KR20100087891A - Ssr primer derived from peanut and use thereof - Google Patents

Abstract

PURPOSE: An SSR primer isolated from Arachis hypogaea L. is provided to effectively detect the DNA polymorphism of peanuts and to be used for a DNA profile of Arachis hypogaea L. CONSTITUTION: An SSR primer pair isolated from Arachis hypogaea L. is a primer pair of sequence numbers 9 and 10, sequence numbers 11 and 12, sequence numbers 13 and 14, sequence numbers 15 and 16, sequence number 17 and 18, sequence numbers 19 and 20, sequence numbers 21 and 22, or sequence numbers 23 and 24. A method for detecting the DNA polymorphism of Arachis hypogaea L. comprises: a step of isolating a genome DNA from Arachis hypogaea L.; a step of performing PCR using an SSR primer pair; and a step of separating a PCR product.

Description

SSR primer derived from peanut and use pretty}

The present invention relates to an SSR primer isolated from a peanut and its use, and to a method for detecting DNA polymorphism of a peanut.

To date, advances in molecular biology have led to the development of nucleic acid fingerprint analysis methods and various DNA markers that enable bio-diversity studies at the nucleic acid (DNA) level. This makes it possible to search useful traits, identify species of species, classify varieties, and analyze flexible relationships of populations at the DNA level. Fingerprint analysis using polymerase chain reaction (PCR) developed so far includes randomly amplifed polymorphic DNAs (RAPD), amplified fragment length polymorphic DNA (AFLP), and simple sequence repeat (SSR). RAPD and AFLP methods of the above methods are disadvantageous in reproducibility or complicated analysis. In contrast, the SSR method is a method of preparing PCR primers based on nucleotide sequence information of a microsatellite region, which is a DNA repeat sequence, and is easily used for identification of a species because of its easy analysis and high reproducibility. It is becoming.

In rice, a representative crop, supersatellite markers have been developed that identify genotypes of rice varieties by amplifying SSR repeated in the rice genome by PCR technology (Korean Patent Application No. 2001-34003). In addition, many SSR markers have been developed in barley, soybeans, wheat and peanuts. In the United States, SSR markers were prepared from peanuts (Fegurson, 2003) and used for determination of collection species, and previously reported SSR markers and microsatellite markers (Krishna, 2004) were used to distinguish foreign collection species. In Korea, however, no SSR markers have been developed for the same kind of varieties in peanuts.

Therefore, the present inventors synthesized the nucleotide sequences of peanut SSR markers from all the data reported to find SSR markers that can efficiently evaluate the differences between peanut varieties, and used them as test materials. The present invention was completed by developing.

The present invention seeks to contribute to the protection of varieties grown in Korea by efficiently analyzing the varieties of peanuts using SSR primers isolated from peanuts.

In order to achieve the above object, the present invention provides an SSR primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 24.

In order to achieve another object of the present invention, the present invention provides a method for detecting DNA polymorphism of a peanut and a method for identifying a variety of peanuts, including performing PCR using the SSR primer pair.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing an SSR marker capable of specifically analyzing the genetic polymorphism of peanuts.

In the present invention, SSR markers of peanuts are reported by Ferguson et al. (Theor. Appl. Genet. (2003) 108: 1064-1070), and sequence information of 220 SSR markers and Krishna et al. (Cellular & Molecular Biology Letter). (2004) 9 (4A) 685-697) was obtained from the nucleotide sequence information of 18 SSR markers reported, and synthesized and used SSR markers. By performing DNA profiling through PCR of 36 peanut varieties using the primer pairs, 12 pairs of SSR primer pairs showing many polymorphic mutations were selected.

