KR20060029836A - Probe of human papillomavirus, oligonucleotide microarray and genotyping kit comprising the same, and genotyping method for human papillomavirus using the same - Google Patents

Abstract

The present invention is a probe that binds complementarily to nucleic acid of human papillomaviruis (HPV), the main cause of cervical cancer and the most common sexually transmitted disease, DNA chip or microarray including the same, and using the same The diagnostic kit for HPV genotyping and the method for analyzing HPV infection and genotypes using the same, the method of 35 types of HPV in 4,898 cervical cell specimens and 68 cervical cancer tissue specimens in Korea Clones of the L1 and E6 / E7 genes were obtained, oligonucleotide probes were synthesized for the analysis of 40 types of HPV by adding Western data to them, DNA chips were prepared using these probes, and various clinical specimens. This is done by analyzing the value of this DNA chip. The DNA chip can accurately identify all 40 types of HPV found in the cervix, diagnose multiple infections caused by one or more HPV types, and the diagnostic sensitivity and specificity of HPV genotypes are close to 100%. It is very high and reproducible, and it is possible to test a large number of samples in the shortest time, which is better and more economical than conventional tests, and is useful for predicting cervical cancer and precancerous lesions.

Human Papilloma Virus (HPV), Oligonucleotide Microarrays, DNA Chips, PCR

Description

Probe Of Human Papillomavirus, Oligonucleotide Microarray And Genotyping Kit Comprising The Same, And Genotyping Method For Human Papillomavirus Using The Same}             

1 is a genomic DNA is isolated from the positive control cell line (positive control cell line) as a casting amplification of the E6 and E7 genes of HPV by PCR according to the method of Example 3 and electrophoresed on 2% agarose gel (Lane 1, M: 100 bp DNA size marker, lane 2 (N / C): negative control, lane 3 (HPV-16): HPV-16 infection positive control cell line (Caski, ATCC CRL- 1550), lane 4 (HPV-18): HPV-18 infection positive control cell line (HeLa, ATCC CCL-2), lane 5 (HPV-35): HPV-35 infection positive control cell line (ATCC 40331).

Figure 2 is a photograph of the results of electrophoresis on 2% agarose gel by amplifying the L1 gene of HPV by PCR according to the method of Example 3 after separating genomic DNA from the positive control cell line as a casting (lane 1 (M ): 100 bp DNA size marker, lane 2 (N / C): negative control, lane 3 (HPV-16): HPV-16 infection positive control cell line (Caski, ATCC CRL-1550), lane 4 (HPV-18) : HPV-18 infection positive control cell line (HeLa, ATCC CCL-2), lane 5 (HPV-35): HPV-35 infection positive control cell line (ATCC 40331)).

Figure 3 is isolated from the genomic DNA from the positive control cell line as a cast amplified by the duplex PCR E6 / E7 gene and human beta-globulin (HBB) gene of HPV according to the method of Example 3 2% Photograph of agarose gel electrophoresis (lane 1 (M): 100 bp DNA size marker, lane 2 (N / C): negative control, lane 3 (HPV-16): HPV-16 infection positive control cell line) (Caski, ATCC CRL-1550), Lane 4 (HPV-18): HPV-18 Infection Positive Control Cell Line (HeLa, ATCC CCL-2), Lane 5 (HPV-35): HPV-35 Infection Positive Control Cell Line (ATCC 40331)).

Figure 4 is isolated from genomic DNA from the positive control cell line as a casting amplified by the duplex PCR of the L1 gene and human beta globulin (HBB) gene of HPV according to the method of Example 3 and electrophoresed on 2% agarose gel Photo of results (lane 1 (M): 100 bp DNA size marker, lane 2 (HPV-16): HPV-16 infection positive control cell line (Caski, ATCC CRL-1550), lane 3 (HPV-18): HPV -18 infection positive control cell line (HeLa, ATCC CCL-2)).

Figure 5 is isolated from the genomic DNA from the positive control cell line as a casting amplification of HPV L1 gene, E6 / E7 gene, and human beta globurin (HBB) gene by triplex PCR according to the method of Example 3 2% Photograph of agarose gel electrophoresis (lane 1 (M): 100 bp DNA size marker, lane 2 (HPV-16): HPV-16 infection positive control cell line (Caski, ATCC CRL-1550), lane 3 (HPV-18): HPV-18 Infection Positive Control Cell Line (HeLa, ATCC CCL-2)).

Figure 6 shows the amplified E6 / E7 gene after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from Caski, an HPV-16 infected cervical cancer cell line. Analyzes were performed using an ABI prism 377 automatic base sequence analyzer, showing the electrophoresis of the HPV genotype showing HPV-16 (see Example 4).

Figure 7 shows the amplified E6 / E7 gene after triplex PCR amplification of the HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from HeLa, an HPV-18 infected cervical cancer cell line. Analyzes were performed using an ABI prism 377 automatic sequencing analyzer, showing the electrophoresis of the HPV genotype showing HPV-18 (Example 4).

