내지 200 마이크로그램의 범위, 더 바람직하게는 1일 체중 1kg당 0.1 내지 100 마이크로그램의 범위, 더욱 더 바람직하게는 1일 체중 1kg당 1.0 내지 50 마이크로그램의 범위, 가장 바람직하게는 1일 체중 1kg당 1.0 내지 25 마이크로그램의 범위일 것이다. 약학 조성물은 1일 1회 투여될 수 있거나, dsRNA는 하루 전체를 통해 적절한 간격으로 2회, 3회, 4회, 5회, 6회 이상의 하위 투약량으로 또는 연속적인 주입을 사용하여 투여될 수 있다. 이 경우, 각각의 하위 투약량에 포함된 dsRNA는 총 1일 투여량을 달성하기 위해 상응하게 더 적아야 한다. 투여량 단위는 또한 수 일에 걸쳐 전달하기 위해, 예를 들어, 수 일의 기간에 걸쳐 지속된 dsRNA 방출을 제공하는 통상적인 서방성 제형을 사용하여 배합될 수 있다. 서방성 제형은 당분야에 공지되어 있다. 이러한 실시양태에서, 투여 단위는 상응하는 다수의 1일 투약량을 포함한다.
숙련가라면 특정 인자, 제한되지 않지만, 질병 또는 질환의 위중성, 이전의 치료, 피험체의 일반적 건강 및/또는 연령, 및 존재하는 기타 질병이 피험자를 효과적으로 치료하기 위해 필요한 투여량 및 시간에 영향을 주는 것을 인식할 것이다. 게다가, 치료학적 효과량의 조성물로 피험체를 치료함은 1회 치료 또는 일련의 치료를 포함할 수 있다. 본 발명에 포함되는 개별 dsRNA를 위한 효과적 투여량 및 생체내 반감기의 추정은 통상의 방법을 사용하거나 적절한 동물 모델을 이용하는 생체내 시험을 기초로 이루어질 수 있다.
이러한 화합물의 독성 및 치료학적 효능은, 예를 들어, LD50(모집단의 50%에 치명적인 투약량) 및 ED50(모집단의 50%에 치료 효과적인 투약량)을 결정하기 위해, 세포 배양물 또는 실험 동물에서 표준 약학 절차에 의해 결정될 수 있다. 독성 및 치료 효과 사이의 투약량 비율은 치료 지수이고, 이는 LD50/ED50 비율로 표시될 수 있다. 높은 치료 지수를 나타내는 화합물이 바람직하다.
세포 배양 분석법 및 동물 연구로부터 수득된 데이터는 인간에서 사용하기 위한 투여량의 범위로 제형에 사용될 수 있다. 본 발명의 조성물의 투여량은 바람직하게는 거의 또는 전혀 독성 없이 ED50을 포함하는 순환 농도 범위내에 있다. 투여량은 이용되는 투여 형태 및 이용되는 투여 경로에 따라 상기 범위내에서 다양할 수 있다. 본 발명의 방법에 사용되는 임의의 화합물의 경우, 치료 효과 투약량은 세포 배양 분석법으로부터 초기에 추정될 수 있다. 1회 투약량은 화합물, 또는 적절한 경우, 표적 서열의 폴리펩타이드 생성물의 순환 혈장 농도(세포 배양물에서 결정될 경우 IC50, 즉 증후의 최대 저해의 반을 달성하는 시험 화합물의 농도를 포함함)를 달성(예를 들어, 폴리펩타이드의 감소된 농도를 달성)하기 위해 동물 모델에서 제형화될 수 있다. 이러한 정보는 인간에서 유용한 투약량을 보다 정확히 결정하기 위해 사용될 수 있다. 혈장중 수준은, 예를 들면, 고성능 액체 크로마토그래피에 의해 측정될 수 있다.
상기 논의된 바와 같이, 본 발명의 dsRNA의 개별적 또는 복수회의 투여에 더하여, 이는 다른 공지된 제제와 조합하여 투여될 수 있다. 임의의 상황에서, 투여하는 의사는 당분야에 공지되거나 본원에 기재된 효능의 표준 측정법을 사용하여 관찰된 결과에 기초하여 dsRNA 투여 양 및 시간을 조정할 수 있다.
본 발명에 포함되는 약학 조성물은 당분야에 공지된 임의의 수단, 제한되지 않지만, 예컨대 경구 또는 비경구 경로, 예컨대 정맥내, 근육내, 복강내, 피하, 경피, 기도(에어로졸), 비강, 직장, 질 및 국소(구강 및 설하) 투여, 및 경막외 투여에 의해 투여될 수 있다. 바람직한 실시양태에서, 약학 조성물은 주입 또는 주사에 의해 정맥내로 투여된다.
달리 정의되지 않는 한, 본원에 사용된 모든 기술적 및 과학적 용어는 본 발명이 속하는 분야의 숙련가에 의해 통상적으로 이해되는 것과 동일한 의미를 갖는다. 본원에 기재된 것과 유사하거나 동등한 방법 및 재료가 본 발명의 실행 또는 시험에 사용될 수 있지만, 적합한 방법 및 재료는 이후 기재된다. 본원에 언급된 모든 공개공보, 특허 출원, 특허 및 다른 문헌은 본원에 그의 전체가 참고로 인용된다. 대립시, 정의를 비롯한 본 명세서는 조절될 것이다. 추가로, 재료, 방법 및 예는 단지 예시적인 것으로 제한하려는 것이 아니다.
본 발명의 상기 제공된 실시양태 및 항목은 이제 하기 비제한적 실시예에 의해 예시된다.
도 1 - 서열 번호 쌍 259/260을 포함하는 FVII dsRNA(도 1a) 및 서열 번호 쌍 253/254를 포함하는 dsRNA(도 1b)를 LNPO1(1:14) 리포좀 제형중 4mg/kg으로 정맥주사한 후에 기니 피그에서 FVII 혈장 수준에 미치는 FVII 표적화 dsRNA("FVII dsRNA")의 효과. 루시퍼라아제(Luciferase) dsRNA(서열 번호 쌍 411/412)/LNPO1 및 PBS는 대조표준이다. 결과는 개별 동물로부터 취해진다.
도 2 - 기니 피그에서 서열 번호 쌍 259/260("FVII siRNA")을 포함하는 FVII dsRNA를 LNPO1(1:14) 리포좀 제형중 1, 2, 3, 4, 5mg/kg으로 정맥주사한 후 간에서의 FVII mRNA 수준(2a) 및 혈장에서의 FVII 수준(2b)에 미치는 FVII dsRNA의 효과. 모든 측정은 주사 후 48시간 또는 72시간째 수행하였다. mRNA 결과는 PBS-처리군에 대한 퍼센트로 표시되고; FVII 자이모겐 결과는 처리전 값에 대한 퍼센트로 표시된다. 루시퍼라아제 dsRNA(서열 번호 쌍 411/412; "Luc siRNA")/LNPO1 및 PBS는 대조표준이다. 통계: 평균±평균의 표준 오차(sem: standard error of mean); * ANOVA, 포스트-혹 더넷(post-hoc Dunnett)의 시험; ‡다중 t-시험.
도 3 - 서열 번호 쌍 259/260("FVII siRNA")을 포함하는 FVII dsRNA를 LNPO1(1:14) 리포좀 제형중 1, 2, 3, 4, 5mg/kg으로 정맥주사한 후 기니 피그의 프로트롬빈 시간(PT: 프로트롬빈 시간)에 미치는 FVII dsRNA의 효과. 혈액을 FVII dsRNA(기선)의 정맥주사 바로 전, 주사 후 48시간 또는 72시간째 수거하였다. 결과는 처리전 값에 대한 연장 배수(fold prolongation)로 표시된다(평균±sem). 루시퍼라아제 dsRNA(서열 번호 쌍 411/412; "Luc siRNA")/LNPO1 및 PBS는 대조표준이다.
도 4 - 서열 번호 쌍 259/260("FVII dsRNA")을 포함하는 FVII dsRNA를 LNPO1(1:14) 리포좀 제형중 1, 2, 3, 4, 5mg/kg으로 정맥주사한 후의 기니 피그 동맥 혈전증 모델에서 FVII dsRNA의 항혈전 효과. 모든 측정은 마취된 동물에서 주사후 48시간 및 72시간째 수행하였다(방법 참조). 결과는 PBS-처리군에 대한 퍼센트로 표시된다. 루시퍼라아제 dsRNA(서열 번호 쌍 411/412; "Luc dsRNA")/LNPO1 및 PBS는 대조표준이다. 통계: 평균±sem; * ANOVA, 포스트-혹 더넷의 시험; ‡다중 t-시험.
도 5 - 기니 피그에서 서열 번호 쌍 259/260("siFVII")을 포함하는 FVII dsRNA를 SNALP-L 제형중 1, 2, 3, 4, 5mg/kg으로 정맥주사한 후 간에서의 FVII mRNA 수준(a) 및 혈장에서의 FVII 수준(b)에 미치는 FVII dsRNA의 효과. 루시퍼라아제 dsRNA(서열 번호 쌍 411/412; "siLuc")/SNALP-L 및 PBS는 대조표준이다.
도 6 - SNALP-L 제형중 서열 번호 쌍 259/260을 포함하는 FVII dsRNA를 정맥주사한 후 기니 피그에서 (a) 외과적 혈액 손실 및 (b) 발톱 큐티클(cuticle) 출혈 시간에 미치는 FVII dsRNA의 효과. 결과는 PBS-처리군에 대한 증가 배수(외과적 혈액 손실) 및 연장 배수(큐티클 출혈 시간)로 표시되었다. 모든 측정을 주사후 72시간째 수행하였다. SNALP-L 제형중 루시퍼라아제 dsRNA(서열 번호 쌍 411/412)(Luc dsRNA) 및 PBS는 대조표준이다. 95%까지 FVII의 하향 조절에 의해(0.05mg/kg에서 2mg/kg로의 FVII dsRNA), 양쪽 모델에서 출혈 경향의 증가가 관찰되지 않았다.
도 7 - 혈장중 FVII 활성 및 PT-연장 사이의 관계. FVII 활성은 FVII-의존성 응고 파라미터 PT와 관련이 깊은 FVII dsRNA(LNPO1 및 SNALP-L에 제형화된 FVII dsRNA로부터의 조합된 데이터)의 정맥주사후에 감소한다 .
도 8 - 루시퍼라아제 dsRNA(서열 번호 쌍 411/412) 또는 FVII dsRNA(서열 번호 19/20)의 투약 전 3회 및 단일 일시 정맥주사 후 24시간 및 48시간째 색소생산성 분석법(chromogenic assay)에 의해 측정된 사이노몰구스 원숭이 혈장중의 FVII 활성. dsRNA에 대한 투약량은 mg/kg으로서 각각의 군에 제공된다. N=2마리 암컷 사이노몰구스 원숭이. 값은 각각의 개별 원숭이의 투약 전 FVII 활성값의 평균에 대해 정규화되고, 오차 막대는 표준 편차를 나타낸다.
도 9 - SNALP 제형중 루시퍼라아제 dsRNA(siLUC)(서열 번호 쌍 411/412) 또는 SNALP 제형중 FVII dsRNA(siFVII)(서열 번호 19/20)의 투약 전 3회 및 단일 일시 정맥주사 후 24시간 및 48시간째 측정된 사이노몰구스 혈장중 프로트롬빈 시간(PT). dsRNA에 대한 투약량은 mg/kg으로서 각각의 군에 제공된다. N=2마리 암컷 사이노몰구스 원숭이. 값은 각각의 개별 원숭이의 투약 전 PT의 평균에 대해 정규화된 배수 변화로 제공되고, 오차 막대는 표준 편차를 나타낸다.
도 10 - SNALP 제형 중 루시퍼라아제 dsRNA(siLUC)(서열 번호 쌍 411/412) 또는 SNALP 제형 중 FVII dsRNA(siFVII)(서열 번호 19/20)의 투약 전 3회 및 단일 일시 정맥주사 후 24시간 및 48시간째 색소생산성 분석법에 의해 측정된 사이노몰구스 원숭이 혈장중의 FVII 활성. dsRNA에 대한 투약량은 mg/kg으로서 각각의 군에 제공된다. N=2마리 수컷 사이노몰구스 원숭이이지만, 단 1mg/kg의 FVII dsRNA 군의 경우 n=3마리 수컷 사이노몰구스 원숭이이고, 3mg/kg 루시퍼라아제 dsRNA 군의 경우 n=2마리 암컷 사이노몰구스 원숭이이다. 값은 100%로 설정된 각각의 개별 원숭이의 투여전 FVII 활성값의 평균에 대해 정규화되었다. 오차 막대는 각각의 군에서 원숭이의 최소값/최대값을 지시한다.
도 11 - SNALP 제형중 루시퍼라아제 dsRNA(siLUC)(서열 번호 쌍 411/412) 또는 SNALP 제형중 FVII dsRNA(siFVII)(서열 번호 19/20)의 투약 전 3회 및 단일 일시 정맥주사 후 24시간 및 48시간째 측정된 사이노몰구스 원숭이 혈장중의 프로트롬빈 시간(PT). dsRNA에 대한 투약량은 mg/kg으로서 각각의 군에 제공된다. N=2마리 수컷 사이노몰구스 원숭이이지만, 단 1mg/kg의 FVII dsRNA 군의 경우 n=3마리 수컷 사이노몰구스 원숭이이고, 3mg/kg 루시퍼라아제 dsRNA 군의 경우 n=2마리 암컷 사이노몰구스 원숭이이다. 값은 1로 설정된 각각의 개별 원숭이의 투약 전 PT 값의 평균에 대해 정규화된 x-배수 PT 변화로 제공된다. 오차 막대는 각각의 군에서 원숭이의 최소값/최대값을 지시한다.
도 12 - 사이노몰구스 혈청중 FVII 활성은 SNALP 제형중 루시퍼라아제 dsRNA(siLUC)(서열 번호 쌍 411/412) 또는 SNALP 제형중 FVII dsRNA(siFVII)(서열 번호 19/20)의 단일 일시 정맥주사 전후의 시간에 걸쳐 수행되었다. FVII 활성은 투약 전 3회 및 투약 후 지시된 시점에 색소생산성 분석법에 의해 측정되었다. dsRNA에 대한 투약량은 각각의 동물에 대해 mg/kg으로 제공되고, 숫자는 연구에서 개별 동물-ID를 지시한다. 곡선은 주사일에 100%로 설정된 각각의 동물의 예비투약량의 평균으로 정규화된다.
도 13 - 사이노몰구스 혈장중 프로트롬빈 시간(PT)은 SNALP 제형중 루시퍼라아제 dsRNA(siLUC)(서열 번호 쌍 411/412) 또는 SNALP 제형중 FVII dsRNA(siFVII)(서열 번호 19/20)의 단일 일시 정맥주사 전후의 시간에 걸쳐 수행되었다. PT는 투약 전 3회 및 투약 후 지시된 시점에 측정되었다. dsRNA에 대한 투약량은 각각의 동물에 대해 mg/kg으로 제공되고, 숫자는 연구에서 개별 동물-ID를 지시한다. 값은 PT 배수 변화로 제공되고 곡선은 주사일에 1로 설정된 각각의 동물의 예비투약량의 평균으로 정규화된다.
도 14 - 사이노몰구스 원숭이 혈장중 FVII 활성은 SNALP 제형 중 FVII dsRNA(siFVII)(서열 번호 19/20)를 3mg/kg으로 반복된 일시 정맥주사 전후의 시간에 대해 수행되었다. FVII 활성은 투약 전 3회 및 투약 후 지시된 시점에 색소생산성 분석법에 의해 측정되었다. 곡선은 제1 주사일에 100%로 설정된 각각의 동물의 예비투약량의 평균으로 정규화된다.
도 15 - 사이노몰구스 원숭이 혈장중 프로트롬빈 시간(PT)은 SNALP 제형중 FVII dsRNA(siFVII)(서열 번호 19/20)의 반복된 일시 정맥주사 전후의 시간에 대해 수행되었다. PT는 투약 전 3회 및 3mg/kg으로 투약 후 지시된 시점에 측정되었다. 값은 PT 배수 변화로 제공되고 곡선은 주사일에 1로 설정된 각각의 동물의 예비투약량의 평균으로 정규화된다.
도 16 - 오프-표적 서열을 침묵시키는데 미치는 서열 번호 쌍 13/14를 포함하는 FVII dsRNA의 효과. FVII mRNA의 19량체 표적 부위("온(on)") 또는 컴퓨터모의실험 예측된 오프-표적 서열("오프 1" 내지 "오프 10"; "오프 1" 내지 "오프 8"은 안티센스 스트랜드 오프-표적이고 "오프 9" 및 "오프 10"은 센스 스트랜드 오프-표적임)에 대해 대표적인, 2중 루시퍼라아제 구성물을 발현하는 COS7 세포를 50nM FVII dsRNA로 형질감염한 후의 레닐라(renilla) 루시퍼라아제 단백질의 발현. 완벽하게 매칭된 오프-표적 dsRNA는 상응하는 표적-부위의 기능적 침묵에 대한 양성 대조표준이다.
도 17 - 오프-표적 서열을 침묵시키는데 미치는 서열 번호 쌍 19/20을 포함하는 FVII dsRNA의 효과. FVII mRNA의 19량체 표적 부위("온") 또는 컴퓨터모의실험 예측된 오프-표적 서열("오프 1" 내지 "오프 17"; "오프 1" 내지 "오프 14"는 안티센스 스트랜드 오프-표적이고 "오프 15" 내지 "오프 17"은 센스 스트랜드 오프-표적임)에 대해 대표적인, 2중 루시퍼라아제 구성물을 발현하는 COS7 세포를 50nM FVII dsRNA에 의해 형질감염한 후의 레닐라 루시퍼라아제 단백질의 발현. 완벽하게 매칭된 오프-표적 dsRNA는 상응하는 표적-부위의 기능적 침묵에 대한 양성 대조표준이다. 인자 VII mRNA의 표적 부위는 동일한 10개의 뉴클레오티드 상류 및 하류에 의해 오프 11로서 클로닝되어 하나의 작용성 표적 부위를 생성한다.
도 18 - 오프-표적 서열을 침묵시키는데 미치는 서열 번호 쌍 11/12를 포함하는 FVII dsRNA의 효과. FVII mRNA의 19량체 표적 부위("온") 또는 컴퓨터모의실험 예측된 오프-표적 서열("오프 1" 내지 "오프 16"; "오프 1" 내지 "오프 13"은 안티센스 스트랜드 오프-표적이고 "오프 14" 내지 "오프 16"은 센스 스트랜드 오프-표적임)에 대해 대표적인, 2중 루시퍼라아제 구성물을 발현하는 COS7 세포를 50nM FVII dsRNA에 의해 형질감염한 후의 레닐라 루시퍼라아제 단백질의 발현. 완벽하게 매칭된 오프-표적 dsRNA는 상응하는 표적-부위의 기능적 침묵에 대한 양성 대조표준이다. 인자 VII mRNA의 표적 부위는 서열 번호 쌍 19/20에 대해 동일한 10개의 뉴클레오티드 상류 및 하류에 의해 오프 11로서 클로닝되어 하나의 작용성 표적 부위를 생성한다.
표의 설명
표 1 - 인간 인자 VII 유전자 표적화 dsRNA. 대문자는 RNA 뉴클레오티드를 나타내고 소문자 "c", "g", "a" 및 "u"는 2' O-메틸-변형된 뉴클레오티드를 나타내고, "s"는 포스포로티오에이트를 나타내고, "dT"는 데옥시티미딘을 나타낸다.
표 2 - 인간 인자 VII 표적화 dsRNA의 특징: Huh7 세포에서 투약 반응에 대한 활성 시험. IC50: 50% 저해 농도.
표 3 - 인간 인자 VII 표적화 dsRNA의 특징: 안정성 및 사이토킨 유도, t1/2: 실시예에 정의된 바와 같은 스트랜드의 반감기, PBMC: 인간 말초 혈액 단핵 세포.
표 4 - 기니 피그 인자 VII 유전자 표적화 dsRNA. 대문자는 RNA 뉴클레오티드를 나타내고, 소문자 "c", "g", "a" 및 "u"는 2' O-메틸-변형된 뉴클레오티드를 나타내고, "s"는 포스포로티오에이트를 나타내고, "dT"는 데옥시티미딘을 나타낸다. "f"는 이전 뉴클레오티드의 2' 플루오로 변형을 나타낸다.
표 5 - 기니 피그 인자 VII 표적화 dsRNA의 특징. IC50: 50% 저해 농도, PBMC: 인간 말초 혈액 단핵 세포.
표 6 - 인간 인자 VII 유전자 표적화 dsRNA. 대문자는 RNA 뉴클레오티드를 나타내고 "T"는 데옥시티미딘을 나타낸다.
표 7 - 기니 피그 인자 VII 유전자 표적화 dsRNA. 대문자는 RNA 뉴클레오티드를 나타내고 "T"는 데옥시티미딘을 나타낸다.
표 8 - 서열 번호 쌍 13/14를 포함하는 인간 FVII 표적화 dsRNA의 선택된 오프-표적
표 9 - 서열 번호 쌍 19/20을 포함하는 인간 FVII 표적화 dsRNA의 선택된 오프-표적
표 10 - 서열 번호 쌍 11/12를 포함하는 인간 FVII 표적화 dsRNA의 선택된 오프-표적
실시예
치료 용도를 위한 dsRNA 의 동정
치료 용도를 위하여 인간 인자 VII를 특이적으로 표적화하는 dsRNA를 동정하기 위해 dsRNA 고안을 수행하였다. 우선, 인간(호모 사피엔스(Homo sapiens)) 인자 VII의 공지된 mRNA 서열(서열 번호 406 및 서열 번호 407로 열거된 NM_019616 및 NM_OOO131.3)을 컴퓨터 분석에 의해 검사하여, 서열 사이에 교차반응성인 RNA 간섭(RNAi: RNA interference) 제제를 생성하는 19개 뉴클레오티드의 상동성 서열을 동정하였다.
RNAi 제제를 동정하는데 있어서, 인간 RefSeq 데이터베이스(릴리스(release) 25)중 임의의 다른 서열에 적어도 2개의 부정합을 갖는 19량체 서열로 선택을 제한하였고, 이는 패스트A 알고리즘(fastA algorithm)을 사용함으로써 포괄적 인간 전사체를 나타내는 것으로 추정되었다.