The SSR marker provided by the present invention refers to a pair of PCR primers, and includes a forward primer and a reverse primer. SSR primer pair provided in the present invention has two base sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 24. Preferably AH4-4 (primary pairs represented by SEQ ID NOs: 1 and 2), AH4-20 (primary pairs represented by SEQ ID NOs: 3 and 4), PM-3 (primer pairs represented by SEQ ID NOs: 5 and 6) PM-15 (primary pairs represented by SEQ ID NOs: 7 and 8), PGPseq3A01 (primary pairs represented by SEQ ID NOs: 9 and 10), PGPseq7G02 (primary pairs represented by SEQ ID NOs: 11 and 12), PGPseq8E12 (SEQ ID NO: 13 And primer pairs represented by SEQ ID NO: 14), PGPseq10D4 (primer pairs represented by SEQ ID NOs: 15 and 16), PGPseq13A7 (primer pairs represented by SEQ ID NOs: 17 and 18), and PGPseq14H6 (primer pairs represented by SEQ ID NOs: 19 and 20) , PGPseq15C10 (primer pairs represented by SEQ ID NOs: 21 and 22), PGPseq16G8 (primer pairs represented by SEQ ID NOs: 23 and 24). Information on the range of primer pairs provided in the present invention and the size of the supersatellites amplified by them, Tm (° C.) and chromosomal alleles in which the supersatellites are present are given in Table 1 below.

TABLE 1 Properties of SSR Primer Pairs of the Present Invention and Supersatellites Amplified therefrom

Primer Name order SEQ ID NO: Range of size of supersatellite to be amplified (bp) Tm (℃) Number of alleles AH4-4 F: CGATTTCTTTACTGAGTGAG One 90-110 45 3 R: ATTTTTTTGCTCCACACA 2 AH4-20 F: ACCAAATAGGAGAGAGGGTTCT 3 200-220 55 2 R: CTCTCTTGCTGGTTCTTTATTAACTC 4 PM-3 F: GAAAGAAATTATACACTCCAATTATGC 5 190-220 55 3 R: CGGCATGACAGCTCTATGTT 6 PM-15 F: CCTTTTCTAACACATTCACACATGA 7 170-180 55 2 R: GGCTCCCTTCGATGATGAC 8 PGPseq3A01 F: ATCATTGTGCTGAGGGAAGG 9 240-260 55 3 R: CACCATTTTTCTTTTTCACCG 10 PGPseq7G02 F ^a : ACTCCCGATGCACTTGAAAT 11 220-230 55 3 R ^b : AACCTCTGTGCACTGTCCCT 12 PGPseq8E12 F: TCTGTTGAGAACCACCAGCA 13 200-210 55 2 R: GTGCTAGTTGCTTGACGCAC 14 PGPseq10D4 F: ATCCCTGATTAGTGCAACGC 15 200-210 55 2 R: CGTAGGTGGTTTTAGGAGGG 16 PGPseq13A7 F: AATCCGACGCAATGATAAAAA 17 270-290 55 2 R: TCCCCTTATTGTTCCAGCAG 18 PGPseq14H6 F: GCAACTAGGGTGTATGCCGT 19 270-290 55 3 R: CAACCCTATACACCGAGGGA 20 PGPseq15C10 F: ATTCCCATGTCGTCAAGACC 21 210-230 55 One R: GCGACGGTATTGGCTTTTAG 22 PGPseq16G8 F: CTCAAAAAGCGCTTAGCCAC 23 200 55 One R: CTGCCTACTGCCTACTGCCT 24

F ^a : forward primer R ^b : reverse primer

SSR primer pairs provided in the present invention can be usefully used for detecting DNA polymorphism and analyzing genetic diversity in peanuts. By using the SSR primers according to the present invention, genetic resources and varieties of peanuts can be efficiently evaluated or preserved. Accordingly, the present invention provides a method for detecting DNA polymorphism of peanut, including performing PCR using the SSR primer pair.

Specifically, the method for detecting DNA polymorphism in peanuts

(a) extracting genomic DNA from peanuts;

(b) performing PCR using the extracted genomic DNA as a template and the SSR primer pair provided by the present invention; And

(c) separating the PCR products by size.