FIG. 8 shows the ABI prism of the amplified L1 gene after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from Caski, an HPV-16 infected cervical cancer cell line. Analyzes using a 377 automatic sequencing analyzer, the genotype of the HPV is electrophoresis showing HPV-16 (Example 4).

FIG. 9 shows ABI prism of amplified L1 gene after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from HeLa, HPV-18 infected cervical cancer cell line. Analyzes using a 377 automatic sequencing analyzer, the genotype of the HPV is electrophoresis showing HPV-18 (Example 4).

FIG. 10 is amplified L1 after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from the microdermal cancer cells in Korean cervical cancer tissues. The gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing that the genotype of HPV is HPV-31, which is a high-risk type (Example 4).

FIG. 11 is amplified L1 after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from the microdermal cancer cells in cervical cancer tissues of Korean women. The gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing that the HPV genotype is HPV-35, a high-risk type (Example 4).

FIG. 12 is amplified L1 after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from the microdermal cancer cells in Korean cervical cancer tissues. The gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis that shows that the HPV genotype is HPV-39, a high-risk type (Example 4).

FIG. 13 is amplified L1 after triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from the microdermabrasion of cancer cells in cervical cancer tissue of Korean women. The gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing that the HPV genotype is HPV-67, a high-risk type (Example 4).

FIG. 14 shows amplified L1 after triplex PCR amplification of HP1's L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from the microdermabrasion of cancer cells in cervical cancer tissue of Korean women. The gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis that shows that the HPV genotype is HPV-56, a type of high risk type (Example 4).

FIG. 15 shows triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from cervical swap specimens of Korean women who showed only positive changes in cervical cytology. The amplified L1 gene was then analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis that shows that the HPV genotype is HPV-6b, a low-risk type (Example 4).

16 is a triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene using DNA extracted from cervical swap specimens of Korean women who showed only positive changes in cervical cytology. The amplified L1 gene was then analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing that the HPV genotype is HPV-11, a low-risk type (Example 4).

FIG. 17 shows DNA L1 gene and E6 / E7 genes extracted from cervical swap specimens of Korean women in which only atypical squamous cell of unknown significance (ASCUS), which is an obscure lesion, was detected by Pap smear. And triplex PCR amplification of the human beta globulin (HBB) gene, followed by analysis of the amplified L1 gene using an ABI prism 377 automatic sequencing analyzer, showing the HPV genotype HPV-58 (Example) 4).

Figure 18 shows DNA extraction from cervical swap specimens of Korean women with microinavasive sqamous carcinoma found in the Pap smear and biopsy of the cervix and HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB). ) Triplex PCR amplification of the gene, followed by analysis of the amplified L1 gene using an ABI prism 377 automatic sequencing analyzer, showing the HPV genotype HPV-16 (Example 4).

Fig. 19 shows DNA extracted from cervical swap specimens of Korean women with high grade squamous intraepithelial lesions detected by Pap smear in the cervix and HPV's L1 gene, E6 / E7 gene, and human betagloburin. Triplex PCR amplification of the (HBB) gene followed by PCR amplification of the amplified L1 gene using an ABI prism 377 automatic sequencing analyzer. It is an electrophoresis showing that the genotype of HPV is HPV-31 (Example 4). ).

20 is a triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene by extracting DNA from cervical swab specimen of Korean woman whose HSIL was found by Pap smear test. The amplified L1 gene was PCR amplified and analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing HPV-18 genotype (Example 4).

FIG. 21 shows DNA extraction from cervical swap specimens of a Korean woman whose HSIL was detected by Pap smear, and triplex PCR amplification of HPV L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene. The amplified L1 gene was analyzed using an ABI prism 377 Autobase Sequence Analyzer, showing electrophoresis showing that HPV genotype is HPV-58, a type of high risk type (Example 4).

Fig. 22 shows DNA extraction from cervical swap samples of Korean women whose HSILs were detected by Pap smear, followed by triplex PCR amplification of HP1's L1 gene, E6 / E7 gene, and human betagloburin (HBB) gene. The amplified L1 gene was analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing HPV genotype HPV-34, a high-risk type (Example 4).

FIG. 23 shows DNA extracted from cervical swap specimens of a Korean woman who was later confirmed that carcinoma in situ was present in the cervical biopsy, and the HP1 L1 gene, E6 / E7 gene, and human betagloburin (HBB). ) Triplex PCR amplification of the gene, and the amplified L1 gene was analyzed using an ABI prism 377 automatic sequencing analyzer. It is an electrophoresis showing that the genotype of HPV is HPV-68 (Example 4).