사이노몰구스 원숭이(마카카 파시큘라리스(Macaca fascicularis)) 인자 VII 유전자의 CDS(코딩 서열)를 16마리 원숭이로부터 RT-PCR 증폭 이후에 서열화하였다. 이러한 서열은 NCBI EST/EMBL BB885059 EST(서열 번호 408)의 역 보체와 함께 사용되어 사이노몰구스 원숭이 인자 VII에 대한 대표적인 컨센서스(consensus) 서열(서열 번호 409)를 생성하였다.
인간 뿐만 아니라 사이노몰구스 원숭이 인자 VII에 교차 반응성인 dsRNA 치료 용도에 가장 바람직한 것으로 규정하였다. 4개 이상의 연속적인 G를 포함하는 모든 서열(폴리-G 서열)을 합성에서 배제하였다.
이와 같이 동정된 서열은 표 1 및 6에서 RNAi 제제의 합성에 대한 기초를 형성하였다.
개념 연구의 생체내 증거를 위한 dsRNA 의 동정
개념 실험의 생체내 증거를 위하여 기니 피그(카비아 포르셀러스) 뿐만 아니라 시험관내 스크리닝 목적을 진행하기 위하여 인간 인자 VII를 표적화하는 dsRNA를 동정하기 위해 dsRNA 고안을 수행하였다. 우선, 기니 피그 인자 VII ENSEMBL(ENSCPOT00000005353, 서열 번호 410)에 대한 예측된 전사체 및 인간 인자 VII의 공지된 mRNA 서열(서열 번호 406 및 서열 번호 407로 열거된 NM_019616 및 NM_OOO131.3)을 컴퓨터에 의해 검사하여 서열 사이에 교차 반응성인 RNAi 제제를 생성하는 19개 뉴클레오티드의 상동성 서열을 동정하였다.
4개 이상의 연속적인 G를 포함하는 모든 서열(폴리-G 서열)을 합성에서 배제하였다. 이와 같이 동정된 서열은 표 4 및 7에서 RNAi 제제의 합성에 대한 기초를 형성하였다.
dsRNA 합성
시약의 공급원이 본원에 구체적으로 제공되지 않는 경우, 이러한 시약은 분자 생물학을 위한 시약의 임의의 공급업체로부터 분자 생물학에 적용하기 위한 품질/순도 표준값으로 입수될 수 있다.
엑스페다이트(Expedite) 8909 합성기(어플라이드 바이오시스템즈, 어플레라 도이치랜드 게엠베하(Applied Biosystems, Applera Deutschland GmbH), 독일 다름스타트 소재) 및 고체 지지체로서의 제어된 기공 유리(CPG, 5O0Å, 프롤리고 바이오케미에 게엠베하(Proligo Biochemie GmbH), 독일 햄버그 소재)를 사용하여 1μ몰의 척도로 고체 상 합성에 의해 단일 스트랜드 RNA를 생성하였다. RNA 및 2'-O-메틸 뉴클레오티드를 포함하는 RNA를, 상응하는 포스포아미다이트 및 2'-O-메틸 포스포아미다이트(프롤리고 바이오케미에 게엠베하, 독일 햄버그 소재)를 각각 사용하여 고체 상 합성에 의해 생성하였다. 예컨대 뷰케이지의 문헌[Current protocols in nucleic acid chemistry, John Wiley & Sons, Inc., New York, NY, USA]에 기재된 표준 뉴클레오시드 포스포아미다이트 화학을 사용하여 이들 구성 요소를 올리고리보뉴클레오티드 쇄의 서열내의 선택된 부위에 혼합하였다. 요오드 산화제 용액을 아세토니트릴중 뷰케이지(Beaucage) 시약(츠루아켐 리미티드(Chruachem Ltd), 영국 글래스고우 소재) 용액(1%)으로 대체함으로써 포스포로티오에이트 연결부를 도입하였다. 추가의 보조 시약을 말린크로트 베이커(Mallinckrodt Baker)(독일 그리스하임 소재)로부터 입수하였다.
음이온 교환 HPLC에 의한 조질의 올리고리보뉴클레오티드의 보호제거 및 정제를 확립된 절차에 따라 수행하였다. 분광광도계(DU 640B, 베크만 쿨터 게엠베하(Beckman Coulter GmbH), 독일 운터슐라이스하임 소재)를 사용하여 260nm 파장에서 각각의 RNA의 용액의 UV 흡광도에 의해 수율 및 농도를 결정하였다. 상보성 스트랜드의 동몰 용액을 어닐링(annealing) 완충액(20mM 인산 나트륨, pH 6.8; 100mM 염화 나트륨)에서 혼합하고, 수욕에서 85 내지 90℃로 3분 동안 가열하고, 실온으로 3 내지 4시간 동안 냉각시킴으로써 2중 스트랜드 RNA를 생성하였다. 어닐링된 RNA 용액을 사용할 때까지 -20℃에서 저장하였다.
활성 시험
상기 기재된 인자 VII-dsRNA의 활성을 Huh7 세포에서 시험하였다.
배양액중 Huh7 세포를, 인자 VII-특이적 dsRNA와 함께 항온처리된 세포로부터 유도된 총 mRNA에서 분지화된 DNA에 의한 인자 VII mRNA의 정량화에 사용하였다.
Huh7 세포를 아메리칸 타입 컬쳐 콜렉션(American Type Culture Collection)(메릴랜드주 락빌 소재, 품목 번호 HB-8065)으로부터 입수하고, 5% 소 태아 혈청(FCS: fetal calf serum)(깁코 인비트로겐(Gibco Invitrogen), 품목 번호 16250-078), 1% 페니실린/스트렙토마이신(깁코 인비트로겐, 품목 번호 15140-122)을 포함하도록 강화된 페놀 레드가 없는 DMEM/F-12(깁코 인비트로겐, 독일 소재, 품목 번호 11039-021)에서 37℃에서 5% CO.sub.2의 분위기하에 습식 인큐베이터(헤라에우스 헤라셀, 켄드로 래보레이토리 프로덕츠(Heraeus HERAcell, Kendro Laboratory Products), 독일 라겐셀볼트 소재)에서 배양하였다.
세포 파종 및 dsRNA의 형질감염을 동일한 시간에 수행하였다. dsRNA에 의한 형질감염을 위해, Huh7 세포를 96-웰 플레이트에 웰당 10.상청액.4세포로 2.5.배 밀도로 파종하였다. dsRNA의 형질감염을 리포펙타민(lipofectamine) 2000(인비트로겐 게엠베하(Invitrogen GmbH), 독일 카를스루헤 소재, 품목 번호 11668-019)에 의해 제조업체에 의해 설명된 바와 같이 수행하였다. 제1의 단일 투약 실험에서, dsRNA를 30nM의 농도로 Huh7 세포에서 형질감염하였다. 각각의 데이터포인트를 4중으로 결정하였다. 2개의 독립적인 실험을 수행하였다. 3OnM에서 단일 투약량 스크린으로부터 70% 초과의 mRNA 넉다운을 보여주는 가장 효과적인 dsRNA는 투약량 반응 곡선에 의해 추가로 특징화되었다. 투약 반응 곡선을 위해, 형질감염을 상기 단일 투약량 스크린에 대해 기재된 바와 같지만, 다음의 dsRNA(nM)의 농도로 수행하였다: 24, 6, 1.5, 0.375, 0.0938, 0.0234, 0.0059, 0.0015, 0.0004 및 0.0001nM. 형질감염 세포를 24시간 동안 37℃ 및 5% CO2하에 습식 인큐베이터(헤라에우스 게엠베하, 독일 하나우 소재)에서 수행하였다. 인자 VII mRNA의 측정의 경우, mRNA의 bDNA 정량화를 위해 보다 감도가 높은 퀀티젠(QuantiGene) 2.0 분석 키트(파노믹스(Panomics), 미국 캘리포니아주 프레몬트 소재, 품목 번호 QSOO11)를 사용한 반면, GAP-DH mRNA의 경우, 퀀티젠 1.0 분석 키트(파노믹스, 미국 캘리포니아주 프레몬트 소재, 품목 번호 QG0004)를 사용하였다. 형질감염된 Huh7 세포를 제조업체가 추천한 절차에 따라 수거하고 53℃에서 용해하였다. 50㎕의 용해물을 인간 인자 VII mRNA, 또는 기니 피그 인자 VII에 각각 특이적인 프로브세트(probeset)(프로브세트의 서열은 아래를 참조함)와 함께 항온처리하고, 퀀티젠에 대한 제조업체의 프로토콜에 따라 처리하였다. GAP-DH mRNA의 측정을 위해, 1O㎕의 세포 용해물을 GAP-DH 특이적 프로브세트로 분석하였다. 화학 발광을 빅토르(Victor)2-라이트(Light)(퍼킨 엘머(Perkin Elmer), 독일 비스바덴 소재)에서 상대적 광 유닛(RLU: relative light unit)으로서 측정하고, 인간 인자 VII 프로브세트에 의해 수득된 값을 각각의 웰에 대한 개개의 인간 GAPDH 값으로 정규화하였다. 관련되지 않은 대조 dsRNA를 음성 대조표준으로서 사용하였다. 저해 데이터는 표 2 및 5에 제공된다.
인간 인자 VII 의 결정을 위한 bDNA 프로브의 서열
Figure pct00004
인간 GAPDH 의 결정을 위한 bDNA 프로브의 서열
Figure pct00005
LE= 표지 증량제, CE= 포획 증량제, BL= 차단 프로브
dsRNA 의 안정성
dsRNA의 안정성을 시험관내 분석에서 인간 혈청 또는 사이노몰구스 원숭이로부터의 혈장에 의해 각각의 단일 스트랜드의 반감기를 측정함으로써 결정하였다.
30㎕의 인간 혈청 또는 사이노몰구스 혈장(시그마 알드리치(Sigma Aldrich))와 혼합된 3㎕의 50μM dsRNA 샘플을 사용하여 측정을 각각의 시점에 3중으로 수행하였다. 혼합물을 O분, 30분, 1시간, 3시간, 6시간, 24시간, 또는 48시간 동안 37℃에서 항온처리하였다. 비특이적 분해를 위한 대조표준으로서, dsRNA를 30㎕의 1x PBS(pH 6.8)와 함께 48시간 동안 항온처리하였다. 4㎕의 프로테이나아제(proteinase) K(20mg/ml), 25㎕의 "조직 및 세포 용해 용액(Tissue and Cell Lysis Solution)"(에피센트레(Epicentre)) 및 38㎕의 밀리포어 워터(Millipore water)를 30분 동안 65℃에서 첨가함으로써 반응을 중단시켰다. 이후 샘플을 0.2㎛의 96 웰 필터 플레이트를 통해 1400 rpm에서 8분 동안 스핀 여과하고, 55㎕의 밀리포어 워터로 2회 세척하고 다시 스핀여과하였다.
단일 스트랜드의 분리 및 남은 전장 생성물(FLP: full length product)의 분석을 위해, 샘플을 용출액 A로서 10% ACN(pH=11)중 2OmM Na3PO4를 사용하고 용출액 B로서 용출액 A중 1M NaBr을 사용하여 변성 조건하에 이온 교화 디오넥스 서밋(Dionex Summit) HPLC을 통해 샘플을 통과시켰다.
하기 구배를 적용하였다:
Figure pct00006
매번의 주사시, 디오넥스 크로멜레온(Dionex Chromeleon) 6.60 HPLC 소프트웨어에 의해 크로마토그램을 자동적으로 적분하고, 필요할 경우 수동으로 조정하였다. 모든 피이크 면적을 내부 표준(IS: internal standard) 피이크로 보정하고 t=0분에서 항온처리로 정규화하였다. 피이크 아래의 면적 및 생성된 잔류 FLP를 각각의 단일 스트랜드에 대해 계산하고, 별도로 3중처리하였다. 스트랜드의 반감기(tl/2)를, FLP의 반이 분해되는, 3중값의 평균 시점[시간]으로 규정하였다. 결과는 표 3 및 5에 제공된다.
사이토킨 유도
시험관내 PBMC 분석에서 INF-α 및 TNF-α의 방출을 측정함으로써 dsRNA의 잠재적인 사이토킨 유도를 결정하였다.
인간 말초 혈액 단핵 세포(PBMC: peripheral blood mononuclear cell)를 형질감염일에 피콜(Ficoll) 원심분리에 의해 두 공여자의 버피 코트(buffy coat) 혈액으로부터 단리하였다. 세포를 dsRNA에 의해 4중으로 형질감염하고, 진 포터(Gene Porter) 2(GP2) 또는 DOTAP를 사용하여 24시간 동안 37℃에서 Opti-MEM중 13OnM의 최종 농도로 배양하였다. 상기 분석에서 INF-α 및 TNF-α를 유도하는 것으로 공지된 dsRNA 서열, 뿐만 아니라 CpG 올리고를 양성 대조표준으로서 사용하였다. 사이토킨 유도를 위해 형질감염 시약이 필요하지 않은 화학 컨쥬게이트된 dsRNA 또는 CpG 올리고뉴클레오티드를 배양 배지에서 50OnM의 농도로 항온처리하였다. 항온처리 종료시, 4중의 배양 상청액을 푸울링(pooling)하였다.
이어서 INF-α 및 TNF-α를 푸울당 2개의 데이터포인트로 표준 샌드위치(sandwich) ELISA에 의해 푸울링된 상청액에서 측정하였다. 사이토킨 유도 정도를 0 내지 5의 스코어를 사용하여 양성 대조표준에 대하여 표시하였고, 5는 최대 유도를 지시한다. 결과는 표 3 및 5에 제공된다.
FVII (기니 피그 ) 표적화 dsRNA 의 생체내 효과
항혈전 효과
상기 기재된 FVII dsRNA의 활성을, 신규 항혈전 약물의 생체내 효능 평가를 위해 이전에 개발된 유효한 기니 피그 동맥 혈전증 모델(힘버(Himber J.) 등의 문헌[Thromb Haemost. (2001); 85:475-481])에서 시험하였다.
수컷 기니 피그(350-450g, CRL: (HA) BR, 찰스 리버(Charles River)(독일))를 케타민-HCl 90mg/kg 및 실라진(Xylazine) 2% 10mg/kg의 근육주사 유도에 의해 마취시킨 후, 연속적인 가스 마취를 수행하였다. O2/공기(40:60)중 1 내지 3 부피% 이소플루란을, 마취제를 공급하고 동시에 과량의 증기를 소거하는 2중 흡인 마스크(프로버트 아게(Provet AG), 스위스 소재)를 통해 증발기를 경유하여 전달하였다. 체온을 자동온도조절 장치에 의해 38℃로 유지시켰다.
기니 피그를 등쪽으로 놓고, 카테터(TriCath In 22G, 0.8mm x 30mm, 코단 스테리텍스(Codan Steritex) ApS, 덴마크 데스퍼가에르데 소재)를 혈액 샘플링을 위해 우측 대퇴 동맥에 넣었다. 우측 경동맥을 해부하고 체류 시간 유량계 모듈(Transit Time flowmeter module)(TS420, 트랜소닉 시스템스 인크.(Transonic Systems Inc.), 미국 뉴욕주 이타카 소재)에 커플링된 혈관주변 초음파 유동프로브(perivascular ultrasonic flowprobe)(트랜소닉 0.7 PSB 232)를 경동맥 주변에 설치하여 혈류 속도를 모니터링하였다. 경동맥 혈류 속도를 그래프텍 선형 기록기(Graphtec Linear recorder) VII(모델 WR 3101, 휴고 사흐스(Hugo Sachs), 독일 마치-휴그스테텐 소재) 상에 기록하였다.
혈류의 5 내지 15분간의 안정화 기간 이후, 해부된 경동맥의 1mm 분절을 고무로 덮힌 겸자로 1초 동안 핀칭(pinching)함으로써 내피하층의 손상을 유동 프로브에서 2 밀리미터 떨어진 곳에 유도하였다. 손상 후, 혈류의 점진적인 감소가 초래되어 완전한 혈관 폐색이 일어났다. 유동이 0에 도달되었을 때, 손상된 영역 상의 경동맥을 온화하게 흔들어 폐색성 혈전을 밀어내고 유동을 복원하여 순환식 유동 변화(CFV: cyclic flow variation)를 일으켰다. CFV가 8분 동안 전혀 관찰되지 않았을 때, 제1 손상 부위에 핀칭을 반복하였다. CFV가 초래되지 않는다면, 동일한 절차를 매 8분 마다 반복하였다. 최종적으로, CFV를 생성하는데 필요한 핀치의 수를 40분의 관찰 기간에 걸쳐 계수하였다. 이러한 프로토콜을 사용하여, 각각의 CFV의 평균 주기성은 대조 동물에서 대략 3 내지 5분/주기였다. 혈전증 지수를 핀치 수에 대한 CFV 수의 비율로서 계산하였다.
상기 기재된 FVII dsRNA를 혈관 벽 손상 전 48시간 또는 72시간째 마취된 기니 피그의 경정맥에 주사하였다. 혈액을 약물 주사 시작 전 및 혈관 벽 손상 전에 108mM 시트르산 나트륨 용액(1:10 부피) 상에서 수집하였다.
출혈 시간 및 혈액 손실
발톱 큐티클 출혈 시간(NCBT: nail cuticle bleeding time)을 이전에 기재된 바와 같이 수행하였다(힘버(Himber J.) 등의 문헌[Thromb Haemost. (1997) 78:1142-1149]). NCBT를 동일한 동물에서 평가하였고, 여기서 기계적 손상에 의해 유도된 동맥 혈전증이 수반되었다. 마취된 기니 피그에서, 앞다리의 발톱 큐티클의 정점에서 발톱깎기로 표준 절단을 수행하고, 발을 37℃의 물 표면에 접촉시켜, 물로 혈액이 흘러들도록 하였다. 출혈 시간을 큐티클 가로절단 후 출혈이 완전히 중단될 때의 시간으로서 정의하였다. 2분 이내에 재출혈되는 경우, 출혈 시간을 초기 출혈 시간에 더하였다. 이러한 절차를 40분의 실험적 혈전증 기간 직후에 3중으로 동시에 수행하였다. 결과를 대조군 값에 대한 연장 배수로 표시하였다.
외과적 혈액 손실(SBL: surgical blood loss)을 NCBT 직후에 동일한 동물에서 측정하였다. 마취된 기니 피그를 복측으로 놓고, 목의 털을 깎고, 귀로부터 견갑골로 수술용 칼(애스컬랩 비비(AESCULAP BB) 524)에 의해 중앙 절개(길이 40 내지 50mm, 깊이 5mm)를 하였다. 절개 후 즉시, 상처에 길이방향으로 위치된 치과용 거즈 롤(N°1-14 111 00, Ø8mm, 길이 40mm, 인터내셔널 베르반드스토프 파브리크(Internationale Verbandstoff Fabrik), 스위스 너하우센 소재)로 혈액을 빨아들였다. 치과용 롤을 상처에 위치되기 5분 전후에 칭량하고, 무게의 차이를 5분당 혈액 손실(mg)로 정의하였다. 1시간 동안 평가된 혈액 손실은 1시간의 측정 기간내에 상처에 놓인 12개의 치과용 롤에 흡수된 혈액의 합과 상응한다.
후속적으로 펜토바비탈(pentobarbital)(100mg/kg)을 정맥주사하여 동물을 안락사시키고, 간을 신속히 제거하였다. 1 그램의 간을 이후 기재될 FVII mRNA의 결정을 위해 액체 질소에서 쇼크(shock) 동결하였다.
혈장 분석
상업용의 색소생산성 분석(바이오펜(BIOPHEN) FVII 키트; 조회 번호 221304, 하이펜 바이오메드(HYPHEN BioMed), 프랑스 소재)을 사용하여 기니 피그 혈장중 FVII 수준을 결정하였다. FVII 수준을 처리전 수준에 대한 퍼센트로 표시하였다. 인간 재조합 인간 조직 인자(다데 이노빈(Dade Innovin), 다데 베링(Dade Behring), 독일 마버그 소재)를 활성화제로 사용하여 응고 및 출혈 경향의 마커로서 사용되는 프로트롬빈 시간(PT)을 결정하고, 인지질을 활성화제(다데 액틴(Dade Actin), 다데 베링, 독일 마버그 소재)로서 사용하여 활성화된 부분 트롬보플라스틴 시간(aPTT: activated partial thromboplastin time)을 결정하였다. ACL3OOO plus 응고 시스템 애널라이저(Coagulation Systems Analyzer)를 사용하여 PT 및 aPTT를 측정하였고, 이를 처리전 값에 대한 연장 배수로 표시한다. 히타치(Hitachi) 912 오토매틱 애널라이저(Automatic Analyser)(베링거 만하임(Boehringer Mannheim), 독일 소재) 및 ALT 키트 n° 10851132216, AST(아새트(Asat)/고트(Got)) 키트 n° 10851124216(로슈 디애그노스틱스(Roche Diagnostics), 스위스 소재)을 사용하여 알라닌 아미노트랜스퍼라아제(ALT: alanin aminotransferase) 및 아스파테이트 아미노트랜스퍼라아제(AST: aspartate aminotransferase)를 측정하였다.
혈액 세포 계수, 혈소판 및 헤마토크릿(hematocrit)의 측정을 위해 혈액 샘플을 또한 EDTA내로 수집하였다(코바스 헬리오스(Cobas Helios) VET, 에프. 호프만-라 로슈(F. Hoffmann-La Roche), 스위스 바셀 소재).