Extraction of genomic DNA in step (a) is performed by phenol / chloroform extraction, SDS extraction (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303), CTAB separation method (Cetyl Trimethyl) commonly used in the art. Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits.

In addition, the PCR in the step (b) can be performed using a PCR reaction mixture containing a variety of components known in the art for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to genomic DNA extracted from the peanut to be analyzed and the SSR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the MgCl ₂ concentration greatly affects the specificity and quantity of amplification, and may be preferably used in the range of 1.5-2.5 mM. In general, when Mg ^{2 +} is an excessive increase the non-specific PCR amplification products and reduce the yield of PCR product when Mg ^{2 +} insufficient. The PCR buffer solution may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. Denaturation and amplification in the above can be carried out at 94-95 ℃ and 72 ℃, respectively. The temperature at the time of binding may vary depending on the type of primer. Preferably it is 55 and 60 degreeC. The time and number of cycles in each step can be determined according to the conditions generally made in the art. The two optimal reaction conditions when performing PCR using the SSR primer pair according to the present invention are as follows. The first reaction condition was the reaction conditions of four primers such as primers AH4-4, AH4-20, PM-3, and PM-15; 30 seconds at 55 ° C .; And 45 cycles of 60 seconds at 72 ° C., followed by reaction at 72 ° C. for 7 minutes. The second reaction conditions were premodified template DNA at 94 ° C. for 2 minutes at 94 ° C. under the reaction conditions of eight primers such as primers PGPseq3A01, PGPseq7G02, PGPseq8E12, PGPseq10D4, PGPseq13A7, PGPseq14H6, PGPseq15C10, and PGPseq16G8; 60 seconds at 60 ° C .; And repeating 90 seconds at 72 ° C. for 35 cycles, and finally reacting at 72 ° C. for 10 minutes.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). PCR amplification results can be preferably confirmed by polyacrylamide gel electrophoresis, more preferably modified polyacrylamide gel electrophoresis. After electrophoresis, electrophoresis results can be analyzed by silver staining and fluorescence staining. General PCR performance and resulting analysis methods are well known in the art.

In addition, the present invention provides a method for homogeneous varieties of peanut, including performing PCR using the SSR primer pair.

Specifically, the method of homologating varieties of peanuts

(a) extracting genomic DNA from peanut and control peanut varieties;

(b) performing PCR using each of the extracted genomic DNA as a template and the SSR primer pair provided by the present invention;

(c) separating each PCR product by size; And

(d) comparing the separation results for each size of step (c) with each other.

Genomic DNA extraction, PCR, and size separation of PCR products of steps (a) to (c) are as described above, and the comparison of peanut and control peanut varieties in step (d) is the same combination of SSR primers. This is done by comparing the size of each PCR product of the peanut and control peanut varieties that are samples for the pair. By comparing the results of the size comparison for each SSR primer pair, if the sample peanuts and the control peanut varieties match with the results, the sample peanuts can be identified as the same varieties as the control peanut varieties. Such a breed identification method may be useful when the identification of the breed is necessary, such as judging whether there is a duplication in the introduction of new genetic resources and whether the indication of origin is violated by checking the origin.

Genomic DNA extraction, PCR, and size separation of PCR products for control peanut varieties may be performed concurrently with the sampled peanut, but may be performed prior to the sampled peanut and prepared as a reference for identification. Using such a reference table can be useful because it can be compared with the reference table by performing genomic DNA extraction, PCR, and size separation of PCR products for peanuts as samples.

Peanut that can be applied to the present inventionArachis hypogaea L. and variants thereof, but is not limited thereto. PreferablyArachis hypogaea May be L.

The present invention also provides a kit for detecting DNA polymorphism of a peanut comprising the SSR primer pair.

In addition, the present invention provides a kit for homogeneous varieties of peanuts comprising the SSR primer pair.