 Figure 24 shows the extraction of DNA from cervical swap specimens of Korean women with low grade squamous intraepithelial lesions (LSIL) detected in Pap smears of the cervix and HPV's L1 gene, E6 / E7 gene, and human beta. The globulin (HBB) gene was subjected to triplex PCR amplification, and the amplified L1 gene was analyzed using an ABI prism 377 automatic sequencing analyzer. It is an electrophoresis showing that the genotype of HPV is HPV-56 (Example 4).

25 is a triplex PCR amplification of HPV's L1 gene, E6 / E7 gene, and human betaglobulin (HBB) gene by extracting DNA from cervical swap specimens of Korean women in which LSIL was detected by Pap smear. The amplified L1 gene was then analyzed using an ABI prism 377 automatic sequencing analyzer, showing electrophoresis showing HPV-35 genotype (Example 4).

Fig. 26 shows the L1 gene and E6 / E7 gene of HPV by extracting DNA from cervical swap specimens of Korean women who were found to have HSIL in the cervical cytology and later found to have a combination of HPV-18 and HPV-70. And electrophoretic diagrams of human beta globulin (HBB) genes after triplex PCR amplification and analysis of the amplified L1 genes using an ABI prism 377 automatic sequencing analyzer (Example 4, FIG. 51).

FIG. 27 shows that LV gene and E6 / E7 of HPV were extracted from cervical swap specimens of Korean women who were confirmed to have microinvasive cancer in the cervix and had a combined infection of HPV-16 and HPV-52. Genes and human beta globulin (HBB) genes were subjected to triplex PCR amplification, followed by electrophoresis analysis of the amplified L1 gene using an ABI prism 377 automatic sequencing analyzer (Example 4, FIG. 52).

28 is a schematic diagram showing the type and position of a probe located on a DNA chip according to an example of the present invention.

29 is a front photograph of an HPV genotype diagnostic DNA chip according to an example of the present invention.

30 is amplified by HPV genotyping DNA chip of the present invention after amplification of HPV E6 / E7 gene, L1 gene, human type beta globurin (HBB) gene by triplex PCR using DNA extracted from Caski, a cervical cancer cell line One example is a fluorescence scanner photograph showing that the HPV genotype is HPV-16 (Example 9).

31 is amplified by HPV genotyping DNA chip of the present invention after amplification of HPV E6 / E7 gene, L1 gene, human beta globulin (HBB) gene by triplex PCR using DNA extracted from HeLa, a cervical cancer cell line One example is a fluorescence scanner photograph showing that HPV genotype is HPV-18 (Example 9).

FIG. 32 shows amplification of HPV's E6 / E7 gene, L1 gene and human body beta globulin (HBB) gene using triplex PCR using DNA extracted from K562, a negative control cell line not infected with HPV. It is a photograph analyzed by the HPV genotyping DNA chip of the present invention (Example 9).

FIG. 33 illustrates amplification of HPV's E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the microdermal cancer cells in Korean cervical cancer tissues. HPV genotyping DNA chip analysis of the fluorescence scanner showing that HPV genotype HPV-16 is a high risk type (Example 9).

FIG. 34 shows amplification of HPV's E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the cancer cells in the cervical cancer tissue of Korean women. HPV genotyping DNA chip analysis of the fluorescence scanner shows that HPV genotype HPV-18 is a high risk type (Example 9).

FIG. 35 illustrates amplification of HPV's E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the microdermal cancer cells in Korean cervical cancer tissues. Analysis of HPV genotyping DNA chip of the fluorescence scanner shows that HPV genotype HPV-31 of high risk type (Example 9).

FIG. 36 illustrates amplification of HPV E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the micro-separation of cancer cells in cervical cancer tissues of Korean women. HPV genotyping DNA chip was analyzed by the fluorescent scanner showing that the HPV genotype HPV-35 of high risk type (Example 9).

37 shows amplification of HPV's E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the microdermal cancer cells in cervical cancer tissues of Korean women. HPV genotyping DNA chip analysis of the fluorescence scanner shows that HPV genotype HPV-39 of high risk type (Example 9).

38 shows amplification of HPV's E6 / E7 gene, L1 gene, and human-type beta globurin (HBB) gene by triplex PCR using DNA extracted from the microdermalized cancer cells in cervical cancer tissues of Korean women. HPV genotyping DNA chip analysis of the fluorescence scanner shows that HPV genotype HPV-67 is a high risk type (Example 9).

FIG. 39 illustrates amplification of HPV's E6 / E7 gene, L1 gene, and human-type betagloburin (HBB) gene by triplex PCR using DNA extracted from the micro-separation of cancer cells in cervical cancer tissues of Korean women. HPV genotyping DNA chip analysis of the fluorescence scanner shows that HPV genotype HPV-56 is a high-risk type (Example 9).