dsRNA를 이전에 기재된 바와 같이 LNPO1에서 제형화하였다(아킨크(Akinc, A.) 등의 문헌[Nature Biotech 2008, 26(5):561-9.]). 또한, SNALP-L에 제형화된 dsRNA를 시험하였다(저지(Judge A.D.) 등의 문헌[J. Clinic . Invest. 2009, 119(3):661-73.]).
기니 피그 인자 VII 의 결정을 위한 bDNA 프로브의 서열
Figure pct00007
래트 GAPDH 의 결정을 위한 bDNA 프로브의 서열
Figure pct00008
기니 피그 간 조직에서의 FVII mRNA 측정
퀀티젠 1.0 분지형 DNA(bDNA) 분석 키트(파노믹스, 미국 캘리포니아주 프레몬트 소재, 품목 번호: QG0004)를 사용하여 간 조직으로부터 FVII mRNA 측정을 수행하였다.
검시할 때, 1 내지 2g의 간 조직을 액체 질소에서 스냅(snap) 동결하였다. 동결된 조직을 드라이 아이스 상에서 막자사발로 분말화하였다. 15 내지 25mg의 조직을 냉각된 1.5ml의 반응 튜브로 옮기고, 밀리큐 워터(MilliQ water)에 예비희석된 1ml의 1:3 용해 혼합물 및 3,3㎕의 프로테이나아제 K(50㎍/㎕)를 첨가하고 조직을 30 내지 50% 전력으로 수 초간의 초음파 분해에 의해 용해시켰다(HD2070, 반델린(Bandelin), 독일 베를린 소재). 용해물을 -80℃에서 분석할 때까지 저장하였다. mRNA 분석 용해물을 해동시키고 프로테이나아제 K를 1000 rpm 및 65℃에서 15분 동안 분해하였다(써모 믹서 컴포트(Thermo mixer comfort), 에펜도르프(Eppendorf), 독일 햄버그 소재). 퀀티젠 1.0 bDNA 분석 키트 시약을 사용하고 제조업체의 권고에 따라 FVII 및 GAPDH mRNA 수준을 결정하였다. 20㎕의 용해물 및 카비아 포르셀러스 FVII 프로브세트를 사용하여 FVII 발현을 분석하고, 40㎕의 용해물 및 기니 피그와 교차반응하는 것으로 보이는 래터스 노르베기커스 프로브세트(프로브세트의 서열은 아래를 참조함)를 사용하여 GAPDH 발현을 분석하였다. 분석 종료시 화학발광 신호를 빅토르2 라이트 발광 계수기(퍼킨 엘머, 독일 비스바덴 소재)에서 상대 광 유닛(RLU)으로서 측정하였다. FVII 신호를 동일한 용해물 GAPDH 신호로 나누고 값을 GAPDH로 정규화된 FVII 발현으로서 도시하였다.
예(도 1)로서, 서열 번호 쌍 259/260를 포함하는 FVII dsRNA 및 서열 번호 쌍 253/254를 포함하는 FVII dsRNA를 LNPO1 리포좀 제형[지질:dsRNA 비율(중량/중량) 14:1, 96% 포획, 80 내지 85nm 크기]중 4mg/kg으로 기니 피그 경정맥에 주사한 후 3일 및 5일에 걸쳐 FVII 혈장 수준의 시간 경과를 수행하였다. 최대 FVII 넉다운을 주사 후 24시간에 달성하였고 적어도 72시간 동안 지속되었다.
서열 번호 쌍 259/260/LNPO1(1:14)을 포함하는 FVII dsRNA를 기니 피그 동맥 혈전증 모델에서 1, 2, 3, 4, 5mg/kg으로, 단일 정맥내 투약로 시험하였다. 포스페이트 완충된 염수(PBS: phosphate buffered saline) 및 루시퍼라아제 dsRNA(서열 번호 쌍 411/412)/LNP01(1:14)을 대조표준으로서 사용하였다. 간중 FVII mRNA 수준(도 2a) 및 혈장중 FVII 자이모겐 수준(도 2b)은 투약량 의존적 방식으로 감소한 반면, PT는 그에 따라 연장되었다(도 3).
80%로 탁월한 혈장중 FVII 넉다운은 기니 피그 동맥 혈전증 모델에서 혈전 형성의 상당한 저해와 연관되었다. 관찰된 IC50은 서열 번호 쌍 259/260/LNPO1(1:14)을 포함하는 FVII dsRNA에 대해 1 내지 2mg/kg였다. 서열 번호 쌍 259/260 /LNPO1(1:14)을 포함하는 FVII dsRNA의 3, 4, 5mg/kg에서, 유사한 FVII 혈장 넉다운(약 95%) 및 간 mRNA 넉다운(약 80%)은 유사한 항혈전 효과와 연관되었다(혈전 형성의 약 90% 저해)(도 4).
▣ 1mg/kg은 간중 FVII mRNA의 56% 넉다운, 혈장중 FVII의 62% 넉다운을 유도하고, PT를 1.3배 연장시키고, 트롬빈 생성(피이크 높이)을 4% 저해하고, 혈전 형성을 약 26% 저해하였다.
▣ 2mg/kg은 간중 FVII mRNA의 73% 넉다운, 혈장중 FVII의 84% 넉다운을 유도하고, PT를 1.6배 연장시키고, 트롬빈 생성(피이크 높이)을 22% 저해하고, 혈전 형성을 약 62% 저해하였다.
▣ 3mg/kg은 간중 FVII mRNA의 81% 넉다운, 혈장중 FVII의 93% 넉다운을 유도하고, PT를 2.0배 연장시키고, 트롬빈 생성(피이크 높이)을 27% 저해하고, 혈전 형성을 약 82% 저해하였다.
▣ 4mg/kg은 간중 FVII mRNA의 80% 넉다운, 혈장중 FVII의 93% 넉다운을 유도하고, PT를 2.3배 연장시키고, 트롬빈 생성(피이크 높이)을 43% 저해하고, 혈전 형성을 약 91% 저해하였다.
▣ 5mg/kg은 간중 FVII mRNA의 80% 넉다운, 혈장중 FVII의 95% 넉다운을 유도하고, PT를 2.4배 연장시키고, 트롬빈 생성(피이크 높이)을 40% 저해하고, 혈전 형성을 약 92% 저해하였다.
발톱 큐티클 출혈 시간 및 외과적 혈액 손실에 의해 평가된 출혈은 시험된 FVII dsRNA 서열 번호 쌍 259/260/LNP01(1:14)의 투약량(1, 2, 3, 4, 5mg/kg)에서 크게 영향받지 않았고, 이는 정상적인 지혈이 혈장중 약 95% FVII 넉다운까지 유지되었음을 시사한다.
도 5는 서열 번호 쌍 259/260을 포함하는 FVII dsRNA가 SNALP-L중에서 제형화되었을 때의 간중 FVII mRNA 수준(도 5a) 및 혈장중 FVII 자이모겐 수준(도 5b)을 보여준다.
도 6은 SNALP-L 제형(siFVII)중 서열 번호 쌍 259/260을 포함하는 FVII dsRNA의 정맥주사 이후 기니 피그에서의 (a) 외과적 혈액 손실 및 (b) 발톱 큐티클 출혈 시간에 대한 FVII dsRNA의 효과를 보여준다.
도 7은 혈장중 FVII 활성 및 PT-연장 사이의 상관관계를 보여준다. FVII 활성은 FVII-의존성 응고 파라미터 PT와 상관관계가 있는 FVII dsRNA의 정맥주사 후에 감소한다(LNPO1 및 SNALP-L에서 제형화된 FVII dsRNA로부터 조합된 데이터).
FVII ( 마카카 파시큘라리스 ) 표적화 dsRNA 의 생체내 효과
하기 연구를 위해, 등장성 완충액중 지질 입자에서의 dsRNA의 멸균 제형("안정한 핵산-지질 입자"(SNALP: stable nucleic acid-lipid particles) 기법, 테크미라 파마슈티칼스 코포레이션(Tekmira Pharmaceuticals Corporation), 캐나다 소재)을 사용하였다.
원숭이(마카카 파시큘라리스)에서 단일 투약량 적정 연구
원숭이에게 0.3mg/kg 내지 10mg/kg 범위의 FVII dsRNA(서열 번호 19/20)를 단일 일시 정맥주사하였다. 대조군은 지질 입자에 의해 야기되는 효과 및 RNAi-중재된 효과를 구별하기 위해 10mg/kg의 고 투약량의 루시퍼라아제 dsRNA(서열 번호 411/412)를 수여받았다. 주사 후 48시간째 원숭이를 희생시켰다.
약리학적 효과를 혈장 및 간에서 모니터링하였다. FVII 활성 및 PT 값을 주사 후 24시간 및 48시간째 혈장에서 측정하였다. FVII mRNA 수준을 주사 후 48시간째 희생 시간에 간에서 측정하였다.
FVII dsRNA(서열 번호 19/20) 처리군은 1mg/kg의 dsRNA에서 약 50%의 FVII 활성에서의 투약량 의존성 감소를 나타내었고, 정맥주사 후 24시간 및 48시간째 3mg/kg의 FVII dsRNA(서열 번호 19/20)에서 FVII 활성이 >90% 감소하였다(도 8). 6mg/kg 및 10mg/kg의 투약량에서, FVII 활성의 감소는 3mg/kg의 FVII dsRNA(서열 번호 19/20)에서 보여진 감소와 유사하였다. PT 연장은 3mg/kg에서 출발하는 것으로 관찰되었다(도 9). PT에서의 추가의 연장은 투약량이 6mg/kg에서 10mg/kg으로 증가될 때 관찰되었다. PT 연장은 3mg/kg에서의 1.2배 내지 10mg/kg에서의 1.4배였다.
효과 기간 및 관련 투약량을 평가하기 위한 원숭이에서의 탐사 연구
FVII dsRNA(서열 번호 19/20)를 사용하여 수컷 사이노몰구스 원숭이에서 단일 투약량 및 반복 투약량을 연구하였다. 연구 목적은 FVII dsRNA(서열 번호 19/20)의 약리학적 효과의 기간 및 동력학에 대해 추가로 이해할 뿐만 아니라, 다중 투약량의 안전성 및 효능을 평가하는 것이다.
원숭이에게 FVII dsRNA(서열 번호 19/20)의 단일 또는 반복 투약량을 투약하였다. 단일 투약의 목적은 효과의 기간을 검사하는 것이었다. 단일 투약 군에서의 원숭이에게 3mg/kg 및 6mg/kg의 FVII dsRNA(서열 번호 19/20)를 일시 주사하였다. 6mg/kg의 루시퍼라아제 dsRNA(서열 번호 411/412) 군을 사용하여 dsRNA 서열 의존성 침묵에 대해 비교하고 지질 입자 관련된 효과를 평가하였다. 반복된 투약의 목적은 투약량 가성성(additivity)을 연구하고, 과도한 약리학에 기인한 지질 입자 독성 또는 잠재적 출혈 사건으로 규정되는 바와 같은, 최대 용인된 투약량을 확인하는 것이었다. 2개의 반복된 투약 군에서의 원숭이에게 FVII dsRNA(서열 번호 19/20)를 3mg/kg 및 10mg/kg으로 1주에 1번씩 3회 일시 주사하도록 계획을 세웠다.
상기 기재된 단일 투약 원숭이 연구에서의 발견에 대한 후속 조치로서, 3mg/kg의 루시퍼라아제 dsRNA(서열 번호 411/412) 암컷 원숭이 군을 포함시켜 더 낮은 투약량에서 지질 입자-중재된 효과를 추가로 특징화하였다. 약리학적 효과(FVII 활성 및 PT)를, 연구도중 다수의 시점에서 및 희생 시간에 취해진 혈장으로부터 모니터링하였다.
24시간 및 48시간째 FVII 활성에 대하여 컴파일링된(compiled) 데이터는 상기 기재된 단일 투약 연구로부터의 데이터와 유사하였다(도 10). FVII dsRNA(서열 번호 19/20)는 1mg/kg에서 약 50%로, 3, 6 및 10mg/kg 투약량에서 약 85% 내지 95%로 FVII 활성을 감소시켰다. 3 및 6mg/kg에서의 루시퍼라아제 dsRNA 대조군으로부터, dsRNA 지질 입자가 24시간째 FVII 활성에 일시적으로 비특이적 영향을 준 것이 확인되었다. 값은 48시간째 정상으로 돌아왔다. 따라서, 3 및 6mg/kg FVII dsRNA(서열 번호 19/20) 군에서 48시간째 보여진 활성은 FVII dsRNA의 약리학적 활성에 완전히 기인될 수 있다.
PT 값은 도 11에 제시된다. 1.2배의 PT 연장은 3mg/kg에서 관찰되었고, 10mg/kg에서 1.7배로 투약량 의존성 방식으로 증가하였다.
원숭이에서 약리학적 효과의 기간은 >1 개월에 걸쳐 수행된 혈장중 FVII 활성 수준으로부터의 외삽에 기초하여 약 6주였다(도 12). FVII 활성의 완전한 감소는 FVII 활성이 점진적으로 복원된 후 약 1주일 동안 지속되었다. 유사한 침묵 동력학을 3 및 6mg/kg에서 관찰하였고, 이로부터 디팟(depot) 효과가 없었고, 단순한 완전 FVII 활성 저해에 필요한 투약량 보다 더 높은 투약량으로 제공된 FVII dsRNA가 약리학적 효과를 연장시키는데 필수적이지 않았음을 알 수 있다.
PT 연장을 4주 동안 관찰하였는데, 처리 후 제1주에 가장 높은 값을 갖고 제2주 내지 제4주에 선형으로 감소하였다(도 13). 데이터로부터, FVII-의존성 생물마커에 대한 효과를 보기 위해 >70%의 FVII 활성 감소가 필요하였음을 알 수 있다.
매주 1회 간격으로 3mg/kg 씩의 다중 투약이 도 14에 제시되어 있다. 정상 상태 상황을 알아보고 과도한 효능 및 독물학적 영향을 방지하기 위해 제2 및 제3 투약 간의 간격을 1주에서 2주로 확장시켰다. FVII 활성 데이터로부터 정상 상태 간격에서 FVII 수준을 고정시킴이 실현가능하였음을 알 수 있다.
2주 또는 3주 간격으로 3mg/kg을 투약하는 것이 80% 내지 95% FVII 활성 감소를 유지하는데 최적인 것으로 나타났다. PT 값은 1.2 내지 1.8배 연장으로 유지될 수 있다.
2주 또는 3주 간격으로 3mg/kg을 투약하는 것이 80% 내지 95% FVII 활성 감소를 유지하는데 최적인 것으로 보여졌다. PT 값은 1.2 내지 1.8배 연장 간격으로 유지될 수 있고(도 15), 이때 표시된 PT 피이크는 주사 후 수 일을 지시한다. 이들 피이크는 FVII dsRNA의 약리학적 활성으로부터의 추가의 영향 및 지질 입자로부터의 비특이적인 영향에 기인한 것으로 보였다.
인간 FVII 표적화 dsRNA 의 시험관내 오프 -표적 분석
psiCHECK(등록상표)-벡터(프로메가(Promega))는 RNAi 활성을 모니터링하기 위한 2개의 리포터 유전자: 레닐라 루시퍼라아제(hRluc) 유전자의 합성 형태 및 합성 반딧불 루시퍼라아제 유전자(hluc+)를 포함한다. 반딧불 루시퍼라아제 유전자는 레닐라 루시퍼라아제 발현에서의 변화를 반딧불 루시퍼라아제 발현으로 정규화할 수 있게 한다. 듀얼-글로(Dual-Glo: 등록상표) 루시퍼라아제 분석 시스템(프로메가)을 사용하여 레닐라 및 반딧불 루시퍼라아제 활성을 측정하였다. 본 발명의 dsRNA의 오프-표적 효과 분석용 psiCHECK(등록상표) 벡터를 사용하기 위해, 예측된 오프-표적 서열을 합성 레닐라 루시퍼라아제 유전자 3' 위치 및 그의 번역 중지 코돈에 위치된 다중 클로닝 영역으로 클로닝하였다. 클로닝 후, 벡터를 포유동물 세포주내로 형질감염하고, 후속적으로 FVII 표적화 dsRNA로 공동 형질감염하였다. dsRNA가 예측된 오프-표적의 표적 RNA 상에서 RNAi 과정을 효과적으로 개시한다면, 융합된 레닐라 표적 유전자 mRNA 서열은 분해되어, 레닐라 루시퍼라아제 활성을 감소시킬 것이다.
컴퓨터모의실험 오프 -표적 예측
인간 게놈을 본 발명의 dsRNA에 상동성인 서열에 대해 컴퓨터 분석하여 조사하였다. 본 발명의 dsRNA와 5개 미만의 부정합을 나타내는 상동성 서열을 가능한 오프-표적으로서 정의하였다. 시험관내 오프-표적 분석으로 선택된 오프-표적은 첨부된 표 8, 9 및 10에 제공된다.
예측된 오프 -표적 서열을 포함하는 psiCHECK 벡터의 생성
siRNA 유도 후보에 대한 오프 표적 효과를 분석하기 위한 전략은 예측된 오프 표적 부위를 psiCHECK2 벡터 시스템(듀얼 글로(등록상표)-시스템, 프로메가, 독일 브라운슈바이그 소재, 품목 번호 C8021)에 XhoI 및 NotI 제한 부위를 통해 클로닝함을 포함한다. 따라서, 오프 표적 부위는 siRNA 표적 부위의 10개 뉴클레오티드 상류 및 하류에 의해 연장된다. 추가로, NheI 제한 부위를 조립하여 제한 분석에 의한 단편의 삽입을 보여준다. 단일 스트랜드 올리고뉴클레오티드를 표준 프로토콜(예를 들어 메타비온(Metabion)에 의한 프로토콜)에 따라 마스터사이클러(Mastercycler)(에펜도르프)에서 어닐링하고, 이어서 XhoI 및 NotI에 의해 미리 분해된 psiCHECK(프로메가)내로 클로닝하였다. NheI에 의한 제한 분석 및 후속적인 양성 클론의 서열화에 의해 성공적인 삽입을 확인하였다. 서열화를 위한 선택된 프라이머(서열 번호 761)는 벡터 psiCHECK의 1401 위치에 결합한다. 클론 생산 후, 플라스미드를 서열화로 분석한 다음 세포 배양 실험에 사용하였다.
dsRNA 오프 -표적 효과의 분석
세포 배양물:
Cos7 세포를 도이췌 샘렁 퓌어 미크로오르가니스멘 운트 첼쿨투렌(Deutsche Sammlung fur Mikroorganismen und Zellkulturen)(DSMZ, 독일 브라운슈바이그 소재, 품목 번호 ACC-60)으로부터 입수하고, 10% 소 태아 혈청(FCS)(바이오크롬 아게(Biochrom AG), 독일 베를린 소재, 품목 번호 SO115), 페니실린 100U/ml, 및 스트렙토마이신 100㎍/ml(바이오크롬 아게, 독일 베를린 소재, 품목 번호 A2213) 및 2mM L-글루타민(바이오크롬 아게, 독일 베를린 소재, 품목 번호 K0283) 뿐만 아니라 12㎍/ml 중탄산나트륨을 포함하도록 보충된 DMEM(바이오크롬 아게, 독일 베를린 소재, 품목 번호 F0435) 배지중에서 37℃에서 5% CO2의 분위기하에 습식 인큐베이터(헤라에우스 헤라셀, 켄드로 래보레이토리 프로덕츠, 독일 라겐셀볼트 소재)에서 배양하였다.
형질감염 및 루시퍼라아제 정량화:
플라스미드에 의한 형질감염을 위해, Cos-7 세포를 2.25 x 104 세포/웰 밀도로 96-웰 플레이트에 파종하고, 직접 형질감염하였다. 플라스미드의 형질감염을 50ng/웰의 농도로 제조업체에 의해 설명된 바와 같이 리포펙타민(lipofectamine) 2000(인비트로겐 게엠베하, 독일 칼스루헤 소재, 품목 번호 11668-019)으로 수행하였다. 형질감염 후 4시간째, 배지를 버리고 신선한 배지를 첨가하였다. 이제, siRNA를 50nM의 농도로 전술된 리포펙타민 2000으로 형질감염하였다. siRNA 형질감염 후 24시간째, 세포를 제조업체에 의해 설명된 루시퍼라아제 시약(듀얼-글로(등록상표) 루시퍼라아제 분석 시스템, 프로메가, 독일 만하임 소재, 품목 번호 E2980)으로 용해하였고, 반딧불 및 레닐라 루시퍼라아제를 제조업체의 프로토콜에 따라 정량화하였다. 레닐라 루시퍼라아제 단백질 수준을 반딧불 루시퍼라아제 수준으로 정규화하였다. 각각의 siRNA에 대해 12개의 개별 데이터포인트를 3가지 독립적인 실험에서 수집하였다. 모든 표적 부위에 연관되지 않은 siRNA를 대조표준으로 사용하여 siRNA 처리된 세포에서 상대적인 레닐라 루시퍼라아제 단백질 수준을 결정하였다.
결과는 도 16, 17 및 18에 제공된다.
[표 1a]
Figure pct00009
[표 1b]
Figure pct00010
[표 1c]
Figure pct00011
[표 1d]
Figure pct00012
[표 1e]
Figure pct00013
[표 1f]
Figure pct00014
[표 2]
Figure pct00015
[표 3]
Figure pct00016
[표 4a]
Figure pct00017
[표 4b]
Figure pct00018
[표 4c]
Figure pct00019
[표 5]
Figure pct00020
[표 6a]
Figure pct00021
[표 6b]
Figure pct00022
[표 6c]
Figure pct00023
[표 6d]
Figure pct00024
[표 6e]
Figure pct00025
[표 6f]
Figure pct00026
[표 7a]
Figure pct00027
[표 7b]
Figure pct00028
[표 7c]
Figure pct00029
[표 8]
Figure pct00030