As described above, in the present invention, the first SSR marker was developed in peanuts. SSR primer pairs provided in the present invention can be very useful for effectively detecting the DNA polymorphism of the peanut and preparing the DNA profile of the peanut. Through this, by efficiently evaluating the genetic resources of peanuts, it is possible to effectively perform redundancy analysis and establishment of novelty with existing resources when introducing new genetic resources, and to homologize the varieties of peanuts.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example 1 Genomic DNA Extraction

Genomic DNA was extracted according to a method using SDS (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990) from peanuts (Table 2) registered as varieties. This will be described in detail as follows. 0.5 g of leaf tissues were taken from young peanut plants at 1 month of growth and placed in a 1.5 ml tube and quenched with liquid nitrogen. The leaf was then ground finely with a plastic rod immediately. 750 μl of extraction buffer (200 mM Tris-HCl, pH 8.0), 200 mM NaCl, 25 mM EDTA, 0.5% SDS) was added before the ground leaves were dissolved, and the mixture was stored at 65 ° C. for 30 minutes. An equivalent amount of a phenol (chloro): chloroform: isoamylalchol (25: 24: 1) solution was further added thereto, followed by stirring for about 15 minutes. It was centrifuged for 15 minutes at 13,000 rpm. The supernatant was taken and transferred to a new tube. Equal amount of isopropanol (-20 ° C.) was added to the tube and stored at −20 ° C. for 1 hour. Thereafter, centrifugation was performed at 13,000 rpm for 15 minutes. After discarding the supernatant, the precipitated DNA was washed with 70% ethanol. After drying the DNA, TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 7.4) containing about 300 μl of RNase (50 μg / ml) was added thereto to be sufficiently dissolved, and then stored at 37 ° C. for 1 hour. .

TABLE 2 Peanut varieties used in the present invention as peanuts registered as varieties

Breed name Year of growth Collection country (country of origin) Type Saddle Peanut 1983 Republic of Korea Arachis hypogaea L. Daekwang Peanut 1985 Republic of Korea Arachis hypogaea L. Indigo peanut 1990 Republic of Korea Arachis hypogaea L. Daewon Peanut 1990 Republic of Korea Arachis hypogaea L. Cinnamon Peanut 1991 Republic of Korea Arachis hypogaea L. Royal Peanuts 1992 Republic of Korea Arachis hypogaea L. Dafeng Peanut 1993 Republic of Korea Arachis hypogaea L. Shindae Gwang Peanut 1994 Republic of Korea Arachis hypogaea L. Singwang Peanut 1995 Republic of Korea Arachis hypogaea L. Chogwang Peanut 1996 Republic of Korea Arachis hypogaea L. Kepung Peanut 1997 Republic of Korea Arachis hypogaea L. Daecheong Peanut 1997 Republic of Korea Arachis hypogaea L. Baekwang Peanut 1997 Republic of Korea Arachis hypogaea L. Delicacy Peanut 1998 Republic of Korea Arachis hypogaea L. Joan Peanut 1999 Republic of Korea Arachis hypogaea L. Sekwang Peanut 1999 Republic of Korea Arachis hypogaea L. Howang Peanut 1999 Republic of Korea Arachis hypogaea L. Ocean Peanut 2000 Republic of Korea Arachis hypogaea L. Peanut instead 2000 Republic of Korea Arachis hypogaea L. Bowon Peanut 2001 Republic of Korea Arachis hypogaea L. Dagwang Peanut 2001 Republic of Korea Arachis hypogaea L. Peanut Peanut 2002 Republic of Korea Arachis hypogaea L. Agwang peanut 2002 Republic of Korea Arachis hypogaea L. Daemyung Peanut 2003 Republic of Korea Arachis hypogaea L. High Kwang Peanut 2003 Republic of Korea Arachis hypogaea L. Light peanut 2003 Republic of Korea Arachis hypogaea L. White Peanut 2003 Republic of Korea Arachis hypogaea L. Danuri Peanuts 2004 Republic of Korea Arachis hypogaea L. Ringworm 2004 Republic of Korea Arachis hypogaea L. Sangpyeong Peanut 2005 Republic of Korea Arachis hypogaea L. Baekjin Peanut 2005 Republic of Korea Arachis hypogaea L. Chopyeong Peanut 2006 Republic of Korea Arachis hypogaea L. Peanut Peanut 2006 Republic of Korea Arachis hypogaea L. Champyeong Peanut 2007 Republic of Korea Arachis hypogaea L. Pungsan Peanut 2007 Republic of Korea Arachis hypogaea L. Peanut Peanut 2007 Republic of Korea Arachis hypogaea L.