40 is a triplex PCR assay for E6 / E7 gene, L1 gene, human body beta globulin (HBB) gene of HPV using DNA extracted from cervical swab sample of Korean women who showed only positive change in cervical Pap smear. After amplification and analysis with the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that the HPV genotype is a low risk HPV-6b (Example 9).

FIG. 41 is a triplex PCR assay for E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene of HPV using DNA extracted from cervical swab sample of Korean women who showed only positive change in cervical Pap smear. After amplification is analyzed by the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that the HPV genotype is a low risk HPV-11 (Example 9).

FIG. 42 shows DNA extraction from HPV E6 / E7 gene and L1 gene in the cervical swab sample of a Korean woman in whom only an obscure atypical squamous cell of unknown significance (ASCUS) was detected. After amplifying the human-type beta globulin (HBB) gene by triplex PCR and analyzing it with the HPV genotyping DNA chip of the present invention, it is a fluorescence scanner photograph showing that the genotype of HPV is HPV-58 of high risk type (Example 9).

43 is a DNA extract from cervical swap specimens of Korean women with microinavasive sqamous carcinoma found in the Pap smear and biopsy of the cervix and HPV's E6 / E7 gene, L1 gene and human body beta globulin (HBB). Amplified by triplex PCR and analyzed by HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that HPV genotype is HPV-16 of high risk (Example 9).

44. Extraction of DNA from cervical swap specimens of Korean women with high grade squamous intraepithelial lesions detected in Pap smears of the cervix. The (HBB) gene was amplified by a triplex PCR and analyzed by the HPV genotyping DNA chip of the present invention, showing that the HPV genotype is a high-risk type HPV-31 (scanner 9).

45 shows DNA extracted from cervical swap specimens of a Korean woman in which HSIL was found by Pap smear test and amplified HPV's E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene by triplex PCR. After the analysis of the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that HPV genotype is HPV-18 of high risk type (Example 9).

46 shows DNA extracted from cervical swap specimens of a Korean woman whose HSIL was detected by Pap smear, and amplified HPV's E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene by triplex PCR. After the analysis of the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that HPV genotype is HPV-58 of high risk type (Example 9).

47 shows DNA extracted from cervical swap specimens of a Korean woman whose HSIL was detected by Pap smear, and amplified E6 / E7 gene, L1 gene, and human-type beta globulin (HBB) gene of HPV by triplex PCR. After the analysis of the HPV genotype diagnostic DNA chip of the present invention is a fluorescence scanner picture showing that the HPV genotype is high-risk HPV-34 (Example 9).

48 shows DNA extracted from cervical swap specimens of a Korean woman who was later confirmed that carcinoma in situ was present in a cervical biopsy, and the HP6 E6 / E7 gene, L1 gene, and human body beta globulin (HBB). Amplified gene by triplex PCR and analyzed by HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing HPV genotype HPV-68 of high risk (Example 9).

Figure 49 shows the extraction of DNA from cervical swap specimens of Korean women with low grade squamous intraepithelial lesions (LSIL) detected by Pap smear in the cervix and HPV's E6 / E7 gene, L1 gene and human body beta. The globulin (HBB) gene was amplified by triplex PCR and analyzed by the HPV genotyping DNA chip of the present invention. The fluorescence scanner photograph showing that HPV genotype was high-risk HPV-56 (Example 9).

50 shows DNA extracted from cervical swap specimens of a Korean woman in which LSIL was found by Pap smear test and amplified E6 / E7 gene, L1 gene, and human-type beta globulin (HBB) gene of HPV by triplex PCR. After the analysis of the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that the HPV genotype is HPV-35 of high risk type (Example 9).

FIG. 51 shows DNA extracted from cervical swap specimens of a Korean woman whose HSIL was detected by Pap smear, and amplified HPV's E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene by triplex PCR. It is analyzed by the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing a complex infection of HPV-18 and HPV-70 (Example 9).

Fig. 52 shows DNA extraction from cervical swap specimens of a Korean woman whose HSIL was detected by Pap smear, and amplified HPV's E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene by triplex PCR. It is analyzed by the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing a complex infection of HPV-16 and HPV-52 (Example 9).

Fig. 53 shows DNA extraction from cervical swap specimens of Korean women with normal findings on Pap smear. Amplification of HPV's E6 / E7 gene, L1 gene, and human type beta globulin (HBB) gene by triplex PCR It is analyzed by the HPV genotyping DNA chip of the present invention is a fluorescence scanner picture showing that HPV is not infected (Example 9)

The present invention is a probe that binds complementarily to nucleic acid of human papillomaviruis (HPV), the main cause of cervical cancer and the most common sexually transmitted disease, DNA chip or microarray comprising the same, and using the same Diagnostic kit for HPV genotyping and a method for analyzing the presence and genotype of HPV using the same.