[표 9]
Figure pct00031
[표 10]
Figure pct00032
<110> F. Hoffmann-La Roche AG <120> COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENES <130> 25413 <140> PCT/EP2009/064940 <141> 2009-11-10 <150> EP 08169301.2 <151> 2008-11-17 <160> 761 <210> 1 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 6, 12, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 1 uucugguucu uauccauuat t 21 <210> 2 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 2 uaauggauaa gaaccagaat t 21 <210> 3 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 11, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 3 gacacagaga uggaauagat t 21 <210> 4 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 4 ucuauuccau cucuguguct t 21 <210> 5 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 9, 10, 11, 12, 14, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 6, 7, 8, 13, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 5 gcaccaaauc ccauauauut t 21 <210> 6 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 6 aauauauggg auuuggugct t 21 <210> 7 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 9, 10, 11, 13, 14, 15, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 12, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 7 gaaaaauacc uauucuagat t 21 <210> 8 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 8, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 8 ucuagaauag guauuuuuct t 21 <210> 9 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 6, 11, 12, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 8, 9, 10, 13, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 9 aaagccaagg cugcgucgat t 21 <210> 10 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 10 ucgacgcagc cuuggcuuut t 21 <210> 11 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 7, 9, 11, 13, 15, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 8, 10, 12, 14, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 11 gagauaugca cacaccgaut t 21 <210> 12 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 12, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 12 aucggugugu gcauaucuct t 21 <210> 13 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 9, 10, 11, 13, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 12, 14, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 13 ugcaaaagcu caugcgcuct t 21 <210> 14 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 14 gagcgcauga gcuuuugcat t 21 <210> 15 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 10, 12, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 8, 9, 11, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 15 acacaucagu gcacacggat t 21 <210> 16 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 16 uccgugugca cugaugugut t 21 <210> 17 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 8, 10, 11, 12, 13, 14, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 7, 9, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 17 cuucgugcgc uucucauugt t 21 <210> 18 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 18 caaugagaag cgcacgaagt t 21 <210> 19 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 8, 10, 12, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 9, 11, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 19 agauaugcac acacacggat t 21 <210> 20 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 20 uccgugugug ugcauaucut t 21 <210> 21 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 8, 9, 10, 11, 12, 14, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 13, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 21 cgugcgcuuc ucauugguct t 21 <210> 22 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 22 gaccaaugag aagcgcacgt t 21 <210> 23 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 8, 11, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 7, 9, 10, 12, 13, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 23 agcuucacaa uaaacggcut t 21 <210> 24 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 24 agccguuuau ugugaagcut t 21 <210> 25 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 8, 9, 11, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 10, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 25 cccagcuuca caauaaacgt t 21 <210> 26 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 26 cguuuauugu gaagcugggt t 21 <210> 27 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 12, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 27 gacaguagag gcaugaacat t 21 <210> 28 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 28 uguucaugcc ucuacuguct t 21 <210> 29 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 9, 10, 12, 14, 15, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 7, 8, 11, 13, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 29 agccaaggcu gcgucgaact t 21 <210> 30 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 30 guucgacgca gccuuggcut t 21 <210> 31 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 11, 13, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 8, 9, 10, 12, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 31 gagucaggga cacacgcaut t 21 <210> 32 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 32 augcgugugu cccugacuct t 21 <210> 33 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 6, 8, 9, 11, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 7, 10, 12, 13, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 33 ccaaauauca cggaguacat t 21 <210> 34 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 34 uguacuccgu gauauuuggt t 21 <210> 35 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 6, 8, 10, 12, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 7, 9, 11, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 35 cgaugcacac gcacauagat t 21 <210> 36 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 36 ucuaugugcg ugugcaucgt t 21 <210> 37 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 8, 11, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 7, 9, 10, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 37 ccaugcaugg uggcgaaugt t 21 <210> 38 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 11, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 38 cauucgccac caugcauggt t 21 <210> 39 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 8, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 39 gugugaacga gaacggcggt t 21 <210> 40 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 40 ccgccguucu cguucacact t 21 <210> 41 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 10, 14, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 7, 8, 9, 11, 12, 13, 15 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 41 cugcccgaac ggacguucut t 21 <210> 42 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 42 agaacguccg uucgggcagt t 21 <210> 43 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 7, 8, 12, 13, 14, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 6, 9, 10, 11, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 43 cuggcaccaa aucccauaut t 21 <210> 44 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 44 auaugggauu uggugccagt t 21 <210> 45 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 8, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 7, 9, 10, 11, 12, 13, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 45 ggucacacag agauacgcat t 21 <210> 46 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 46 ugcguaucuc ugugugacct t 21 <210> 47 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 5, 7, 8, 9, 10, 11, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 6, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 47 cggacguucu cugagaggat t 21 <210> 48 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 48 uccucucaga gaacguccgt t 21 <210> 49 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 13, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 14, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 49 ugugcgcaca cacagauaut t 21 <210> 50 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 50 auaucugugu gugcgcacat t 21 <210> 51 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 13, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 51 gcgcacacac accgauguat t 21 <210> 52 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 52 uacaucggug ugugugcgct t 21 <210> 53 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 53 augugcgcac acacagauat t 21 <210> 54 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 54 uaucugugug ugcgcacaut t 21 <210> 55 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 7, 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 8, 9, 10, 11, 12, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 55 gucacacaga gauacgcaat t 21 <210> 56 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 56 uugcguaucu cugugugact t 21 <210> 57 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 6, 8, 10, 12, 14, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 5, 7, 9, 11, 13, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 57 gccaaugcac gcacacauct t 21 <210> 58 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 58 gaugugugcg ugcauuggct t 21 <210> 59 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 6, 8, 10, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 7, 9, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 59 ugaucugugu gaacgagaat t 21 <210> 60 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 11, 13, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 60 uucucguuca cacagaucat t 21 <210> 61 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 7, 9, 10, 12, 13, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 8, 11, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 61 gcggcccacu guuucgacat t 21 <210> 62 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 62 ugucgaaaca gugggccgct t 21 <210> 63 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 6, 8, 10, 12, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 7, 9, 11, 13, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 63 caaugcacgc acacaucagt t 21 <210> 64 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 64 cugaugugug cgugcauugt t 21 <210> 65 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 6, 9, 11, 13, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 7, 8, 10, 12, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 65 cacaccgaug ugcgcacact t 21 <210> 66 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 66 gugugcgcac aucggugugt t 21 <210> 67 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 8, 9, 10, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 7, 11, 12, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 67 gcgguuguuu agcucucact t 21 <210> 68 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 68 gugagagcua aacaaccgct t 21 <210> 69 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 7, 9, 12, 15, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 8, 10, 11, 13, 14, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 69 accaugcaug guggcgaaut t 21 <210> 70 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 10, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 70 auucgccacc augcauggut t 21 <210> 71 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 8, 10, 12, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 6, 7, 9, 11, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 71 acaucagugc acacggaugt t 21 <210> 72 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 72 cauccgugug cacugaugut t 21 <210> 73 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 8, 9, 10, 12, 15, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 6, 11, 13, 14, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 73 ucccagcuuc acaauaaact t 21 <210> 74 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 74 guuuauugug aagcugggat t 21 <210> 75 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 6, 7, 8, 10, 11, 13, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 9, 12, 14, 15 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 75 gagauuucau cauggucuct t 21 <210> 76 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 76 gagaccauga ugaaaucuct t 21 <210> 77 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 9, 10, 12, 13, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 11, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 77 gaaggcgguu guuuagcuct t 21 <210> 78 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 78 gagcuaaaca accgccuuct t 21 <210> 79 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 11, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 7, 8, 9, 10, 12, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 79 ccucugaagg cgguuguuut t 21 <210> 80 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 80 aaacaaccgc cuucagaggt t 21 <210> 81 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 10, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 81 cugugugaac gagaacggct t 21 <210> 82 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 82 gccguucucg uucacacagt t 21 <210> 83 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 5, 9, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 6, 7, 8, 10, 11, 12, 14 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 83 ugcccgaacg gacguucuct t 21 <210> 84 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 84 gagaacgucc guucgggcat t 21 <210> 85 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 6, 7, 11, 12, 13, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 8, 9, 10, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 85 uggcaccaaa ucccauauat t 21 <210> 86 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 86 uauaugggau uuggugccat t 21 <210> 87 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 10, 12, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 8, 9, 11, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 87 auacgcaaac acaccgaugt t 21 <210> 88 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 88 caucggugug uuugcguaut t 21 <210> 89 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 10, 11, 12, 13, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 89 cuguccucug aaggcgguut t 21 <210> 90 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 90 aaccgccuuc agaggacagt t 21 <210> 91 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 8, 10, 11, 12, 13, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 6, 7, 9, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 91 caccaagcgc uccugucggt t 21 <210> 92 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 92 ccgacaggag cgcuuggugt t 21 <210> 93 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 6, 7, 8, 10, 13, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 9, 11, 12, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 93 ccagcuucac aauaaacggt t 21 <210> 94 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 94 ccguuuauug ugaagcuggt t 21 <210> 95 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 8, 10, 12, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 6, 7, 9, 11, 13, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 95 augccaaugc acgcacacat t 21 <210> 96 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 96 ugugugcgug cauuggcaut t 21 <210> 97 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 8, 11, 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 9, 10, 12, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 97 cacacaucag ugcacacggt t 21 <210> 98 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 98 ccgugugcac ugaugugugt t 21 <210> 99 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 12, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 99 gucacggaag gugggagact t 21 <210> 100 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 100 gucucccacc uuccgugact t 21 <210> 101 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 10, 12, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 11, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 101 acacagagau acgcaaacat t 21 <210> 102 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 102 uguuugcgua ucucugugut t 21 <210> 103 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 10, 12, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 8, 9, 11, 13, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 103 acaugccaau gcacgcacat t 21 <210> 104 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 104 ugugcgugca uuggcaugut t 21 <210> 105 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 11, 12, 13, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 14, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 105 gcacguacgu cccgggcact t 21 <210> 106 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 106 gugcccggga cguacgugct t 21 <210> 107 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 8, 9, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 10, 11, 12, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 107 gggagugcca agguugucct t 21 <210> 108 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 108 ggacaaccuu ggcacuccct t 21 <210> 109 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 13, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 11, 12, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 109 uauacacaug gaugcacgct t 21 <210> 110 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 10, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 110 gcgugcaucc auguguauat t 21 <210> 111 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 13, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 8, 9, 10, 11, 12, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 111 guccucugaa ggcgguugut t 21 <210> 112 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 112 acaaccgccu ucagaggact t 21 <210> 113 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 6, 7, 9, 10, 11, 12, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 5, 8, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 113 gcccacuguu ucgacaaaat t 21 <210> 114 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 114 uuuugucgaa acagugggct t 21 <210> 115 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 11, 12, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 115 cacgcacaua gagauaugct t 21 <210> 116 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 116 gcauaucucu augugcgugt t 21 <210> 117 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 6, 8, 10, 11, 14, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 5, 7, 9, 12, 13, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 117 gccggcgcgc caacgcguut t 21 <210> 118 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 118 aacgcguugg cgcgccggct t 21 <210> 119 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 11, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 5, 6, 7, 8, 9, 10, 12, 13, 14, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 119 gcucagagag uggacucgat t 21 <210> 120 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 120 ucgaguccac ucucugagct t 21 <210> 121 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 11, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 6, 8, 9, 10, 12, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 121 ccucagcgag cacgacgggt t 21 <210> 122 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 122 cccgucgugc ucgcugaggt t 21 <210> 123 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 9, 10, 11, 12, 13, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 6, 8, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 123 uucgugcgcu ucucauuggt t 21 <210> 124 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 124 ccaaugagaa gcgcacgaat t 21 <210> 125 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 7, 12, 13, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 8, 9, 10, 11, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 125 gaaagccaag gcugcgucgt t 21 <210> 126 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 126 cgacgcagcc uuggcuuuct t 21 <210> 127 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 8, 9, 10, 13, 14, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 11, 12, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 127 gaccagcucc aguccuauat t 21 <210> 128 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 128 uauaggacug gagcugguct t 21 <210> 129 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 13, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 129 ugcgcacaca caccgaugut t 21 <210> 130 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 130 acaucggugu gugugcgcat t 21 <210> 131 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 7, 8, 9, 11, 12, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 10, 13, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 131 agagauuuca ucauggucut t 21 <210> 132 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 132 agaccaugau gaaaucucut t 21 <210> 133 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 5, 7, 8, 10, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 6, 9, 11, 12, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 133 caaauaucac ggaguacaut t 21 <210> 134 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 134 auguacuccg ugauauuugt t 21 <210> 135 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 11, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 12, 13, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 135 acgcacacau cagugcacat t 21 <210> 136 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 136 ugugcacuga ugugugcgut t 21 <210> 137 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 10, 11, 13, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 8, 9, 12, 14, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 137 caccaccaac cacgacauct t 21 <210> 138 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 138 gaugucgugg uugguggugt t 21 <210> 139 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 5, 6, 7, 10, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 8, 9, 11, 14 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 139 uggacucgau gccaucccut t 21 <210> 140 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 140 agggauggca ucgaguccat t 21 <210> 141 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 9, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 141 cucugccugc ccgaacggat t 21 <210> 142 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 142 uccguucggg caggcagagt t 21 <210> 143 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 8, 9, 12, 13, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 7, 10, 11, 14, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 143 uucugugccg gcuacucggt t 21 <210> 144 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 144 ccgaguagcc ggcacagaat t 21 <210> 145 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 10, 11, 12, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 13, 14, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 145 cacguacguc ccgggcacct t 21 <210> 146 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 146 ggugcccggg acguacgugt t 21 <210> 147 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 10, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 147 ccucugccug cccgaacggt t 21 <210> 148 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 148 ccguucgggc aggcagaggt t 21 <210> 149 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 10, 12, 14, 15, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 8, 9, 11, 13, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 149 gcgcgccaac gcguuccugt t 21 <210> 150 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 150 caggaacgcg uuggcgcgct t 21 <210> 151 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 7, 8, 10, 11, 12, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 6, 9, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 151 ggcccacugu uucgacaaat t 21 <210> 152 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 152 uuugucgaaa cagugggcct t 21 <210> 153 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 6, 7, 8, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 9, 10, 11, 12, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 153 agaucuucaa ggacgcggat t 21 <210> 154 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 154 uccgcguccu ugaagaucut t 21 <210> 155 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 155 auguauuucu cccuucgcut t 21 <210> 156 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 156 agcgaaggga gaaauacaut t 21 <210> 157 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 7, 9, 11, 13, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 6, 8, 10, 12, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 157 gauaugcaca caccgaugut t 21 <210> 158 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 158 acaucggugu gugcauauct t 21 <210> 159 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 9, 12, 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 7, 8, 10, 11, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 159 uacugcagug accacacggt t 21 <210> 160 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 160 ccgugugguc acugcaguat t 21 <210> 161 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 7, 8, 10, 12, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 6, 9, 11, 13, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 161 ccagggcugc gcaaccgugt t 21 <210> 162 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 162 cacgguugcg cagcccuggt t 21 <210> 163 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 6, 7, 9, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 8, 10, 14 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 163 caguccuaua ucugcuucut t 21 <210> 164 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 10, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 164 agaagcagau auaggacugt t 21 <210> 165 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 11, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 8, 9, 10, 12, 13, 14, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 165 ccugcccgaa cggacguuct t 21 <210> 166 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 166 gaacguccgu ucgggcaggt t 21 <210> 167 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 8, 10, 11, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 9, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 167 cacgcaucac uaaaugcaat t 21 <210> 168 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 168 uugcauuuag ugaugcgugt t 21 <210> 169 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 10, 13, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 11, 12, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 169 ugcacacacc gaugugcgct t 21 <210> 170 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 170 gcgcacaucg gugugugcat t 21 <210> 171 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 6, 8, 10, 12, 13, 14, 15, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 7, 9, 11, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 171 cagcacguac gucccgggct t 21 <210> 172 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 172 gcccgggacg uacgugcugt t 21 <210> 173 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 9, 10, 11, 13, 14, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 12, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 173 gugcgcuucu cauuggucat t 21 <210> 174 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 174 ugaccaauga gaagcgcact t 21 <210> 175 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 7, 9, 10, 11, 12, 13, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 8, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 175 aacggacguu cucugagagt t 21 <210> 176 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 176 cucucagaga acguccguut t 21 <210> 177 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 177 gaucuucaag gacgcggagt t 21 <210> 178 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 178 cuccgcgucc uugaagauct t 21 <210> 179 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 11, 12, 13, 14, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 8, 9, 10, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 179 ccauggcagg uccuguugut t 21 <210> 180 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 180 acaacaggac cugccauggt t 21 <210> 181 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 8, 9, 11, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 7, 10, 12, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 181 cuaugaacua cagccguggt t 21 <210> 182 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 10, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 182 ccacggcugu aguucauagt t 21 <210> 183 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 9, 11, 13, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 10, 12, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 183 uacgcaaaca caccgaugct t 21 <210> 184 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 184 gcaucggugu guuugcguat t 21 <210> 185 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 6, 7, 9, 11, 12, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 8, 10, 13, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 185 caaggcugcg ucgaacugut t 21 <210> 186 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 186 acaguucgac gcagccuugt t 21 <210> 187 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 8, 10, 12, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 9, 11, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 187 agauaugcac acaccgaugt t 21 <210> 188 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 188 caucggugug ugcauaucut t 21 <210> 189 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 11, 12, 14, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 8, 9, 10, 13, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 189 cugcgucgaa cuguccuggt t 21 <210> 190 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 7, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 190 ccaggacagu ucgacgcagt t 21 <210> 191 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 191 augcgcacac acaccgaugt t 21 <210> 192 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 192 caucggugug ugugcgcaut t 21 <210> 193 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 9, 10, 11, 15, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 8, 12, 13, 14, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 193 ucugccugcc cgaacggact t 21 <210> 194 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 12, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 194 guccguucgg gcaggcagat t 21 <210> 195 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 9, 13, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 7, 8, 10, 11, 12, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 195 gacuccggca agcacggcut t 21 <210> 196 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 196 agccgugcuu gccggaguct t 21 <210> 197 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 6, 9, 10, 11, 12, 13, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 197 gacgcuggcc uucgugcgct t 21 <210> 198 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 198 gcgcacgaag gccagcguct t 21 <210> 199 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 12, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 199 cgcacacaca ccgauguact t 21 <210> 200 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 200 guacaucggu gugugugcgt t 21 <210> 201 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 6, 7, 9, 10, 12, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 8, 11, 13, 14 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 201 agauuucauc auggucucct t 21 <210> 202 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 202 ggagaccaug augaaaucut t 21 <210> 203 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 6, 8, 10, 11, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 9, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 203 aaggcugcgu cgaacuguct t 21 <210> 204 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 204 gacaguucga cgcagccuut t 21 <210> 205 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 13, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 205 ugcgucuccu ccgcacacct t 21 <210> 206 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 206 ggugugcgga ggagacgcat t 21 <210> 207 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 7, 10, 11, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 8, 9, 12, 14 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 207 aauaaacggc ugcgucucct t 21 <210> 208 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 208 ggagacgcag ccguuuauut t 21 <210> 209 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 12, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 209 auaugcacac acacggaugt t 21 <210> 210 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 210 cauccgugug ugugcauaut t 21 <210> 211 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 8, 9, 11, 12, 13, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 10, 14, 15 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 211 aaggcgguug uuuagcucut t 21 <210> 212 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 212 agagcuaaac aaccgccuut t 21 <210> 213 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 9, 10, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 8, 11, 12, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 213 acgcaucacu aaaugcaagt t 21 <210> 214 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 214 cuugcauuua gugaugcgut t 21 <210> 215 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 8, 9, 10, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 7, 11, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 215 cugccugccc gaacggacgt t 21 <210> 216 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 13, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 216 cguccguucg ggcaggcagt t 21 <210> 217 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 6, 8, 9, 11, 12, 13, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 7, 10, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 217 cggcccacug uuucgacaat t 21 <210> 218 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 218 uugucgaaac agugggccgt t 21 <210> 219 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 6, 7, 9, 11, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 8, 10, 12, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 219 cagggcugcg caaccguggt t 21 <210> 220 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 220 ccacgguugc gcagcccugt t 21 <210> 221 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 7, 9, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 8, 10, 11, 12, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 221 uggucacaca gagauacgct t 21 <210> 222 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 222 gcguaucucu gugugaccat t 21 <210> 223 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 11, 13, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 9, 10, 12, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 223 cuccugucgg ugccacgagt t 21 <210> 224 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 224 cucguggcac cgacaggagt t 21 <210> 225 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 7, 8, 11, 12, 13, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 9, 10, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 225 caaggaccag cuccagucct t 21 <210> 226 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 226 ggacuggagc ugguccuugt t 21 <210> 227 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 11, 12, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 9, 10, 13, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 227 uucucauugg ucagcggcut t 21 <210> 228 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 228 agccgcugac caaugagaat t 21 <210> 229 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 6, 7, 8, 9, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 229 gagaucuuca aggacgcggt t 21 <210> 230 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 230 ccgcguccuu gaagaucuct t 21 <210> 231 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 11, 12, 13, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 14, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 231 agagagugga cucgaugcct t 21 <210> 232 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 232 ggcaucgagu ccacucucut t 21 <210> 233 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 8, 10, 12, 13, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 7, 9, 11, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 233 cucccaguac aucgaguggt t 21 <210> 234 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 234 ccacucgaug uacugggagt t 21 <210> 235 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 10, 12, 14, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 7, 8, 9, 11, 13, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 235 agucagggac acacgcauct t 21 <210> 236 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 236 gaugcgugug ucccugacut t 21 <210> 237 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 10, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 