Example 2 Selection of SSR Markers

In order to amplify the genomic DNA extracted in Example 1 by PCR, SSR primers were manufactured and used by Bioner Corporation. In order to select the SSR primer combination showing a lot of polymorphic variation in various peanut varieties among the prepared primer pairs, DNA profiling analysis by PCR was performed on the 36 peanut varieties described in Table 2 above.

The composition of each PCR reaction mixture (20 μl) was as follows: 100ng peanut template DNA isolated by the method of Example 1, 0.2 μM forward primer, 0.2 μM reverse primer, 1 × PCR reaction solution (10 mM Tris-HCl ( pH 8.8), 1.5 mM MgCl ₂ , 50 mM KCl, 0.1% Triton X-100), 1 unit DNA polymerase. PCR reaction was amplified using two reaction conditions. The first reaction condition was the reaction conditions of four primers such as primers AH4-4, AH4-20, PM-3, and PM-15. 15 seconds at 94 ° C. after full denaturation; 30 seconds at 55 ° C .; And 45 cycles of 60 seconds at 72 ° C., followed by reaction at 72 ° C. for 7 minutes. The second reaction conditions were premodified template DNA at 94 ° C. for 2 minutes at 94 ° C. under the reaction conditions of eight primers such as primers PGPseq3A01, PGPseq7G02, PGPseq8E12, PGPseq10D4, PGPseq13A7, PGPseq14H6, PGPseq15C10, and PGPseq16G8; 60 seconds at 60 ° C .; And repeating 90 seconds at 72 ° C. for 35 cycles, and finally reacting at 72 ° C. for 10 minutes.

In order to analyze the size of differently amplified PCR product fragments, polyacrylamide gel electrophoresis was used. The polyacrylamide concentration was separated using 0.6%, and the result was stained using fluorescence staining of genet bio company. After photographing, the size of the amplified supernatant was compared with the amplified fragment. And 0 if not amplified.

As a result, 12 pairs of SSR primer pairs showing polymorphism in the domestically grown peanut varieties were identified. AH4-4 (primary pairs represented by SEQ ID NOS: 1 and 2) and AH4-20 (SEQ ID NOs: 3 and 4) were identified. Primer pairs), PM-3 (primary pairs represented by SEQ ID NOs: 5 and 6), PM-15 (primary pairs represented by SEQ ID NOs: 7 and 8), PGPseq3A01 (primary pairs represented by SEQ ID NOs: 9 and 10), PGPseq7G02 (primary pairs represented by SEQ ID NOs: 11 and 12), PGPseq8E12 (primary pairs represented by SEQ ID NOs: 13 and 14), PGPseq10D4 (primary pairs represented by SEQ ID NOs: 15 and 16), and PGPseq13A7 (SEQ ID NOs: 17 and 18) Primer pairs shown), PGPseq14H6 (primer pairs represented by SEQ ID NOs: 19 and 20), PGPseq15C10 (primer pairs represented by SEQ ID NOs: 21 and 22), and PGPseq16G8 (primer pairs represented by SEQ ID NOs: 23 and 24) were selected. (See Table 1). The results of comparing the PCR fragments amplified by the 12 pairs of primers are shown in Table 3 below.