Human papillomavirus (HPV) is a virus with a structure that covers the genome of double-stranded DNA, and is shaped like a golf ball. The HPV is important to the human body in two respects. First, HPV is the most common sexually transmitted disease (STD) in the human body. More than half of all adult women are infected with HPV at least once in their lifetime. Second, HPV causes hyperproliferation after infection of human epithelial cells. In most cases, hyperplasia is a simple skin wart, external period, stinging around the rash, or benign tumor such as condyloma accuminata. However, HPV may be a cause of cancer, and in fact, almost all uterine cervix cancer or cervical cancer, a large number of head and neck cancers, and many anal cancers have been confirmed by HPV. Howley PM Virology.Vol 2, 1996, 2045-2109; Murinoz N et al., N Engl J Med, 2003, 348: 518-27).

Cervical cancer is one of the leading causes of death among women worldwide, with the highest incidence of cancer among women worldwide after breast cancer, with about 440,000 new cases reported each year. The most common female cancer in developing countries, about 300,000 people die of cervical cancer each year. In Korea, the incidence rate has recently decreased, but according to the 2000 Ministry of Health and Welfare Cancer Registration Survey, about 5,000 new patients are reported. In Korea, cervical cancer (10.6%) ranks third after gastric cancer (15.8%) and breast cancer (15.1%). Recently, young women in their 20s and 30s have experienced a significant increase in the prevalence of HPV, accounting for 32% of all sexually transmitted diseases.

There are two types of HPV: an invasive skin type and an anogenital type that invades the skin and mucous membranes of the outgrowth or erythrocytes. Subdividing the types of HPV, there are more than 120 types, depending on the nucleotide sequence of the genome, ie the phylogenic tree or genotype. Among them, HPV Type 16 (HPV-16), HPV-31, HPV-33, HPV-35, HPV-52, HPV-58, HPV-67, HPV-40, HPV-43, HPV-7, HPV- 32, HPV-42, HPV-6, HPV-11, HPV-74, HPV-44, HPV-55, HPV-13, HPV-61, HPV-72, HPV-62, HPV-2, HPV-27, HPV-57, HPV-3, HPV-28, HPV-29, HPV-10, HPV-54, HPV-18, HPV-39, HPV-45, HPV-59, HPV-68, HPV-70, HPV- Forty-five types of 26, HPV-69, HPV-51, HPV-30, HPV-53, HPV-56, HPV-66, HPV-34, HPV-64 and HPV-73 invade the external phase and erythema. Exogenous HPV is divided into high-risk, low-risk, and / or moderate-risk forms, depending on the risk that it can cause cervical cancer. High-risk HPVs include HPV-16, HPV-18, HPV-26, HPV-30, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51, HPV-52, HPV 22 of the -53, HPV-56, HPV-57, HPV-58, HPV-59, HPV-61, HPV-67, HPV-68, HPV-70, HPV-73, and HPV-82 are included. The most common of these is the high-risk type, HPV-16, followed by the world, but HPV-18, HPV-45, HPV-31, HPV-33, HPV-52, and HPV-58. Occupy. Low risk HPVs include HPV-2a, HPV-3, HPV-6, HPV-10, HPV-11, HPV-32, HPV-34, HPV-40, HPV-42, HPV-43 and HPV-44. About 20 of HPV-54, HPV-55, HPV-61, HPV-66, HPV-69, HPV-70, HPV-72, HPV-81, HPV-CP6108 are mentioned (Murinoz N et al., N Engl J Med, 2003, 348: 518-27).

The genome structure of HPV is largely divided into early transcription region E (late gene region), late transcription region L (late gene region), and non-expressed long control region (LCR). The genomic structure of an HPV has a big impact on the outbreak, risk, and prognosis of the HPV. In particular, the E6 and E7 genes in the E region are expressed while staying in the genome of infected cells and play the most important role in carcinogenesis. The high-risk HPV genes E6 and E7, such as HPV-16 and HPV-18, are the most important tumor suppressor genes, p53 and E6AP, and Rb (retinoblastoma, P105RB), P107, and P130, respectively. In response to neutralizing these tumor suppressor genes. As a result, the cell cycle is turned into cancer cells with impaired mechanisms of cell cycle regulation and apoptosis. In contrast, low-risk HPVs have a low ability to react with p53 or Rb tumor suppressor genes and inactivate them, making it difficult to cause cervical cancer. The largest gene in HPV is L1. L1 appears to have a similar conserved sequence in most HPV types. L1 accounts for most of HPV's capsid protein and is also the most antigenic site (Schneider A. Science 1993; 281: 263-5; zur Hausen H. Semin Cancer Biol 1999; 9: 405-11).