9, 11, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 237 ccaucccugc agggccguct t 21 <210> 238 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 238 gacggcccug cagggauggt t 21 <210> 239 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 9, 12, 13, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 8, 10, 11, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 239 agucuucgua acccaggagt t 21 <210> 240 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 240 cuccuggguu acgaagacut t 21 <210> 241 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 5, 7, 8, 9, 10, 11, 13, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 6, 12, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 241 caagcgcucc ugucggugct t 21 <210> 242 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 242 gcaccgacag gagcgcuugt t 21 <210> 243 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 9, 10, 13, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 8, 11, 12, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 243 gguccucacu gaccaugugt t 21 <210> 244 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 244 cacaugguca gugaggacct t 21 <210> 245 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 7, 9, 10, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 8, 11, 12, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 245 aggcugcguc gaacugucct t 21 <210> 246 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 246 ggacaguucg acgcagccut t 21 <210> 247 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 8, 10, 12, 13, 15, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 9, 11, 14, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 247 ggacacacgc aucacuaaat t 21 <210> 248 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 248 uuuagugaug cgugugucct t 21 <210> 249 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 7, 9, 11, 12, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 8, 10, 13, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 249 ugcacacaca ccgaugcugt t 21 <210> 250 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 250 cagcaucggu gugugugcat t 21 <210> 251 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 8, 12, 13, 14, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 5, 6, 7, 9, 10, 11, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 251 acugaaauga acccucacat t 21 <210> 252 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 252 ugugaggguu cauuucagut t 21 <210> 253 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 9, 11, 12, 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 7, 8, 10, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 253 caguugaaua uccauguggt t 21 <210> 254 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 10, 12, 13, 14, 17, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 7, 8, 9, 11, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 254 ccacauggau auucaacugt t 21 <210> 255 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 5, 8, 10, 11, 13, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 6, 7, 9, 12, 14, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 255 ugagcaguac ugcagugact t 21 <210> 256 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 6, 8, 11, 13, 14, 16, 17, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 7, 9, 10, 12, 15, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 256 gucacugcag uacugcucat t 21 <210> 257 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 9, 12, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 8, 10, 11, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 257 gcugugagca guacugcagt t 21 <210> 258 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 9, 10, 12, 13, 14, 16, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 8, 11, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 258 cugcaguacu gcucacagct t 21 <210> 259 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 10, 13, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 7, 8, 9, 11, 12, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 259 ggcugugagc aguacugcat t 21 <210> 260 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 260 ugcaguacug cucacagcct t 21 <210> 261 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 10, 13, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 7, 8, 9, 11, 12, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 261 ggcugugagc aguacugcat t 21 <210> 262 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 6, 8, 9, 11, 12, 13, 15, 18, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 7, 10, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 262 ugcaguacug cucacagcct t 21 <210> 263 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 6, 9, 11, 12, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 7, 8, 10, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 263 gugagcagua cugcagugat t 21 <210> 264 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 10, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 6, 8, 9, 11, 14, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 264 ucacugcagu acugcucact t 21 <210> 265 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 8, 9, 13, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 6, 7, 10, 11, 12, 14, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 265 cccacaguug aauauccaut t 21 <210> 266 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 6, 8, 9, 10, 13, 14, 16 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 7, 11, 12, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 266 auggauauuc aacugugggt t 21 <210> 267 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 8, 11, 13, 14, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 7, 9, 10, 12, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 267 cugugagcag uacugcagut t 21 <210> 268 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 8, 10, 11, 13, 14, 15, 17 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 9, 12, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 268 acugcaguac ugcucacagt t 21 <210> 269 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 12, 14, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 9, 10, 11, 13, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 269 ccacaguuga auauccaugt t 21 <210> 270 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 7, 9, 10, 11, 14, 15, 17 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 8, 12, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 270 cauggauauu caacuguggt t 21 <210> 271 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 9, 11, 13, 14, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 10, 12, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 271 acauguucug ugccggcuat t 21 <210> 272 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 10, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 272 uagccggcac agaacaugut t 21 <210> 273 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 10, 11, 12, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 9, 13, 14, 15, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 273 ucgaggaggc ccgggagaut t 21 <210> 274 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 11, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 8, 9, 10, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 274 aucucccggg ccuccucgat t 21 <210> 275 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 7, 9, 10, 12, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 8, 11, 13, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 275 gagcaguacu gcagugacct t 21 <210> 276 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 7, 9, 12, 14, 15, 17, 18, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 8, 10, 11, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 276 ggucacugca guacugcuct t 21 <210> 277 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 9, 12, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 8, 10, 11, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 277 gcugugagca guacugcagt t 21 <210> 278 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 7, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 278 cugcaguacu gcucacagct t 21 <210> 279 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 6, 7, 11, 13, 14, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 8, 9, 10, 12, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 279 cacaguugaa uauccaugut t 21 <210> 280 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 8, 10, 11, 12, 15, 16, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 9, 13, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 280 acauggauau ucaacugugt t 21 <210> 281 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 10, 12, 13, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 9, 11, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 281 cauguucugu gccggcuact t 21 <210> 282 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 9, 11, 16, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 7, 8, 10, 12, 13, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 282 guagccggca cagaacaugt t 21 <210> 283 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 9, 10, 11, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 283 cgaggaggcc cgggagauct t 21 <210> 284 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 9, 10, 11, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 284 gaucucccgg gccuccucgt t 21 <210> 285 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 10, 12, 13, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 9, 11, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 285 cauguucugu gccggcuact t 21 <210> 286 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 9, 11, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 286 guagccggca cagaacaugt t 21 <210> 287 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 8, 9, 13, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 6, 7, 10, 11, 12, 14, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 287 cccacaguug aauauccaut t 21 <210> 288 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 288 auggauauuc aacugugggt t 21 <210> 289 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 9, 11, 13, 14, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 10, 12, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 289 acauguucug ugccggcuat t 21 <210> 290 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 8, 10, 15, 17, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 7, 9, 11, 12, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 290 uagccggcac agaacaugut t 21 <210> 291 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 7, 10, 12, 13, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 8, 9, 11, 14, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 291 ugugagcagu acugcagugt t 21 <210> 292 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 9, 11, 12, 14, 15, 16, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 7, 8, 10, 13, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 292 cacugcagua cugcucacat t 21 <210> 293 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 9, 11, 12, 13, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 7, 8, 10, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 293 caguugaaua uccauguggt t 21 <210> 294 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 10, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 294 ccacauggau auucaacugt t 21 <210> 295 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 8, 10, 11, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 9, 12, 13, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 295 ggccagcugc uggaccgugt t 21 <210> 296 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 6, 7, 8, 11, 14, 15, 18, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 9, 10, 12, 13, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 296 cacgguccag cagcuggcct t 21 <210> 297 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 6, 7, 11, 13, 14, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 8, 9, 10, 12, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 297 cacaguugaa uauccaugut t 21 <210> 298 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 8, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 298 acauggauau ucaacugugt t 21 <210> 299 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 6, 9, 11, 12, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 7, 8, 10, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 299 gugagcagua cugcagugat t 21 <210> 300 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 7, 10, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 300 ucacugcagu acugcucact t 21 <210> 301 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 9, 11, 12, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 8, 10, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 301 auguucugug ccggcuacut t 21 <210> 302 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 10, 12, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 302 aguagccggc acagaacaut t 21 <210> 303 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 12, 14, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 9, 10, 11, 13, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 303 ccacaguuga auauccaugt t 21 <210> 304 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 7, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 304 cauggauauu caacuguggt t 21 <210> 305 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 10, 12, 13, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 7, 8, 9, 11, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 305 acaguugaau auccaugugt t 21 <210> 306 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 9, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 306 cacauggaua uucaacugut t 21 <210> 307 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 6, 7, 9, 11, 12, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 8, 10, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 307 auguucugug ccggcuacut t 21 <210> 308 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 7, 10, 12, 17, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 8, 9, 11, 13, 14, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 308 aguagccggc acagaacaut t 21 <210> 309 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 7, 8, 12, 13, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 9, 10, 11, 14, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 309 cagcugcugg accguggcgt t 21 <210> 310 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 11, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 310 cgccacgguc cagcagcugt t 21 <210> 311 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 8, 10, 11, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 9, 12, 13, 14, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 311 ggccagcugc uggaccgugt t 21 <210> 312 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 312 cacgguccag cagcuggcct t 21 <210> 313 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 10, 11, 12, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 9, 13, 14, 15, 16, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 313 ucgaggaggc ccgggagaut t 21 <210> 314 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 314 aucucccggg ccuccucgat t 21 <210> 315 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 6, 7, 9, 10, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 5, 8, 11, 12, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 315 gccagcugcu ggaccguggt t 21 <210> 316 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 9, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 316 ccacggucca gcagcuggct t 21 <210> 317 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 8, 9, 11, 12, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 10, 13, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 317 gggccagcug cuggaccgut t 21 <210> 318 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 318 acgguccagc agcuggccct t 21 <210> 319 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 11, 12, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 319 uucgaggagg cccgggagat t 21 <210> 320 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 320 ucucccgggc cuccucgaat t 21 <210> 321 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 7, 11, 12, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 8, 9, 10, 13, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 321 agcugcugga ccguggcgct t 21 <210> 322 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 7, 10, 11, 12, 15, 18, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 6, 8, 9, 13, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 322 gcgccacggu ccagcagcut t 21 <210> 323 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 7, 11, 12, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 8, 9, 10, 13, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 323 agcugcugga ccguggcgct t 21 <210> 324 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 12, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 324 gcgccacggu ccagcagcut t 21 <210> 325 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 7, 8, 12, 13, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 9, 10, 11, 14, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 325 cagcugcugg accguggcgt t 21 <210> 326 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 9, 10, 11, 14, 17, 18 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 7, 8, 12, 13, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 326 cgccacgguc cagcagcugt t 21 <210> 327 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 8, 9, 11, 12, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 10, 13, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 327 gggccagcug cuggaccgut t 21 <210> 328 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 7, 10, 13, 14, 17, 18, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 8, 9, 11, 12, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 328 acgguccagc agcuggccct t 21 <210> 329 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 11, 12, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 6, 7, 8, 9, 10, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 329 uucgaggagg cccgggagat t 21 <210> 330 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 7, 8, 9, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 330 ucucccgggc cuccucgaat t 21 <210> 331 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 9, 10, 11, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 331 cgaggaggcc cgggagauct t 21 <210> 332 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 332 gaucucccgg gccuccucgt t 21 <210> 333 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 6, 8, 9, 13, 14, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 7, 10, 11, 12, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 333 ccagcugcug gaccguggct t 21 <210> 334 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 10, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 334 gccacggucc agcagcuggt t 21 <210> 335 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 6, 7, 9, 10, 14, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 5, 8, 11, 12, 13, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 335 gccagcugcu ggaccguggt t 21 <210> 336 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 9, 12, 15, 16, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 10, 11, 13, 14, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 336 ccacggucca gcagcuggct t 21 <210> 337 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 6, 8, 9, 13, 14, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 7, 10, 11, 12, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 337 ccagcugcug gaccguggct t 21 <210> 338 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 8, 9, 10, 13, 16, 17 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 11, 12, 14, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 338 gccacggucc agcagcuggt t 21 <210> 339 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 9, 10, 12, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 6, 7, 8, 11, 13, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 339 cugcuggacc guggcgccat t 21 <210> 340 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 6, 7, 9, 12, 13, 14, 17 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 8, 10, 11, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 340 uggcgccacg guccagcagt t 21 <210> 341 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 6, 10, 12, 13, 14, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 7, 8, 9, 11, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 341 acaguugaau auccaugugt t 21 <210> 342 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 9, 11, 12, 13, 16, 17, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 6, 7, 8, 10, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 342 cacauggaua uucaacugut t 21 <210> 343 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 6, 10, 11, 13, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 7, 8, 9, 12, 14, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 343 gcugcuggac cguggcgcct t 21 <210> 344 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 6, 8, 11, 12, 13, 16, 19 <223> /mod_base = "2'-deoxy-2'-fluoro corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 7, 9, 10, 14, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 344 ggcgccacgg uccagcagct t 21 <210> 345 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 6, 10, 11, 13, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 7, 8, 9, 12, 14, 15, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 345 gcugcuggac cguggcgcct t 21 <210> 346 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 346 ggcgccacgg uccagcagct t 21 <210> 347 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 9, 10, 12, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 6, 7, 8, 11, 13, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 347 cugcuggacc guggcgccat t 21 <210> 348 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 348 uggcgccacg guccagcagt t 21 <210> 349 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 349 tcgggcaggc agagggtttt tgaagttacc gtttt 35 <210> 350 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 350 cgtcctctca gagaacgtcc gttttttctg agtcaaagca t 41 <210> 351 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 351 aagcgcacga aggccagttt ttctcttgga aagaaagt 38 <210> 352 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 352 ccagccgctg accaatgagt ttttctcttg gaaagaaagt 40 <210> 353 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 353 cggtccagca gctggccttt ttgaagttac cgtttt 36 <210> 354 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 354 gggccgtggc gccatttttc tgagtcaaag cat 33 <210> 355 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 355 cgttgaggac catgagctcc atttttctct tggaaagaaa gt 42 <210> 356 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 356 ggtcatcagc cggggca 17 <210> 357 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 357 gactgctgca ggcagtcctg 20 <210> 358 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 358 gggagtctcc caccttccgt tttttgaagt taccgtttt 39 <210> 359 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 359 cagaacatgt actccgtgat atttgttttt ctgagtcaaa gcat 44 <210> 360 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 360 ccatccgagt agccggcatt tttctcttgg aaagaaagt 39 <210> 361 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 361 ccttgcagga gtccttgctg tttttgaagt taccgtttt 39 <210> 362 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 362 gtgggcctcc actgtccctt tttctgagtc aaagcat 37 <210> 363 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 363 cccggtagtg ggtggcattt tttctcttgg aaagaaagt 39 <210> 364 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 364 cccgtcaggt accacgtgct ttttgaagtt accgtttt 38 <210> 365 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 365 tggccccagc tgacgatgtt tttctgagtc aaagcat 37 <210> 366 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 366 cacggttgcg cagccctttt tctcttggaa agaaagt 37 <210> 367 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 367 gtgtacaccc caaagtggcc tttttgaagt taccgtttt 39 <210> 368 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human Factor VII <400> 368 tcgatgtact gggagaccct gtttttctga gtcaaagcat 40 <210> 369 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 369 gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 <210> 370 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 370 ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 <210> 371 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 371 ccccagcctt ctccatggtt ttttctcttg gaaagaaagt 40 <210> 372 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 372 gctcccccct gcaaatgagt ttttctcttg gaaagaaagt 40 <210> 373 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 373 agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 <210> 374 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 374 gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 <210> 375 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 375 agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 <210> 376 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 376 gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 <210> 377 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 377 cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 <210> 378 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 378 ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 <210> 379 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for human GAPDH <400> 379 ggtgaagacg ccagtggact c 21 <210> 380 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 380 ggttcctcca tgcattccgt tttttctctt ggaaagaaag t 41 <210> 381 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 381 ggcctcctcg aatgtgcatt ttttctcttg gaaagaaagt 40 <210> 382 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 382 ggcaggtgcc tccgttcttt tttctcttgg aaagaaagt 39 <210> 383 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 383 ttcgggaggc agaagcagat ttttctcttg gaaagaaagt 40 <210> 384 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 384 cagttccggc cgctgaagtt tttctcttgg aaagaaagt 39 <210> 385 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 385 agtgcgctcc tgtttgtctc atttttctct tggaaagaaa gt 42 <210> 386 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 386 ggtggtcctg aggatctccc tttttaggca taggacccgt gtct 44 <210> 387 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 387 cccagaactg gttcgtcttc tctttttagg cataggaccc gtgtct 46 <210> 388 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 388 caccattctc attgtcacag atcagctttt taggcatagg acccgtgtct 50 <210> 389 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 389 gcgcgtgtct cccttgcgtt tttaggcata ggacccgtgt ct 42 <210> 390 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 390 gcgtggcacc ggcagatttt ttaggcatag gacccgtgtc t 41 <210> 391 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 391 tggtccccgt cagtatatga ag 22 <210> 392 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 392 ggcaagggtt tgaggcacac 20 <210> 393 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 393 tgtacagccg gaagtcgtct t 21 <210> 394 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for guinea pig FVII <400> 394 gtcactgcag tactgctcac agc 23 <210> 395 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 395 ccagcttccc attctcagcc tttttctctt ggaaagaaag t 41 <210> 396 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 396 tctcgctcct ggaagatggt tttttctctt ggaaagaaag t 41 <210> 397 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 397 cccatttgat gttagcggga tttttctctt ggaaagaaag t 41 <210> 398 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 398 cggagatgat gacccttttg gtttttctct tggaaagaaa gt 42 <210> 399 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 399 gatgggtttc ccgttgatga tttttaggca taggacccgt gtct 44 <210> 400 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 400 gacatactca gcaccagcat cactttttag gcataggacc cgtgtct 47 <210> 401 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 401 cccagccttc tccatggtgg tttttaggca taggacccgt gtct 44 <210> 402 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 402 ttgactgtgc cgttgaactt g 21 <210> 403 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 403 tgaagacgcc agtagactcc ac 22 <210> 404 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 404 ccccaccctt caggtgagc 19 <210> 405 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for rat GAPDH <400> 405 ggcatcagcg gaagggg 17 <210> 406 <211> 3075 <212> DNA <213> Homo sapiens <220> <223> cDNA sequence of human Factor VII, transcript variant 2 <300> <308> NM_019616.2 <309> 2008-10-12 <400> 406 agtcccatggggaatgtcaacaggcaggggcagcactgcagagatttcatcatggtctcc 60 caggccctcaggctcctctgccttctgcttgggcttcagggctgcctggctgcagtcttc 120 gtaacccaggaggaagcccacggcgtcctgcaccggcgccggcgcgccaacgcgttcctg 180 gaggagctgcggccgggctccctggagagggagtgcaaggaggagcagtgctccttcgag 240 gaggcccgggagatcttcaaggacgcggagaggacgaagctgttctggatttcttacagt 300 gatggggaccagtgtgcctcaagtccatgccagaatgggggctcctgcaaggaccagctc 360 cagtcctatatctgcttctgcctccctgccttcgagggccggaactgtgagacgcacaag 420 gatgaccagctgatctgtgtgaacgagaacggcggctgtgagcagtactgcagtgaccac 480 acgggcaccaagcgctcctgtcggtgccacgaggggtactctctgctggcagacggggtg 540 tcctgcacacccacagttgaatatccatgtggaaaaatacctattctagaaaaaagaaat 600 gccagcaaaccccaaggccgaattgtggggggcaaggtgtgccccaaaggggagtgtcca 660 tggcaggtcctgttgttggtgaatggagctcagttgtgtggggggaccctgatcaacacc 720 atctgggtggtctccgcggcccactgtttcgacaaaatcaagaactggaggaacctgatc 780 gcggtgctgggcgagcacgacctcagcgagcacgacggggatgagcagagccggcgggtg 840 gcgcaggtcatcatccccagcacgtacgtcccgggcaccaccaaccacgacatcgcgctg 900 ctccgcctgcaccagcccgtggtcctcactgaccatgtggtgcccctctgcctgcccgaa 960 cggacgttctctgagaggacgctggccttcgtgcgcttctcattggtcagcggctggggc 1020 cagctgctggaccgtggcgccacggccctggagctcatggtcctcaacgtgccccggctg 1080 atgacccaggactgcctgcagcagtcacggaaggtgggagactccccaaatatcacggag 1140 tacatgttctgtgccggctactcggatggcagcaaggactcctgcaagggggacagtgga 1200 ggcccacatgccacccactaccggggcacgtggtacctgacgggcatcgtcagctggggc 1260 cagggctgcgcaaccgtgggccactttggggtgtacaccagggtctcccagtacatcgag 1320 tggctgcaaaagctcatgcgctcagagccacgcccaggagtcctcctgcgagccccattt 1380 ccctagcccagcagccctggcctgtggagagaaagccaaggctgcgtcgaactgtcctgg 1440 caccaaatcccatatattcttctgcagttaatggggtagaggagggcatgggagggaggg 1500 agaggtggggagggagacagagacagaaacagagagagacagagacagagagagactgag 1560 ggagagactctgaggacatggagagagactcaaagagactccaagattcaaagagactaa 1620 tagagacacagagatggaatagaaaagatgagaggcagaggcagacaggcgctggacaga 1680 ggggcaggggagtgccaaggttgtcctggaggcagacagcccagctgagcctccttacct 1740 cccttcagccaagcccacctgcacgtgatctgctggcctcaggctgctgctctgccttca 1800 ttgctggagacagtagaggcatgaacacacatggatgcacacacacacacgccaatgcac 1860 acacacagagatatgcacacacacggatgcacacacagatggtcacacagagatacgcaa 1920 acacaccgatgcacacgcacatagagatatgcacacacagatgcacacacagatatacac 1980 atggatgcacgcacatgccaatgcacgcacacatcagtgcacacggatgcacagagatat 2040 gcacacaccgatgtgcgcacacacagatatgcacacacatggatgagcacacacacacca 2100 atgcgcacacacaccgatgtacacacacagatgcacacacagatgcacacacaccgatgc 2160 tgactccatgtgtgctgtcctctgaaggcggttgtttagctctcacttttctggttctta 2220 tccattatcatcttcacttcagacaattcagaagcatcaccatgcatggtggcgaatgcc 2280 cccaaactctcccccaaatgtatttctcccttcgctgggtgccgggctgcacagactatt 2340 ccccacctgcttcccagcttcacaataaacggctgcgtctcctccgcacacctgtggtgc 2400 ctgccacccactgggttgcccatgattcatttttggagcccccggtgctcatcctctgag 2460 atgctcttttctttcacaattttcaacatcactgaaatgaaccctcacatggaagctatt 2520 ttttaaaaacaaaagctgtttgatagatgtttgaggctgtagctcccaggatcctgtgga 2580 attggatgttctctccctgccacagcccttgtcaatgatatttcacagagaccctgggag 2640 cacctgctcaagagtcagggacacacgcatcactaaatgcaagttcccaggccctggctg 2700 cagtgggaggacctggcaagctgcactcttgctgagtccccagggtggtggaagaagaat 2760 gagaaacacatgaacagagaaatggggaggtgacaaacagtgcccccactcagactccgg 2820 caagcacggctcagagagtggactcgatgccatccctgcagggccgtcctgggcaccact 2880 ggcactcacagcagcaaggtgggcaccattggcactcacagcagcaaggcaggcaccagc 2940 aacccacctcgggggcactcaggcatcatctacttcagagcagacagggtctatgaacta 3000 cagccgtgggctgcttccaaggcaccctgctcttgtaaataaagttttatgggaacacaa 3060 aaaaaaaaaaaaaaa 3075 <210> 407 <211> 3141 <212> DNA <213> Homo sapiens <220> <223> cDNA sequence of human Factor VII, transcript variant 1 <300> <308> NM_000131.3 <309> 2008-10-12 <400> 407 agtcccatggggaatgtcaacaggcaggggcagcactgcagagatttcatcatggtctcc 60 caggccctcaggctcctctgccttctgcttgggcttcagggctgcctggctgcaggcggg 120 gtcgctaaggcctcaggaggagaaacacgggacatgccgtggaagccggggcctcacaga 180 gtcttcgtaacccaggaggaagcccacggcgtcctgcaccggcgccggcgcgccaacgcg 240 ttcctggaggagctgcggccgggctccctggagagggagtgcaaggaggagcagtgctcc 300 ttcgaggaggcccgggagatcttcaaggacgcggagaggacgaagctgttctggatttct 360 tacagtgatggggaccagtgtgcctcaagtccatgccagaatgggggctcctgcaaggac 420 cagctccagtcctatatctgcttctgcctccctgccttcgagggccggaactgtgagacg 480 cacaaggatgaccagctgatctgtgtgaacgagaacggcggctgtgagcagtactgcagt 540 gaccacacgggcaccaagcgctcctgtcggtgccacgaggggtactctctgctggcagac 600 ggggtgtcctgcacacccacagttgaatatccatgtggaaaaatacctattctagaaaaa 660 agaaatgccagcaaaccccaaggccgaattgtggggggcaaggtgtgccccaaaggggag 720 tgtccatggcaggtcctgttgttggtgaatggagctcagttgtgtggggggaccctgatc 780 aacaccatctgggtggtctccgcggcccactgtttcgacaaaatcaagaactggaggaac 840 ctgatcgcggtgctgggcgagcacgacctcagcgagcacgacggggatgagcagagccgg 900 cgggtggcgcaggtcatcatccccagcacgtacgtcccgggcaccaccaaccacgacatc 960 gcgctgctccgcctgcaccagcccgtggtcctcactgaccatgtggtgcccctctgcctg 1020 cccgaacggacgttctctgagaggacgctggccttcgtgcgcttctcattggtcagcggc 1080 tggggccagctgctggaccgtggcgccacggccctggagctcatggtcctcaacgtgccc 1140 cggctgatgacccaggactgcctgcagcagtcacggaaggtgggagactccccaaatatc 1200 acggagtacatgttctgtgccggctactcggatggcagcaaggactcctgcaagggggac 1260 agtggaggcccacatgccacccactaccggggcacgtggtacctgacgggcatcgtcagc 1320 tggggccagggctgcgcaaccgtgggccactttggggtgtacaccagggtctcccagtac 1380 atcgagtggctgcaaaagctcatgcgctcagagccacgcccaggagtcctcctgcgagcc 1440 ccatttccctagcccagcagccctggcctgtggagagaaagccaaggctgcgtcgaactg 1500 tcctggcaccaaatcccatatattcttctgcagttaatggggtagaggagggcatgggag 1560 ggagggagaggtggggagggagacagagacagaaacagagagagacagagacagagagag 1620 actgagggagagactctgaggacatggagagagactcaaagagactccaagattcaaaga 1680 gactaatagagacacagagatggaatagaaaagatgagaggcagaggcagacaggcgctg 1740 gacagaggggcaggggagtgccaaggttgtcctggaggcagacagcccagctgagcctcc 1800 ttacctcccttcagccaagcccacctgcacgtgatctgctggcctcaggctgctgctctg 1860 ccttcattgctggagacagtagaggcatgaacacacatggatgcacacacacacacgcca 1920 atgcacacacacagagatatgcacacacacggatgcacacacagatggtcacacagagat 1980 acgcaaacacaccgatgcacacgcacatagagatatgcacacacagatgcacacacagat 2040 atacacatggatgcacgcacatgccaatgcacgcacacatcagtgcacacggatgcacag 2100 agatatgcacacaccgatgtgcgcacacacagatatgcacacacatggatgagcacacac 2160 acaccaatgcgcacacacaccgatgtacacacacagatgcacacacagatgcacacacac 2220 cgatgctgactccatgtgtgctgtcctctgaaggcggttgtttagctctcacttttctgg 2280 ttcttatccattatcatcttcacttcagacaattcagaagcatcaccatgcatggtggcg 2340 aatgcccccaaactctcccccaaatgtatttctcccttcgctgggtgccgggctgcacag 2400 actattccccacctgcttcccagcttcacaataaacggctgcgtctcctccgcacacctg 2460 tggtgcctgccacccactgggttgcccatgattcatttttggagcccccggtgctcatcc 2520 tctgagatgctcttttctttcacaattttcaacatcactgaaatgaaccctcacatggaa 2580 gctattttttaaaaacaaaagctgtttgatagatgtttgaggctgtagctcccaggatcc 2640 tgtggaattggatgttctctccctgccacagcccttgtcaatgatatttcacagagaccc 2700 tgggagcacctgctcaagagtcagggacacacgcatcactaaatgcaagttcccaggccc 2760 tggctgcagtgggaggacctggcaagctgcactcttgctgagtccccagggtggtggaag 2820 aagaatgagaaacacatgaacagagaaatggggaggtgacaaacagtgcccccactcaga 2880 ctccggcaagcacggctcagagagtggactcgatgccatccctgcagggccgtcctgggc 2940 accactggcactcacagcagcaaggtgggcaccattggcactcacagcagcaaggcaggc 3000 accagcaacccacctcgggggcactcaggcatcatctacttcagagcagacagggtctat 3060 gaactacagccgtgggctgcttccaaggcaccctgctcttgtaaataaagttttatggga 3120 acacaaaaaaaaaaaaaaaaa 3141 <210> 408 <211> 751 <212> DNA <213> Macaca fascicularis <220> <223> cDNA sequence of cynomolgus monkey (Macaca fascicularis) Factor VII (partial) <300> <308> BB885059.1 <309> 2008-04-14 <400> 408 tttccccccgggactaagttccataaaccgcgatgggggtgcagctctaaaatcgtgaag 60 ttgggaagccggtggggatcggcctatgcagcccggcacatttgggggagagtttggggc 120 atttgccaacatgcatggtgatgcttctgaattgtctgaaatgaagatgataatggataa 180 gaacgaggaaagtgagagctaaacaaccgcctttggaggacagcacacatggagtcagca 240 tcggtgtgtgtgcatccgtgtgtgcatatctgtgtgtgtacattggtgtgtgtgcactca 300 tccatgtgtgtgcatatctgtgtgcatctgtgtgtgtgcatatctgtgtatgtgcacatc 360 ggtgtgtgcatatctctctgcatccgtgtgggtgcattagtgtgtgtgtgcattggtgtg 420 gtgtgcacgcatccgtgtgtgcgcatatctctgtatgtgtgtgtgtcagtgtgtttgcat 480 atctctgtgtgaccctctgtgtgtgcatccgtgtgtgtgcatatctctgtgtgtgtgcat 540 tggtgtgtgtgtatgcatccacgtgtgtacatgcctctagtgtctccagcaatgaaggca 600 gaagaatcgatgggattttgtgccagaacagttctacacagccttggctttctctccagg 660 ggcagggctgctagctagggaaatggggctcgcagaagacgcctgggcgtggctctgagt 720 gcatgagcttttgcagccactcgatgtactt 751 <210> 409 <211> 1508 <212> DNA <213> Macaca fascicularis <220> <223> cDNA sequence of cynomolgus monkey (Macaca fascicularis) Factor VII <400> 409 