[Table 3] Amplification by primer type and allele varieties showing polymorphism

primer Opposition
factor One
Birds 2
Dae Kwang 3
Indigo 4
Crew 5
Shin Nam Kwang 6
king 7
Dafeng 8
Shin Dae Kwang 9
Shin Kwang 10
Dimming 11
ethos 12
Daecheong PGPseq
7G02 One 0 0 0 0 0 0 0 0 0 0 0 0 2 One One One One One One 0 One One One One One 3 0 0 0 0 0 0 One 0 0 0 0 0 PGPseq
8E12 4 One One One 0 One 0 0 0 0 One One 0 5 0 0 0 One 0 One One One One 0 0 One PGPseq
16G8 6 0 0 0 One 0 0 One One One One 0 One AH4-4 7 0 0 One 0 0 0 0 0 0 0 0 0 8 One One 0 One One One One 0 One One One One 9 0 0 0 0 0 0 0 One 0 0 0 0 AH4-20 10 0 0 0 0 0 0 0 0 0 One 0 0 11 One One One One One One One One One 0 One One PM-3 12 0 0 0 0 0 0 0 0 0 0 0 0 13 One One One One One One One One 0 One One One 14 0 0 0 0 0 0 0 0 One 0 0 0 PM-15 15 0 0 0 0 0 0 0 0 One 0 0 0 16 One One One One One One One One 0 One One One 14H6 17 One One One 0 One 0 0 One 0 0 One 0 18 0 0 0 One 0 One One 0 One One 0 0 19 0 0 0 0 0 0 0 0 0 0 0 One PGPseq
3A1 20 0 0 0 0 0 0 One 0 One 0 0 0 21 One One One One One One 0 One 0 One One One 22 0 0 0 0 0 0 0 0 0 0 0 0 PGPseq
10D4 23 0 0 0 0 0 0 0 0 0 0 0 One 24 One One One One One One One One One One One 0 PGPseq
13A7 25 One One 0 One 0 One 0 0 0 0 0 0 26 0 0 One 0 One 0 One One One One One One PGPseq
15C10 27 0 0 One 0 One 0 One One 0 0 0 0

primer Opposition
factor 13
Eight light 14
Delicacy 15
Joan 16
Light 17
Arc 18
ocean 19
instead 20
Bowon 21
Dagwang 22
Scenery 23
Agwang 24
Daemyung PGPseq
7G02 One 0 One 0 0 0 0 0 0 0 0 0 0 2 One 0 One One One One One One One 0 0 One 3 0 0 0 0 0 0 0 0 0 One One 0 PGPseq
8E12 4 0 One One 0 One One One One One One One 0 5 One 0 0 One 0 0 0 0 0 0 0 One PGPseq
16G8 6 One 0 One 0 0 One 0 One 0 0 One 0 AH4-4 7 0 0 0 0 0 0 0 0 0 0 0 0 8 One One One 0 One One One One One One 0 0 9 0 0 0 One 0 0 0 0 0 0 One One AH4-20 10 One 0 0 0 0 0 0 0 0 0 0 0 11 0 One One One One One One One One One One One PM-3 12 0 0 0 0 0 0 0 0 0 0 0 0 13 One One One One One One One 0 One One One One 14 0 0 0 0 0 0 0 One 0 0 0 0 PM-15 15 0 0 0 0 0 0 0 0 0 0 0 0 16 One One One One One One One One One One One One 14H6 17 0 One One One One One One One One One One One 18 One 0 0 0 0 0 0 0 0 0 0 0 19 0 0 0 0 0 0 0 0 0 0 0 0 PGPseq3A1 20 0 0 0 0 0 One 0 0 0 0 0 0 21 One One One 0 One 0 One One One One One One 22 0 0 0 One 0 0 0 0 0 0 0 0 PGPseq
10D4 23 0 One 0 0 0 0 0 0 0 0 0 One 24 One 0 One One One One One One One One One 0 PGPseq
13A7 25 0 0 0 0 0 One 0 0 0 0 0 0 26 One One One One One 0 One One One One One One PGPseq
15C10 27 One 0 0 0 One One 0 0 One 0 0 0