The cervical cells, once transformed by HPV, are treated through dysplasia, cervical intraepithelial neoplasma (CIN), or squamous intraepithelial lesions (SIL), which are precancerous to cancer precursors. It progresses to the so-called carcinoma in situ, and when the epithelial cancer invades the basal layer below the cervical epithelium, it becomes the so-called carcinoma or invasive carcinoma. The majority of women infected with HPV, 90%, naturally lose HPV due to the action of the body's immune mechanisms. However, in about 10% of women with high-risk HPV, HPV persists, leading to precancerous lesions. About 8% of precancerous lesions develop into epithelial cancer, and about 20% of epithelial cancer develops into cancer. In other words, cervical cancer progresses when high-risk HPV infection persists for more than 10-20 years among patients with HPV infection, and the frequency is estimated at about 0.16%. The development of cervical cancer takes a long time, and occurs in stages, so early diagnosis and treatment of precancerous lesions in the middle stage of the onset can be cured or prevented. That is, cancer can be prevented by removing precancerous lesions of the cervix by conservative surgery. Recently, a clinical trial of the vaccine of L1, the main antigen of HPV, is underway for the primary prevention of HPV infection. Attempts have been made to treat cervical precancerous lesions using HPV's E6 and E7 vaccines, which are the main causes of carcinogenesis. However, for HPV vaccines, it is necessary to accurately identify the genotype of each HPV and make a customized vaccine for each (Bosch FX et al., J Clin Pathol, 2002, 55: 244-65. Wallin K et al., N Engl J Med, 1999, 341: 1633-8; Koutsky LA et al., N Engl J Med, 2002, 347: 1645-51).

HPV is very difficult to culture and difficult to diagnose by immunological or serological tests. Because of this, the research is in a stalemate state, and its genotype has been tested in recent 20 years with the development of genetic test methods, and it is used for the diagnosis, prevention and treatment of HPV, and the screening of cervical cancer. Attempts are being made actively.

In particular, the integration of molecular biology and electronics technology has led to the development of genetic DNA chips (or DNA microarrays) that can simultaneously test tens to tens of thousands of genes on a single microscope slide. These DNA chips are a new class of analysis systems that can be widely applied to gene expression analysis, gene diagnosis, gene mutation diagnosis, drug screen and disease diagnosis, and accurate diagnosis of bacterial and viral infections. Accordingly, the development of HPV DNA chips that can quickly and accurately detect high-risk HPV associated with cervical cancer has been widely attempted.

A test that has traditionally been used for the primary screening of cervical cancer and its precursor lesions is a Pap smear. This is a swab or scrape sample of cervical cells with a brush attached to the end of the cervix. Readings of this pap smear are normal and ambiguous atypical squamous cell of unknown significance (ASSCUS), low risk to low grade squamous intraeithelial lesions (LSIL), high risk to high grade High grade squamous intraepithelial lesions (HSILs), carcinoma in situ, to various stages of cancer. The Pap smear is also called the Pap smear after the inventor. Pap Pap smears have been used since the 1940s and have been instrumental in significantly reducing mortality from cervical cancer. However, the Pap test has a disadvantage of having a high false negative rate of 30-40%. This false negative rate is believed to be due to sampling error or inspection error. Recently, liquid based cytology testing under the name of Thin Prep has been attempted to avoid sample taking errors and to minimize reading errors. Nevertheless, the problem is that the false negative rate is still high. In recent decades, attempts have been made to predict the risk of cervical cancer by detecting the presence of HPV infection in cervical cell samples and further genotypes to find high-risk HPV infections. HPV tests have been found to be more accurate in screening cervical cancer than Pap tests.

Recent reports have shown that one HPV test can diagnose almost all high-risk progenitor lesions, and one HPV test is more accurate than two Pap or colposcopic examinations. In addition, when the HPV test is performed together with the Pap test, most problems of the Pap test have been solved, which significantly improves the sensitivity and specificity of the screening of cervical cancer, and it is continuously reported that almost all cervical cancers can be accurately predicted. . This also has the advantage that the interval between screening tests can be increased from one year to three to four years when only Pap tests are performed. Accordingly, the US Food and Drug Administration recently recommends a Pap test and HPV test for screening for cervical cancer (Ledger WJ et al., Am J Obstet Gynecol, 2000, 182: 860-5; Wright TC Jr et al. , JAMA , 2001, 287: 2120-9; Wright TC Jr et al., New Engl J Med, 2003, 348: 6-7; Sherman ME et al., J Natl Cancer Inst, 2003, 95; 46-52 ).

Currently, there are two methods of genetic testing of HPV, which are to examine the presence or absence of HPV infection and the most common type, and the genotyping method to accurately determine the type as well as the presence or absence of HPV infection.