atgctcgagcggccgccagtgtgatggatatctgcagaattcgcccttggaatgtcaaca 60 ggcagaggcagcgctgcagagatttcatcatggtctctcgagccctcgggctcctctgcc 120 ttctgcttgggcttcagggctgtctggctgcagccaccttcctgccccaggcggggtcgc 180 tgaggcctcaggaggagaaaacacaggacctgctgtggaagccagggcctcacagagtct 240 tcgtaacccaggaggaagcccatggcgtcctgcacaggcagcggcgcgccaactcgttcc 300 tggaggagctgcggccgggctccctggagagggagtgcaaggaggagcaatgctccttcg 360 aggaggcccgggagatcttcaaggacctggagaggacgaagctgttctggatttcttaca 420 gtgatggggaccagtgtgcctcaaatccgtgccagaatgggggctcctgcaaggaccagc 480 tccagtcctatatctgcttctgcctcccttccttcgagggccggaactgtgagaagaaca 540 aggacgaccagctgatctgcgtgaacgagaacggcggctgtgagcagtactgcagtgacc 600 acgcgggtgccaagcgctcctgttggtgccacgaggggtactcgctgctggcagacgggg 660 tgtcctgcatgcccacagttgaatatccatgtggaaaaatacctattctggaaaaaagaa 720 atgccagcaaaccccaaggccgaattgtcgggggcagggtgtgccccaaaggggagtgtc 780 catggcaggtcctgttgttggtgaatggagctcagctgtgtggagggaccctgataaaca 840 ccatctgggtggtctctgcggcccactgtttcgacaaaatcaagagctggaggaacttga 900 ccgcggtgctgggcgagcacgacctcagcgagcacgaaggggatgagcagagccggcggg 960 tggcgcaggtcatcatccccagcacgtatgtcctgggcgccaccaaccacgacatcgcgc 1020 tgctccgcctgcagcagcccgtggtcctcactgaccatgtggtgcccctctgcctgcccg 1080 aacggacgttctccgagaggacgctggccttcgtgcgcttctcgttggtcagcggctggg 1140 gtcagctgctggaccgtggtgccacagccctggagctcatggccctcaacgtgccccggc 1200 tgatgacccaggactgcctgcagcagtcacggaaggcggaagcctccccgaatatcacgg 1260 agtacatgttctgtgccggctactcggacggcagcagggactcctgcaagggggacagtg 1320 gaggcccacacgccacccgctaccggggcacgtggtacctgacaggcatcgtcagctggg 1380 gccagggctgcgcggccgtgggccacttcggggtgtacaccagggtctcccagtacatcg 1440 agtggctgcaaaagctcatgcactcagagccacgcccaggcgtcctcctgcgagccccat 1500 ttccctag 1508 <210> 410 <211> 1242 <212> DNA <213> Cavia porcellus <220> <223> cDNA sequence of guinea pig (Cavia porcellus) Factor VII <300> <308> ENSCPOT00000005353 ENSEMBL <400> 410 ggcgtgctgcgcaggcagaggcgtgccaactcctttctggaggagctgtggccaggctcc 60 ttggagacggaatgcatggaggaaccatgcacattcgaggaggcccgggagatcctcagg 120 accaccgagaagacgaaccagttctgggcttcatatactgacggggaccagtgtgcctca 180 aacccttgccagaacggaggcacctgccaagacgacttccggctgtacatctgcttctgc 240 ctcccgaacttcagcggccggaactgtgagacaaacaggagcgcactgctgatctgtgac 300 aatgagaatggtggctgtgagcagtactgcagtgaccgcaagggagacacgcgcatctgc 360 cggtgccacgcggggtacactctgcagccggaccaagtatcctgcatgcccacagttgaa 420 tatccatgtgggaaaataccagttctggaaaaaaggaaggacagcaacatccaaggccga 480 attgtgggaggccagaagtgtcccagaggggagtgtccatggcaggccatcctgatgttc 540 aatggggcaccactgtgtgggggctccctgctggagactggctgggtggtgtctgctgcc 600 cactgcttcgacaagcttcagagcttgaggaacctgtctgtggtgctgggtgagcatgac 660 ctcagcgaggttgatggcactgagcaggtgcgaaaggtgacacaagtcatcttcccggac 720 acatatgtccggggccagaaagaccacgacatcgtgctcttgcggctgcagcggcccgta 780 aacctcacggactatgtggtgcctctctgcctacccgagacggccttcgcacagggcaca 840 ctggccaaaatccgcttctcccgtgtcagtggttggggccagctgctggaccgtggcgcc 900 atggctgtggagctcatggccattgaggtgccacggctgatgaaccaggactgcctggaa 960 cagactcagaggacaaacagctcgccagtgatcaccaaaaacatgttctgtgccggctac 1020 ttggacggcaccaaggacgcctgcaaaggggacagtgggggcccacacgccacgcagttc 1080 cgtggcacgtggtacctgacaggtgtggtgagctggggtgaaggctgtgcggccgtgggc 1140 cagctgggcgtctacaccagggtggcccgctacatcgagtggctgcgcaggctcatgcgc 1200 tcccagccggggcgcagtgtcctgcgggccccgctcctctag 1242 <210> 411 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 7, 8, 12, 14, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 6, 9, 10, 11, 13, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 411 cuuacgcuga guacuucgat t 21 <210> 412 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 11, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 412 ucgaaguacu cagcguaagt t 21 <210> 413 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 413 uucugguucu uauccauuat t 21 <210> 414 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 414 uaauggauaa gaaccagaat t 21 <210> 415 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 415 gacacagaga uggaauagat t 21 <210> 416 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 416 ucuauuccau cucuguguct t 21 <210> 417 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 417 gcaccaaauc ccauauauut t 21 <210> 418 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 418 aauauauggg auuuggugct t 21 <210> 419 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 419 gaaaaauacc uauucuagat t 21 <210> 420 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 420 ucuagaauag guauuuuuct t 21 <210> 421 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 421 aaagccaagg cugcgucgat t 21 <210> 422 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 422 ucgacgcagc cuuggcuuut t 21 <210> 423 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 423 gagauaugca cacaccgaut t 21 <210> 424 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 424 aucggugugu gcauaucuct t 21 <210> 425 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 425 ugcaaaagcu caugcgcuct t 21 <210> 426 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 426 gagcgcauga gcuuuugcat t 21 <210> 427 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 427 acacaucagu gcacacggat t 21 <210> 428 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 428 uccgugugca cugaugugut t 21 <210> 429 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 429 cuucgugcgc uucucauugt t 21 <210> 430 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 430 caaugagaag cgcacgaagt t 21 <210> 431 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 431 agauaugcac acacacggat t 21 <210> 432 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 432 uccgugugug ugcauaucut t 21 <210> 433 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 433 cgugcgcuuc ucauugguct t 21 <210> 434 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 434 gaccaaugag aagcgcacgt t 21 <210> 435 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 435 agcuucacaa uaaacggcut t 21 <210> 436 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 436 agccguuuau ugugaagcut t 21 <210> 437 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 437 cccagcuuca caauaaacgt t 21 <210> 438 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 438 cguuuauugu gaagcugggt t 21 <210> 439 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 439 gacaguagag gcaugaacat t 21 <210> 440 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 440 uguucaugcc ucuacuguct t 21 <210> 441 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 441 agccaaggcu gcgucgaact t 21 <210> 442 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 442 guucgacgca gccuuggcut t 21 <210> 443 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 443 gagucaggga cacacgcaut t 21 <210> 444 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 444 augcgugugu cccugacuct t 21 <210> 445 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 445 ccaaauauca cggaguacat t 21 <210> 446 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 446 uguacuccgu gauauuuggt t 21 <210> 447 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 447 cgaugcacac gcacauagat t 21 <210> 448 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 448 ucuaugugcg ugugcaucgt t 21 <210> 449 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 449 ccaugcaugg uggcgaaugt t 21 <210> 450 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 450 cauucgccac caugcauggt t 21 <210> 451 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 451 gugugaacga gaacggcggt t 21 <210> 452 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 452 ccgccguucu cguucacact t 21 <210> 453 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 453 cugcccgaac ggacguucut t 21 <210> 454 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 454 agaacguccg uucgggcagt t 21 <210> 455 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 455 cuggcaccaa aucccauaut t 21 <210> 456 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 456 auaugggauu uggugccagt t 21 <210> 457 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 457 ggucacacag agauacgcat t 21 <210> 458 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 458 ugcguaucuc ugugugacct t 21 <210> 459 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 459 cggacguucu cugagaggat t 21 <210> 460 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 460 uccucucaga gaacguccgt t 21 <210> 461 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 461 ugugcgcaca cacagauaut t 21 <210> 462 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 462 auaucugugu gugcgcacat t 21 <210> 463 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 463 gcgcacacac accgauguat t 21 <210> 464 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 464 uacaucggug ugugugcgct t 21 <210> 465 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 465 augugcgcac acacagauat t 21 <210> 466 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 466 uaucugugug ugcgcacaut t 21 <210> 467 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 467 gucacacaga gauacgcaat t 21 <210> 468 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 468 uugcguaucu cugugugact t 21 <210> 469 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 469 gccaaugcac gcacacauct t 21 <210> 470 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 470 gaugugugcg ugcauuggct t 21 <210> 471 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 471 ugaucugugu gaacgagaat t 21 <210> 472 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 472 uucucguuca cacagaucat t 21 <210> 473 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 473 gcggcccacu guuucgacat t 21 <210> 474 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 474 ugucgaaaca gugggccgct t 21 <210> 475 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 475 caaugcacgc acacaucagt t 21 <210> 476 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 476 cugaugugug cgugcauugt t 21 <210> 477 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 477 cacaccgaug ugcgcacact t 21 <210> 478 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 478 gugugcgcac aucggugugt t 21 <210> 479 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 479 gcgguuguuu agcucucact t 21 <210> 480 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 480 gugagagcua aacaaccgct t 21 <210> 481 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 481 accaugcaug guggcgaaut t 21 <210> 482 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 482 auucgccacc augcauggut t 21 <210> 483 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 483 acaucagugc acacggaugt t 21 <210> 484 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 484 cauccgugug cacugaugut t 21 <210> 485 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 485 ucccagcuuc acaauaaact t 21 <210> 486 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 486 guuuauugug aagcugggat t 21 <210> 487 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 487 gagauuucau cauggucuct t 21 <210> 488 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 488 gagaccauga ugaaaucuct t 21 <210> 489 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 489 gaaggcgguu guuuagcuct t 21 <210> 490 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 490 gagcuaaaca accgccuuct t 21 <210> 491 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 491 ccucugaagg cgguuguuut t 21 <210> 492 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 492 aaacaaccgc cuucagaggt t 21 <210> 493 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 493 cugugugaac gagaacggct t 21 <210> 494 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 494 gccguucucg uucacacagt t 21 <210> 495 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 495 ugcccgaacg gacguucuct t 21 <210> 496 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 496 gagaacgucc guucgggcat t 21 <210> 497 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 497 uggcaccaaa ucccauauat t 21 <210> 498 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 498 uauaugggau uuggugccat t 21 <210> 499 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 499 auacgcaaac acaccgaugt t 21 <210> 500 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 500 caucggugug uuugcguaut t 21 <210> 501 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 501 cuguccucug aaggcgguut t 21 <210> 502 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 502 aaccgccuuc agaggacagt t 21 <210> 503 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 503 caccaagcgc uccugucggt t 21 <210> 504 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 504 ccgacaggag cgcuuggugt t 21 <210> 505 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 505 ccagcuucac aauaaacggt t 21 <210> 506 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 506 ccguuuauug ugaagcuggt t 21 <210> 507 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 507 augccaaugc acgcacacat t 21 <210> 508 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 508 ugugugcgug cauuggcaut t 21 <210> 509 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 509 cacacaucag ugcacacggt t 21 <210> 510 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 510 ccgugugcac ugaugugugt t 21 <210> 511 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 511 gucacggaag gugggagact t 21 <210> 512 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 512 gucucccacc uuccgugact t 21 <210> 513 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 513 acacagagau acgcaaacat t 21 <210> 514 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 514 uguuugcgua ucucugugut t 21 <210> 515 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 515 acaugccaau gcacgcacat t 21 <210> 516 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 516 ugugcgugca uuggcaugut t 21 <210> 517 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 517 gcacguacgu cccgggcact t 21 <210> 518 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 518 gugcccggga cguacgugct t 21 <210> 519 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 519 gggagugcca agguugucct t 21 <210> 520 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 520 ggacaaccuu ggcacuccct t 21 <210> 521 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 521 uauacacaug gaugcacgct t 21 <210> 522 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 522 gcgugcaucc auguguauat t 21 <210> 523 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 523 guccucugaa ggcgguugut t 21 <210> 524 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 524 acaaccgccu ucagaggact t 21 <210> 525 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 525 gcccacuguu ucgacaaaat t 21 <210> 526 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 526 uuuugucgaa acagugggct t 21 <210> 527 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 527 cacgcacaua gagauaugct t 21 <210> 528 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 528 gcauaucucu augugcgugt t 21 <210> 529 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 529 gccggcgcgc caacgcguut t 21 <210> 530 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 530 aacgcguugg cgcgccggct t 21 <210> 531 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 531 gcucagagag uggacucgat t 21 <210> 532 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 532 ucgaguccac ucucugagct t 21 <210> 533 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 533 ccucagcgag cacgacgggt t 21 <210> 534 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 534 cccgucgugc ucgcugaggt t 21 <210> 535 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 535 uucgugcgcu ucucauuggt t 21 <210> 536 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 536 ccaaugagaa gcgcacgaat t 21 <210> 537 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 537 gaaagccaag gcugcgucgt t 21 <210> 538 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 538 cgacgcagcc uuggcuuuct t 21 <210> 539 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 539 gaccagcucc aguccuauat t 21 <210> 540 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 540 uauaggacug gagcugguct t 21 <210> 541 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 541 ugcgcacaca caccgaugut t 21 <210> 542 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 542 acaucggugu gugugcgcat t 21 <210> 543 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 543 agagauuuca ucauggucut t 21 <210> 544 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 544 agaccaugau gaaaucucut t 21 <210> 545 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 545 caaauaucac ggaguacaut t 21 <210> 546 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 546 auguacuccg ugauauuugt t 21 <210> 547 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 547 acgcacacau cagugcacat t 21 <210> 548 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 548 ugugcacuga ugugugcgut t 21 <210> 549 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 549 caccaccaac cacgacauct t 21 <210> 550 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 550 gaugucgugg uugguggugt t 21 <210> 551 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 551 uggacucgau gccaucccut t 21 <210> 552 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 552 agggauggca ucgaguccat t 21 <210> 553 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 553 cucugccugc ccgaacggat t 21 <210> 554 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 554 uccguucggg caggcagagt t 21 <210> 555 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 555 uucugugccg gcuacucggt t 21 <210> 556 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 556 ccgaguagcc ggcacagaat t 21 <210> 557 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 557 cacguacguc ccgggcacct t 21 <210> 558 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 558 ggugcccggg acguacgugt t 21 <210> 559 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 559 ccucugccug cccgaacggt t 21 <210> 560 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 560 ccguucgggc aggcagaggt t 21 <210> 561 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 561 gcgcgccaac gcguuccugt t 21 <210> 562 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 562 caggaacgcg uuggcgcgct t 21 <210> 563 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 563 ggcccacugu uucgacaaat t 21 <210> 564 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 564 uuugucgaaa cagugggcct t 21 <210> 565 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 565 agaucuucaa ggacgcggat t 21 <210> 566 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 566 uccgcguccu ugaagaucut t 21 <210> 567 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 567 auguauuucu cccuucgcut t 21 <210> 568 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 568 agcgaaggga gaaauacaut t 21 <210> 569 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 569 gauaugcaca caccgaugut t 21 <210> 570 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 570 acaucggugu gugcauauct t 21 <210> 571 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 571 uacugcagug accacacggt t 21 <210> 572 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 572 ccgugugguc acugcaguat t 21 <210> 573 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 573 ccagggcugc gcaaccgugt t 21 <210> 574 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 574 cacgguugcg cagcccuggt t 21 <210> 575 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 575 caguccuaua ucugcuucut t 21 <210> 576 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 576 agaagcagau auaggacugt t 21 <210> 577 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 577 ccugcccgaa cggacguuct t 21 <210> 578 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 578 gaacguccgu ucgggcaggt t 21 <210> 579 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 579 cacgcaucac uaaaugcaat t 21 <210> 580 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 580 uugcauuuag ugaugcgugt t 21 <210> 581 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 581 ugcacacacc gaugugcgct t 21 <210> 582 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 582 gcgcacaucg gugugugcat t 21 <210> 583 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 583 cagcacguac gucccgggct t 21 <210> 584 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 584 gcccgggacg uacgugcugt t 21 <210> 585 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 585 gugcgcuucu cauuggucat t 21 <210> 586 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 586 ugaccaauga gaagcgcact t 21 <210> 587 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 587 aacggacguu cucugagagt t 21 <210> 588 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 588 cucucagaga acguccguut t 21 <210> 589 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 589 gaucuucaag gacgcggagt t 21 <210> 590 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 590 cuccgcgucc uugaagauct t 21 <210> 591 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 591 ccauggcagg uccuguugut t 21 <210> 592 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 592 acaacaggac cugccauggt t 21 <210> 593 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 593 cuaugaacua cagccguggt t 21 <210> 594 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 594 ccacggcugu aguucauagt t 21 <210> 595 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 595 uacgcaaaca caccgaugct t 21 <210> 596 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 596 gcaucggugu guuugcguat t 21 <210> 597 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 597 caaggcugcg ucgaacugut t 21 <210> 598 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 598 acaguucgac gcagccuugt t 21 <210> 599 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 599 agauaugcac acaccgaugt t 21 <210> 600 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 600 caucggugug ugcauaucut t 21 <210> 601 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 601 cugcgucgaa cuguccuggt t 21 <210> 602 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 602 ccaggacagu ucgacgcagt t 21 <210> 603 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 603 augcgcacac acaccgaugt t 21 <210> 604 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 604 caucggugug ugugcgcaut t 21 <210> 605 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 605 ucugccugcc cgaacggact t 21 <210> 606 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 606 guccguucgg gcaggcagat t 21 <210> 607 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 607 gacuccggca agcacggcut t 21 <210> 608 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 608 agccgugcuu gccggaguct t 21 <210> 609 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 609 gacgcuggcc uucgugcgct t 21 <210> 610 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 610 gcgcacgaag gccagcguct t 21 <210> 611 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 611 cgcacacaca ccgauguact t 21 <210> 612 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 612 guacaucggu gugugugcgt t 21 <210> 613 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 613 agauuucauc auggucucct t 21 <210> 614 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 614 ggagaccaug augaaaucut t 21 <210> 615 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 615 aaggcugcgu cgaacuguct t 21 <210> 616 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 616 gacaguucga cgcagccuut t 21 <210> 617 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 617 ugcgucuccu ccgcacacct t 21 <210> 618 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 618 ggugugcgga ggagacgcat t 21 <210> 619 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 619 aauaaacggc ugcgucucct t 21 <210> 620 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 620 ggagacgcag ccguuuauut t 21 <210> 621 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 621 auaugcacac acacggaugt t 21 <210> 622 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 622 cauccgugug ugugcauaut t 21 <210> 623 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 623 aaggcgguug uuuagcucut t 21 <210> 624 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 624 agagcuaaac aaccgccuut t 21 <210> 625 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 625 acgcaucacu aaaugcaagt t 21 <210> 626 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 626 cuugcauuua gugaugcgut t 21 <210> 627 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 627 cugccugccc gaacggacgt t 21 <210> 628 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 628 cguccguucg ggcaggcagt t 21 <210> 629 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 629 cggcccacug uuucgacaat t 21 <210> 630 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 630 uugucgaaac agugggccgt t 21 <210> 631 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 631 cagggcugcg caaccguggt t 21 <210> 632 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 632 ccacgguugc gcagcccugt t 21 <210> 633 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 633 uggucacaca gagauacgct t 21 <210> 634 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 634 gcguaucucu gugugaccat t 21 <210> 635 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 635 cuccugucgg ugccacgagt t 21 <210> 636 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 636 cucguggcac cgacaggagt t 21 <210> 637 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 637 caaggaccag cuccagucct t 21 <210> 638 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 638 ggacuggagc ugguccuugt t 21 <210> 639 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 639 uucucauugg ucagcggcut t 21 <210> 640 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 640 agccgcugac caaugagaat t 21 <210> 641 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 641 gagaucuuca aggacgcggt t 21 <210> 642 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 642 ccgcguccuu gaagaucuct t 21 <210> 643 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 643 agagagugga cucgaugcct t 21 <210> 644 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 644 ggcaucgagu ccacucucut t 21 <210> 645 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 645 cucccaguac aucgaguggt t 21 <210> 646 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 646 ccacucgaug uacugggagt t 21 <210> 647 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 647 agucagggac acacgcauct t 21 <210> 648 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 648 gaugcgugug ucccugacut t 21 <210> 649 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 649 ccaucccugc agggccguct t 21 <210> 650 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 650 gacggcccug cagggauggt t 21 <210> 651 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 651 agucuucgua acccaggagt t 21 <210> 652 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 652 cuccuggguu acgaagacut t 21 <210> 653 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 653 caagcgcucc ugucggugct t 21 <210> 654 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 654 gcaccgacag gagcgcuugt t 21 <210> 655 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 655 gguccucacu gaccaugugt t 21 <210> 656 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 656 cacaugguca gugaggacct t 21 <210> 657 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 657 aggcugcguc gaacugucct t 21 <210> 658 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 658 ggacaguucg acgcagccut t 21 <210> 659 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 659 ggacacacgc aucacuaaat t 21 <210> 660 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 660 uuuagugaug cgugugucct t 21 <210> 661 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 661 ugcacacaca ccgaugcugt t 21 <210> 662 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 662 cagcaucggu gugugugcat t 21 <210> 663 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 663 acugaaauga acccucacat t 21 <210> 664 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 664 ugugaggguu cauuucagut t 21 <210> 665 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 665 caguugaaua uccauguggt t 21 <210> 666 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 666 ccacauggau auucaacugt t 21 <210> 667 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 667 ugagcaguac ugcagugact t 21 <210> 668 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 668 gucacugcag uacugcucat t 21 <210> 669 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 669 gcugugagca guacugcagt t 21 <210> 670 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 670 cugcaguacu gcucacagct t 21 <210> 671 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 671 ggcugugagc aguacugcat t 21 <210> 672 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 672 ugcaguacug cucacagcct t 21 <210> 673 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 673 ggcugugagc aguacugcat t 21 <210> 674 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 674 ugcaguacug cucacagcct t 21 <210> 675 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 675 gugagcagua cugcagugat t 21 <210> 676 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 676 ucacugcagu acugcucact t 21 <210> 677 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 677 cccacaguug aauauccaut t 21 <210> 678 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 678 auggauauuc aacugugggt t 21 <210> 679 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 679 cugugagcag uacugcagut t 21 <210> 680 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 680 acugcaguac ugcucacagt t 21 <210> 681 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 681 ccacaguuga auauccaugt t 21 <210> 682 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 682 cauggauauu caacuguggt t 21 <210> 683 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 683 acauguucug ugccggcuat t 21 <210> 684 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 684 uagccggcac agaacaugut t 21 <210> 685 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 685 ucgaggaggc ccgggagaut t 21 <210> 686 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 686 aucucccggg ccuccucgat t 21 <210> 687 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 687 gagcaguacu gcagugacct t 21 <210> 688 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 688 ggucacugca guacugcuct t 21 <210> 689 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 689 gcugugagca guacugcagt t 21 <210> 690 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 690 cugcaguacu gcucacagct t 21 <210> 691 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 691 cacaguugaa uauccaugut t 21 <210> 692 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 692 acauggauau ucaacugugt t 21 <210> 693 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 693 cauguucugu gccggcuact t 21 <210> 694 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 694 guagccggca cagaacaugt t 21 <210> 695 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 695 cgaggaggcc cgggagauct t 21 <210> 696 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 696 gaucucccgg gccuccucgt t 21 <210> 697 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 697 cauguucugu gccggcuact t 21 <210> 698 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 698 guagccggca cagaacaugt t 21 <210> 699 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 699 cccacaguug aauauccaut t 21 <210> 700 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 700 auggauauuc aacugugggt t 21 <210> 701 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 701 acauguucug ugccggcuat t 21 <210> 702 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 702 uagccggcac agaacaugut t 21 <210> 703 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 703 ugugagcagu acugcagugt t 21 <210> 704 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 704 cacugcagua cugcucacat t 21 <210> 705 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 705 caguugaaua uccauguggt t 21 <210> 706 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 706 ccacauggau auucaacugt t 21 <210> 707 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 707 ggccagcugc uggaccgugt t 21 <210> 708 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 708 cacgguccag cagcuggcct t 21 <210> 709 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 709 cacaguugaa uauccaugut t 21 <210> 710 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 710 acauggauau ucaacugugt t 21 <210> 711 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 711 gugagcagua cugcagugat t 21 <210> 712 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 712 ucacugcagu acugcucact t 21 <210> 713 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 713 auguucugug ccggcuacut t 21 <210> 714 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 714 aguagccggc acagaacaut t 21 <210> 715 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 715 ccacaguuga auauccaugt t 21 <210> 716 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 716 cauggauauu caacuguggt t 21 <210> 717 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 717 acaguugaau auccaugugt t 21 <210> 718 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 718 cacauggaua uucaacugut t 21 <210> 719 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 719 auguucugug ccggcuacut t 21 <210> 720 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 720 aguagccggc acagaacaut t 21 <210> 721 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 721 cagcugcugg accguggcgt t 21 <210> 722 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 722 cgccacgguc cagcagcugt t 21 <210> 723 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 723 ggccagcugc uggaccgugt t 21 <210> 724 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 724 cacgguccag cagcuggcct t 21 <210> 725 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 725 ucgaggaggc ccgggagaut t 21 <210> 726 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 726 aucucccggg ccuccucgat t 21 <210> 727 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 727 gccagcugcu ggaccguggt t 21 <210> 728 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 728 ccacggucca gcagcuggct t 21 <210> 729 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 729 gggccagcug cuggaccgut t 21 <210> 730 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 730 acgguccagc agcuggccct t 21 <210> 731 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 731 uucgaggagg cccgggagat t 21 <210> 732 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 732 ucucccgggc cuccucgaat t 21 <210> 733 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 733 agcugcugga ccguggcgct t 21 <210> 734 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 734 gcgccacggu ccagcagcut t 21 <210> 735 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 735 agcugcugga ccguggcgct t 21 <210> 736 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 736 gcgccacggu ccagcagcut t 21 <210> 737 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 737 cagcugcugg accguggcgt t 21 <210> 738 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 738 cgccacgguc cagcagcugt t 21 <210> 739 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 739 gggccagcug cuggaccgut t 21 <210> 740 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 740 acgguccagc agcuggccct t 21 <210> 741 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 741 uucgaggagg cccgggagat t 21 <210> 742 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 742 ucucccgggc cuccucgaat t 21 <210> 743 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 743 cgaggaggcc cgggagauct t 21 <210> 744 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 744 gaucucccgg gccuccucgt t 21 <210> 745 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 745 ccagcugcug gaccguggct t 21 <210> 746 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 746 gccacggucc agcagcuggt t 21 <210> 747 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 747 gccagcugcu ggaccguggt t 21 <210> 748 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 748 ccacggucca gcagcuggct t 21 <210> 749 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 749 ccagcugcug gaccguggct t 21 <210> 750 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 750 gccacggucc agcagcuggt t 21 <210> 751 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 751 cugcuggacc guggcgccat t 21 <210> 752 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 752 uggcgccacg guccagcagt t 21 <210> 753 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 753 acaguugaau auccaugugt t 21 <210> 754 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 754 cacauggaua uucaacugut t 21 <210> 755 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 755 gcugcuggac cguggcgcct t 21 <210> 756 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 756 ggcgccacgg uccagcagct t 21 <210> 757 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 757 gcugcuggac cguggcgcct t 21 <210> 758 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 758 ggcgccacgg uccagcagct t 21 <210> 759 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: sense strand of dsRNA <400> 759 cugcuggacc guggcgccat t 21 <210> 760 <211> 21 <212> DNA <213> Artificial <220> <223> Description of the artificial sequence: antisense strand of dsRNA <400> 760 uggcgccacg guccagcagt t 21 <210> 761 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: primer for psiCHECK insert <400> 761 tgtccgcaac tacaacgcct 20