primer Opposition
factor 25
High light 26
Light 27
Baekjung 28
Danuri 29
ringworm 30
Sangpyeong 31
Baekjin 32
Chopyeong 33
Visit 34
Champyeong 35
Poongsan 36
Line PGPseq
7G02 One 0 0 0 0 0 0 0 0 0 0 0 0 2 One 0 One One 0 One One One 0 0 0 0 3 0 One 0 0 One 0 0 0 One 0 0 0 PGPseq
8E12 4 One 0 0 One One One One One One 0 0 One 5 0 One One 0 0 0 0 0 0 One One 0 PGPseq
16G8 6 0 0 One 0 One One One One 0 One One 0 AH4-4 7 0 0 0 0 0 0 0 0 0 0 0 0 8 One One One One 0 One One One 0 One One One 9 0 0 0 0 One 0 0 0 One 0 0 0 AH4-20 10 0 One One 0 One One One 0 One One One 0 11 One 0 0 One 0 0 0 One 0 0 0 One PM-3 12 0 0 0 0 0 0 0 One 0 0 0 One 13 0 0 One One One One One 0 0 One One 0 14 One One 0 0 0 0 0 0 One 0 0 0 PM-15 15 One One 0 0 0 0 0 One One 0 0 One 16 0 0 One One One One One 0 0 One One 0 14H6 17 One 0 One One 0 0 0 One 0 0 0 One 18 0 0 0 0 One One One 0 0 One One 0 19 0 One 0 0 0 0 0 0 One 0 0 0 PGPseq3A1 20 One One One 0 One 0 One 0 One 0 0 0 21 0 0 0 One 0 One 0 One 0 One One One 22 0 0 0 0 0 0 0 0 0 0 0 0 PGPseq
10D4 23 0 0 0 One 0 0 0 0 0 0 0 0 24 One One One 0 One One One One One One One One PGPseq
13A7 25 0 0 0 0 0 0 0 0 0 0 0 0 26 One One One One One One One One One One One One PGPseq
15C10 27 0 0 0 0 0 One One One 0 0 0 0

As shown in Table 3, the size of the site containing the SSR amplified by the primer pair of the present invention showed polymorphism in 36 kinds of peanut samples, and the SSR located at the site amplified by the primer pair of the present invention was polymorphic. It can be seen that. At this time, the number of alleles showing the polymorphism of each SSR is also as shown in Table 1.