The former method, that is, the representative method used in the clinic for diagnosing HPV infection, is largely divided into a PCR method and a hybridization method. PCR amplifies the major virus capsid L1 gene or E6 and E7 genes, which are the sites where the nucleotide sequence of the exogenous HPV genome is most uniformly preserved, using so-called common primers (consensus primers), and confirmed by electrophoresis. Way. However, it can only detect the presence or absence of HPV infection, its genotype is unknown, and even whether it is high risk or low risk. There is also a risk of false positives and contamination from amplification. A representative method of hybridization is hybrid capturing technology, which extracts HPV DNA from a sample and then uses a high risk HPV probe cocktail or mixture of low risk HPV. There is a hybrid II capture assay (Digene Diagnostics, Inc. USA) that hybridizes with the probe mixture to diagnose the presence of high or low risk HPV. However, the hybrid capturing test has the disadvantage that the exact genotype of HPV is unknown, and there is a weakness of the test because it is not amplified. In a similar manner, a method of observing an enzyme immune reaction by performing a hybridization reaction with a high-risk probe mixture after PCR of a common primer is also shown. This is relatively simple and useful for identifying high-risk HPVs, but the low-risk HPVs cannot be identified and the exact type is unknown (Kornegay JR et al., J Clin Microbiol, 2001, 39: 3530-6). .

A method that has been used to determine the genotype as well as the presence of HPV infection, the most standard method is the post-PCR sequencing method. This is to amplify by PCR a portion of the base sequence in the L1 and E6 / E7 genes of the exogenous HPV and the difference in the base sequence by each type, and to identify the sequence by direct or cloning sequencing analysis. This is the most accurate golden standard test. However, the sequencing method can test only one specimen by one or two tests, and it is difficult to apply to clinical practice because it is time-consuming and expensive and labor-intensive. In addition, in case of complex infection by one or more types of HPV, cloning can be performed, but this is difficult in practice. Because of this, several alternatives to sequencing analysis are being tried.

First, there is a method of PCR several times using a genotype specfic primer for each HPV type. This is confirmed by electrophoresis or Southern blotting of PCR products of various sizes for each HPV gene type. The disadvantage is that the procedure is simple, labor-intensive and inefficient, and only a few types of HPV can be identified. have.

The second is restriction fragment length polymorphism (PCR-RFLP) method after PCR. The L1 to E6 and E7 genes of HPV are amplified by PCR using a common primer and then digested with restriction enzymes. This method is to check the electrophoresis. This has the disadvantage that the classical method is also labor intensive and only a limited number of types of HPV can be identified (Vermon SD et al. J Clin Microbiol, 2000, 38: 651-5).

Thirdly, it has been relatively widely used in the past 6-7 years, and the commercialized method is reverse hybridization line blot detection method. For each type of HPV, a nylon membrane strip prepared with an oligonucleotide probe unique to it was prepared, followed by placing a common primer PCR product of HPV on it, followed by a hybridization reaction. How to figure out. It is used as a PGMY-line blot assay or SFP10 line probe assay (Gravitt PE et al., J Clin Microbiol, 1998, 36: 3020-7; van Doorn L et al., J Clin Microbiol, 2002, 40). : 979-983). These methods are reported to be capable of reading up to 25 to 27 types of HPV. However, these methods are labor intensive and difficult to automate, and do not identify the genotype of the entire outward HPV. In addition, since the determination target site is limited to only 50 base sites of a specific region of the L1 gene, there is a possibility that PCR amplification may not be performed well due to intragenic variation, and the genetic variant is difficult to identify. In addition, the E6 and E7 genes, which play a decisive role in carcinogenesis, cannot be analyzed.

Fourthly, the oligonucleotide microarray or DNA chip in which the oligonucleotide probe is attached to the glass slide for microscopy, instead of the nylon membrane fragment, is subjected to the hybridization reaction after PCR. It has been developed and used (Cho NH et al. Am J Obstet Gynecol, 2003, 188: 56-62). This has the advantage of being more automated than the previous dehybridization method. Other than that, however, it has all the disadvantages of reverse hybridization. In other words, only 22 types can be analyzed without determining the genotype of the entire exogenous HPV, and there is a concern that PCR amplification may not be performed well because the target site of determination is limited to 50 base sites of a specific region of the L1 gene. Is difficult to identify, and the E6 and E7 genes cannot be analyzed.

Ideal HPV genotyping should be (1) diagnose all types, including multiple infections of exogenous HPV, (2) sensitivity, specificity, and reproducibility close to 100%, (3) It should be possible to analyze not only L1 but also E6 and E7 genes, (4) be able to analyze not only wild type sequences but also variants of genes, (5) easy to interpret test methods and test results, and (6) It should be automated and able to analyze multiple samples in a short time. As a result, DNA chips are suitable, but DNA chips with all of these conditions are not yet available. Given the regional characteristics, it is necessary to obtain a sample of cervical cells from a number of Korean women, and to identify the genotype and variation of the invasive HPV by sequencing and to manufacture DNA chips based on the database.

In order to solve the above problems, the present invention is one of the most common causes of sexually transmitted disease in the human body and a probe capable of accurately and automatically diagnose genotype HPV infection, which is the main cause of cervical cancer, with high specificity and sensitivity. The purpose is to provide.