Claims (24)

  1. 인자 VII 유전자의 발현을 시험관내에서 70% 이상 저해할 수 있는 2중 스트랜드 리보핵산 분자.
  2. 제1항에 있어서,
    상기 2중 스트랜드 리보핵산 분자가 센스 스트랜드 및 안티센스 스트랜드를 포함하고, 안티센스 스트랜드가 센스 스트랜드에 일부 이상 상보성이고, 이에 의해 센스 스트랜드가 인자 VII를 코딩하는 mRNA의 일부 이상에 90% 이상의 동일성을 갖는 서열을 포함하고, 여기서 상기 서열이 (i) 상기 안티센스 스트랜드에 대한 상기 센스 스트랜드의 상보성 영역에 위치하고; (ii) 상기 서열이 30개 미만의 뉴클레오티드 길이인 2중 스트랜드 리보핵산 분자.
  3. 제1항 또는 제2항에 있어서,
    서열 번호 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437 및 438의 뉴클레오티드로 구성된 군에서 선택된 1개 내지 19개의 뉴클레오티드를 포함하는 2중 스트랜드 리보핵산 분자.
  4. 제3항에 있어서,
    안티센스 스트랜드가 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부(overhang)를 추가로 포함하는 2중 스트랜드 리보핵산 분자.
  5. 제3항 또는 제4항에 있어서,
    안티센스 스트랜드의 돌출부가 우라실 또는 인자 VII를 코딩하는 mRNA에 90% 이상 상보성인 뉴클레오티드를 포함하는 2중 스트랜드 리보핵산 분자.
  6. 제3항 내지 제5항중 어느 한 항에 있어서,
    센스 스트랜드가 1개 내지 5개의 뉴클레오티드 길이, 바람직하게는 1개 또는 2개의 뉴클레오티드 길이의 3' 돌출부를 추가로 포함하는 2중 스트랜드 리보핵산 분자.
  7. 제3항 내지 제6항중 어느 한 항에 있어서,
    센스 스트랜드의 돌출부가 우라실 또는 인자 VII를 코딩하는 mRNA에 90% 이상 상보성인 뉴클레오티드를 포함하는 2중 스트랜드 리보핵산 분자.
  8. 제1항 내지 제7항중 어느 한 항에 있어서,
    상기 센스 스트랜드가 서열 번호 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435 및 437로 도시된 핵산 서열로 구성된 군에서 선택되고, 상기 안티센스 스트랜드가 서열 번호 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436 및 438로 도시된 핵산 서열로 구성된 군에서 선택되며, 여기서 상기 2중 스트랜드 리보핵산 분자가 서열 번호 413/414, 415/416, 417/418, 419/420, 421/422, 423/424, 425/426, 427/428, 429/430, 431/432, 433/434, 435/436 및 437/438로 구성된 군에서 선택된 서열 쌍을 포함하는 2중 스트랜드 리보핵산 분자.
  9. 제1항 내지 제8항중 어느 한 항에 있어서,
    상기 2중 스트랜드 리보핵산 분자중 하나 이상의 스트랜드가 24시간 이상의 반감기를 갖는 2중 스트랜드 리보핵산 분자.
  10. 제1항 내지 제9항중 어느 한 항에 있어서,
    상기 2중 스트랜드 리보핵산 분자가 면역자극성이 아닌 2중 스트랜드 리보핵산 분자.
  11. 제1항 내지 제10항중 어느 한 항에 있어서,
    상기 2중 스트랜드 리보핵산 분자가 하나 이상의 변형된 뉴클레오티드를 포함하는 2중 스트랜드 리보핵산 분자.
  12. 제11항에 있어서,
    상기 변형된 뉴클레오티드가 2'-O-메틸 변형된 뉴클레오티드, 5'-포스포로티오에이트 기 포함 뉴클레오티드, 및 콜레스테릴 유도체 또는 도데칸산 비스데실아미드 기에 연결된 말단 뉴클레오티드, 2'-데옥시-2'-플루오로 변형된 뉴클레오티드, 2'-데옥시-변형된 뉴클레오티드, 잠긴(locked) 뉴클레오티드, 무염기(abasic) 뉴클레오티드, 2'-아미노-변형된 뉴클레오티드, 2'-알킬-변형된 뉴클레오티드, 모폴리노 뉴클레오티드, 포스포아미데이트, 및 비천연 염기 포함 뉴클레오티드로 구성된 군에서 선택되는 2중 스트랜드 리보핵산 분자.
  13. 제11항 또는 제12항에 있어서,
    상기 변형된 뉴클레오티드가 2'-O-메틸 변형된 뉴클레오티드, 5'-포스포로티오에이트 기 포함 뉴클레오티드, 및 데옥시티미딘인 2중 스트랜드 리보핵산 분자.
  14. 제1항 내지 제13항중 어느 한 항에 있어서,
    상기 센스 스트랜드가 서열 번호 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 및 25로 도시된 핵산 서열로 구성된 군에서 선택되고, 상기 안티센스 스트랜드가 서열 번호 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 및 26으로 도시된 핵산 서열로 구성된 군에서 선택되며, 여기서 상기 2중 스트랜드 리보핵산 분자가 서열 번호 1/2, 3/4, 5/6, 7/8, 9/10, 11/12, 13/14, 15/16, 17/18, 19/20, 21/22, 23/24 및 25/26으로 구성된 군에서 선택되는 서열 쌍을 포함하는 2중 스트랜드 리보핵산 분자.
  15. 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자에 포함된 센스 스트랜드 및/또는 안티센스 스트랜드를 코딩하는 핵산 서열.
  16. 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자에 포함된 센스 스트랜드 및 안티센스 스트랜드중 하나 이상을 코딩하는 뉴클레오티드 서열에 작동적으로 연결된 조절 서열을 포함하거나 제15항의 핵산 서열을 포함하는 벡터.
  17. 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자 또는 제16항의 벡터를 포함하는 세포, 조직 또는 인간 이외의 유기체.
  18. 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자, 제16항의 벡터, 또는 제17항의 세포 또는 조직을 포함하는 약학 조성물.
  19. 제18항에 있어서,
    약학적으로 허용가능한 담체, 안정화제 및/또는 희석제를 추가로 포함하는 약학 조성물.
  20. (a) 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자 또는 제16항의 벡터를 세포, 조직 또는 유기체에 도입하는 단계; 및
    (b) 인자 VII 유전자의 mRNA 전사체의 분해를 수득하기에 충분한 시간 동안 (a) 단계에서 생산된 세포, 조직 또는 유기체를 유지시킴으로써 세포에서 인자 VII 유전자의 발현을 저해하는 단계를 포함하는,
    세포, 조직 또는 유기체에서 인자 VII 유전자의 발현을 저해하는 방법.
  21. 치료학적 또는 예방학적 효과량의 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자, 제16항의 벡터 및/또는 제18항 또는 제19항에 정의된 약학 조성물을 FVII 유전자 질환의 발현에 의해 야기되는 병리학적 증상 및 질병의 치료, 예방 또는 치유가 필요한 피험체에게 투여함을 포함하는, FVII 유전자 질환의 발현에 의해 야기되는 병리학적 증상 및 질병을 치료, 예방 또는 치유하는 방법.
  22. 제21항에 있어서,
    상기 피험체가 인간인 방법.
  23. 혈전색전성 질환/질병, 염증 또는 증식성 질환을 치료하는데 사용하기 위한 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자, 제16항의 벡터 및/또는 제18항 또는 제19항에 정의된 약학 조성물.
  24. 제1항 내지 제14항중 어느 한 항에 정의된 2중 스트랜드 리보핵산 분자, 제15항의 핵산 분자, 제16항의 벡터 및/또는 제17항의 세포 또는 조직의, 혈전색전성 질환/질병, 염증 또는 증식성 질환을 치료하기 위한 약학 조성물의 제조에 있어서의 용도.