<110> Republic of Korea <120> SSR primer derived from peanut and use <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA Arachis hypogaea L. <400> 1 cgatttcttt actgagtgag 20 <210> 2 <211> 18 <212> DNA Arachis hypogaea L. <400> 2 atttttttgc tccacaca 18 <210> 3 <211> 22 <212> DNA Arachis hypogaea L. <400> 3 accaaatagg agagagggtt ct 22 <210> 4 <211> 26 <212> DNA Arachis hypogaea L. <400> 4 ctctcttgct ggttctttat taactc 26 <210> 5 <211> 27 <212> DNA Arachis hypogaea L. <400> 5 gaaagaaatt atacactcca attatgc 27 <210> 6 <211> 20 <212> DNA Arachis hypogaea L. <400> 6 cggcatgaca gctctatgtt 20 <210> 7 <211> 25 <212> DNA Arachis hypogaea L. <400> 7 ccttttctaa cacattcaca catga 25 <210> 8 <211> 19 <212> DNA Arachis hypogaea L. <400> 8 ggctcccttc gatgatgac 19 <210> 9 <211> 20 <212> DNA Arachis hypogaea L. <400> 9 atcattgtgc tgagggaagg 20 <210> 10 <211> 21 <212> DNA Arachis hypogaea L. <400> 10 caccattttt ctttttcacc g 21 <210> 11 <211> 20 <212> DNA Arachis hypogaea L. <400> 11 actcccgatg cacttgaaat 20 <210> 12 <211> 20 <212> DNA Arachis hypogaea L. <400> 12 aacctctgtg cactgtccct 20 <210> 13 <211> 20 <212> DNA Arachis hypogaea L. <400> 13 tctgttgaga accaccagca 20 <210> 14 <211> 20 <212> DNA Arachis hypogaea L. <400> 14 gtgctagttg cttgacgcac 20 <210> 15 <211> 20 <212> DNA Arachis hypogaea L. <400> 15 atccctgatt agtgcaacgc 20 <210> 16 <211> 20 <212> DNA Arachis hypogaea L. <400> 16 cgtaggtggt tttaggaggg 20 <210> 17 <211> 21 <212> DNA Arachis hypogaea L. <400> 17 aatccgacgc aatgataaaa a 21 <210> 18 <211> 20 <212> DNA Arachis hypogaea L. <400> 18 tccccttatt gttccagcag 20 <210> 19 <211> 20 <212> DNA Arachis hypogaea L. <400> 19 gcaactaggg tgtatgccgt 20 <210> 20 <211> 20 <212> DNA Arachis hypogaea L. <400> 20 caaccctata caccgaggga 20 <210> 21 <211> 20 <212> DNA Arachis hypogaea L. <400> 21 attcccatgt cgtcaagacc 20 <210> 22 <211> 20 <212> DNA Arachis hypogaea L. <400> 22 gcgacggtat tggcttttag 20 <210> 23 <211> 20 <212> DNA Arachis hypogaea L. <400> 23 ctcaaaaagc gcttagccac 20 <210> 24 <211> 20 <212> DNA Arachis hypogaea L. <400> 24 ctgcctactg cctactgcct 20  

Claims (8)

Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; And an SSR primer pair selected from the group consisting of primer pairs represented by SEQ ID NOs: 23 and 24. The method of claim 1, Peanuts ( Arachis hypogaea L.) SSR primer pair, characterized in that derived from. Extracting genomic DNA from peanuts; PCR using the extracted DNA as a template and an SSR primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 24; And Separating the PCR product by size; Method for detecting the DNA polymorphism of the peanut comprising a. The method of claim 3, The SSR primer pair is a primer pair represented by SEQ ID NO: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; And primer pairs represented by SEQ ID NOs: 23 and 24; Extracting genomic DNA from peanut and control peanut varieties; PCR using the extracted DNA as a template and an SSR primer pair having two nucleotide sequences selected from the group consisting of SEQ ID NOs: 1 to 24; Separating the PCR products by size; And Peanut variety homogeneous method comprising the; step of comparing the separation results by size of the peanut and control peanut varieties. The method of claim 5, The SSR primer pair is a primer pair represented by SEQ ID NO: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; And primer pairs represented by SEQ ID NOs: 23 and 24; peanut varieties homologous method, characterized in that the SSR primer pair selected from the group consisting of. Primer pairs represented by SEQ ID NOs: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; And primer pairs represented by SEQ ID NOs: 23 and 24; kit for detecting DNA polymorphism of peanut. Primer pairs represented by SEQ ID NOs: 1 and 2; Primer pairs represented by SEQ ID NOs: 3 and 4; Primer pairs represented by SEQ ID NOs: 5 and 6; Primer pairs represented by SEQ ID NOs: 7 and 8; Primer pairs represented by SEQ ID NOs: 9 and 10; Primer pairs represented by SEQ ID NOs: 11 and 12; Primer pairs represented by SEQ ID NOs: 13 and 14; Primer pairs represented by SEQ ID NOs: 15 and 16; Primer pairs represented by SEQ ID NOs: 17 and 18; Primer pairs represented by SEQ ID NOs: 19 and 20; Primer pairs represented by SEQ ID NOs: 21 and 22; And a pair of primers represented by SEQ ID NOs: 23 and 24;