KR1020117011054A 2008-11-17 2009-11-10 인자 ｖｉｉ 유전자의 발현을 저해하기 위한 조성물 및 방법 KR20110069887A (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08169301 2008-11-17
EP08169301.2 2008-11-17

Publications (1)

Publication Number Publication Date
KR20110069887A true KR20110069887A (ko) 2011-06-23

Family

ID=41510498

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020117011054A KR20110069887A (ko) 2008-11-17 2009-11-10 인자 ｖｉｉ 유전자의 발현을 저해하기 위한 조성물 및 방법

Country Status (18)

Country Link
US (1) US20100124547A1 (ko)
EP (1) EP2358876A1 (ko)
JP (1) JP2012508569A (ko)
KR (1) KR20110069887A (ko)
CN (1) CN102216457A (ko)
AR (1) AR074124A1 (ko)
AU (1) AU2009315665A1 (ko)
BR (1) BRPI0921096A8 (ko)
CA (1) CA2743249A1 (ko)
CL (1) CL2011001128A1 (ko)
IL (1) IL212570A0 (ko)
MX (1) MX2011004909A (ko)
PE (1) PE20120115A1 (ko)
RU (1) RU2011124146A (ko)
SG (1) SG171737A1 (ko)
TW (1) TW201021833A (ko)
WO (1) WO2010055041A1 (ko)
ZA (1) ZA201103424B (ko)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2227545A2 (en) * 2007-11-09 2010-09-15 Isis Pharmaceuticals, Inc. Modulation of factor 7 expression
US9512471B2 (en) * 2010-06-30 2016-12-06 Diacarta Inc Methods and kits for detecting human papillomavirus
JP6336755B2 (ja) 2010-11-12 2018-06-06 ザ ジェネラル ホスピタル コーポレイション ポリコームに関連する非コードｒｎａ
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
DK2655621T3 (en) * 2010-12-20 2018-08-13 Massachusetts Gen Hospital Polycomb-associated non-coding RNAS
AU2011349464B2 (en) * 2010-12-20 2016-07-07 The General Hospital Corporation Polycomb-associated non-coding RNAS
EA201490993A1 (ru) * 2011-11-18 2014-09-30 Элнилэм Фармасьютикалз, Инк. МОДИФИЦИРОВАННЫЕ СРЕДСТВА РНКи
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
AP2014008100A0 (en) 2012-05-16 2014-12-31 Gen Hospital Corp Compositions and methods for modulating hemoglobingene family expression
JP2015523854A (ja) 2012-05-16 2015-08-20 ラナ セラピューティクス インコーポレイテッド Ｓｍｎ遺伝子ファミリー発現を調節するための組成物及び方法
WO2013173608A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating mecp2 expression
US10174323B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating ATP2A2 expression
AU2013262656A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating UTRN expression
CA2966044A1 (en) 2014-10-30 2016-05-06 The General Hospital Corporation Methods for modulating atrx-dependent gene repression
WO2016149455A2 (en) 2015-03-17 2016-09-22 The General Hospital Corporation The rna interactome of polycomb repressive complex 1 (prc1)
KR20180002688A (ko) * 2015-05-06 2018-01-08 알닐람 파마슈티칼스 인코포레이티드 인자 ＸＩＩ(하게만 인자)(Ｆ12), 칼리크레인 Ｂ, 혈장(플레처 인자) 1(ＫＬＫＢ1) 및 키니노겐 1(ＫＮＧ1) ｉＲＮＡ 조성물 및 그의 이용 방법

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4134066A (en) * 1977-03-24 1979-01-09 International Business Machines Corporation Wafer indexing system using a grid pattern and coding and orientation marks in each grid cell
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5264423A (en) * 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
AU598946B2 (en) * 1987-06-24 1990-07-05 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US4924624A (en) * 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) * 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
EP0942000B1 (en) * 1989-10-24 2004-06-23 Isis Pharmaceuticals, Inc. 2'-Modified oligonucleotides
US5177198A (en) * 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5646265A (en) * 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5670633A (en) * 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5506351A (en) * 1992-07-23 1996-04-09 Isis Pharmaceuticals Process for the preparation of 2'-O-alkyl guanosine and related compounds
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5459255A (en) * 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5587470A (en) * 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5541307A (en) * 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5218105A (en) * 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US6262241B1 (en) * 1990-08-13 2001-07-17 Isis Pharmaceuticals, Inc. Compound for detecting and modulating RNA activity and gene expression
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5539082A (en) * 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5359044A (en) * 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
EP0577558A2 (de) * 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
GB9304618D0 (en) * 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
AU6412794A (en) * 1993-03-31 1994-10-24 Sterling Winthrop Inc. Oligonucleotides with amide linkages replacing phosphodiester linkages
US5571902A (en) * 1993-07-29 1996-11-05 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5519134A (en) * 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5554746A (en) * 1994-05-16 1996-09-10 Isis Pharmaceuticals, Inc. Lactam nucleic acids
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US6166197A (en) * 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US6127533A (en) * 1997-02-14 2000-10-03 Isis Pharmaceuticals, Inc. 2'-O-aminooxy-modified oligonucleotides
US6172209B1 (en) * 1997-02-14 2001-01-09 Isis Pharmaceuticals Inc. Aminooxy-modified oligonucleotides and methods for making same
US6271358B1 (en) * 1998-07-27 2001-08-07 Isis Pharmaceuticals, Inc. RNA targeted 2′-modified oligonucleotides that are conformationally preorganized
ES2905724T3 (es) * 2003-06-13 2022-04-11 Alnylam Europe Ag Acido ribonucleico bicatenario con elevada eficacia en un organismo
US7871985B2 (en) * 2007-12-10 2011-01-18 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of factor VII gene

Also Published As

Publication number Publication date
WO2010055041A1 (en) 2010-05-20
SG171737A1 (en) 2011-07-28
BRPI0921096A8 (pt) 2016-05-10
JP2012508569A (ja) 2012-04-12
CL2011001128A1 (es) 2012-03-16
IL212570A0 (en) 2011-06-30
US20100124547A1 (en) 2010-05-20
EP2358876A1 (en) 2011-08-24
CA2743249A1 (en) 2010-05-20
AU2009315665A1 (en) 2010-05-20
BRPI0921096A2 (pt) 2015-08-25
TW201021833A (en) 2010-06-16
CN102216457A (zh) 2011-10-12
MX2011004909A (es) 2011-05-30
PE20120115A1 (es) 2012-02-20
AR074124A1 (es) 2010-12-22
RU2011124146A (ru) 2012-12-27
ZA201103424B (en) 2012-01-25

Similar Documents

Publication Publication Date Title
KR20110069887A (ko) 인자 ｖｉｉ 유전자의 발현을 저해하기 위한 조성물 및 방법
KR102025295B1 (ko) B형 간염 바이러스의 유전자 발현 저해용 조성물 및 방법
KR102139918B1 (ko) ＳＥＲＰＩＮＣ1 ｉＲＮＡ 조성물 및 그의 이용 방법
US20110119781A1 (en) Compositions and Methods for Inhibiting Expression of TGF-BETA Receptor Genes
US20110152349A1 (en) Compositions and methods for inhibiting expression of il-18 genes
WO2011054939A2 (en) Compositions and methods for inhibiting expression of kif10 genes
US10619160B2 (en) Compositions and methods for inhibiting expression of RRM2 genes
US20100197773A1 (en) Compositions and methods for inhibiting expression of ptp1b genes
JP2012526533A (ja) グルココルチコイドレセプター（ｇｃｒ）遺伝子の発現を阻害するための組成物及び方法
WO2012082894A1 (en) Compositions and methods for inhibiting expression of mll genes
WO2011095495A1 (en) Compositions and methods for inhibiting expression of ikk2 genes

Legal Events

Date Code Title Description
A201 Request for examination
E601 Decision to refuse application