Still another object of the present invention is to provide an oligonucleotide microarray (DNA chip) for detecting genotype HPV or genotyping including the probe.

Still another object of the present invention is to provide a kit for detecting or genotyping genotype HPV, which includes the probe and provides all of the reagents and control samples related to the HPV DNA chip together in an "all in one". .

Another object of the present invention is to provide a method for detecting genotype HPV or genotyping using an oligonucleotide microarray (oligonucleotide microarray, oligo DNA chip) comprising the same or a probe for analyzing the genotype of the HPV.

HPV analysis probe, DNA, kit, and analysis method of the present invention was completed in nine steps as follows.

1. Preparation of Standard and Control Samples

Human cervical cancer cell lines infected with major HPV, 68 cervical cancer tissues of Korean, and 4,898 cervical cell specimens of Korean were prepared. From this, positive and negative control samples were obtained (Example 1).

2. DNA isolation

DNA was isolated by establishing a titration method from various samples in the first step (Example 2).

3. PCR

Oligonucleotide primers were selected and designed for amplification of HPV's E6 / E7 gene, L1 gene, and human beta globurin gene, and appropriate PCR conditions were established. PCR was established in different conditions by single (duplex PCR), duplex (PC), and triplex (triplex PCR). In addition, PCR was performed on the HPV E6 / E7 gene, HPV L1, and the human beta globulin gene using the DNA isolated in step 2 as a casting (Example 3).

4. Sequencing Analysis and Cloning

After PCR, the sequencing reaction was performed to analyze the nucleotide sequences of HPV-E6 / E7 and HPV L1 and to organize the data to construct a database. In addition, PCR products identified for each HPV type was cloned (cloning) in the plasmid vector. This clone was then used as a standard and control sample when establishing the reaction conditions of the DNA chip of the present invention. Clinical DNA specimens identified with HPV genotype were stored and used for the accuracy analysis of the DNA chip of the present invention (Examples 4 and 5).

5. Probe design of DNA chip

The most important, according to the database of HPV E6 / E7 and L1 found in the clinical sample for HPV genotyping of Korean cervical cells of four stages and foreign HPV related database, L1 of 40 types of exogenous HPV And oligonucleotide probe (E6 / E7, and human beta globulin, respectively) can be identified on the DNA chip by hybridization reaction (Example 6).

6. Fabrication of DNA Chips

A grid to integrate the probe designed in step 5 was devised. Accordingly, the probe mixed in the titration buffer (arraying or spotting) on the glass slide for microscope. After stabilization through appropriate treatment and quality control was stored until inspection (Example 7).

7. Establish reaction and assay conditions on DNA chips

Multiplex PCR amplification of the genes of HPV E6 / E7, HPV L1, and betagloburin using standard specimens containing one, two, or three clones of each type of HPV established in the preceding 4 in various combinations and concentrations. After that, the product was placed on a DNA chip and subjected to a hybridization reaction several times, and then analyzed by a fluorescence scanner to establish appropriate conditions (Example 8).

8. Clinical Sample Analysis on DNA Chips

After performing PCR multiplexing on the DNA of clinical specimens with the presence and the type of HPV by the sequencing reaction after the PCR in steps 3 and 4, the PCR product was prepared by the DNA chip prepared in step 6. On top of this, the hybridization reaction was carried out under the conditions established in step 7, and then washed and analyzed by fluorescence scanner. As a result, the sensitivity, specificity, and reproducibility of the DNA chip were analyzed, and the optimum conditions of the DNA chip of the present invention for the diagnosis of HPV genotype were established again (Example 9).

9. Correlation analysis with clinical data after analyzing clinical sample in DNA chip

In step 8, the result of PCR analysis was analyzed by DNA chip and compared with clinical data such as cervical cytology test. The correlation was analyzed by using this DNA chip to predict cervical cancer or precancerous lesion. As a result, it was confirmed that this DNA chip was useful not only for the analysis of genotype of HPV but also for screening cervical cancer (Example 10).

The diagnostic kit using the DNA chip of the present invention includes: 1) a reagent for collecting clinical samples such as a cervical swab and a DNA extraction reagent from the sample, 2) a reagent for PCR amplification of E6 / E7 and L1 and betagloburin genes of HPV, 3 4) plasmid DNA clone to be used as a positive control for HPV gene amplification, 4) oligo DNA chip for HPV genotyping, and 5) all-in-one containing both the reaction solution required for the hybridization reaction using the DNA chip and the washing solution after the reaction ( "all in one").

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are only examples for demonstrating the constitution and effects of the present invention, and the present invention is not limited to the following examples.

Example 1: Preparation of Standard and Control Specimens

First, samples were prepared to be standard, reference and control for subsequent genotyping and analysis.

The first sample shows whether HPV has been infected in the past, and the type of HPV. The human cervical cancer cell line, which has been widely used for HPV genotyping, has been used by US ATCC (Manassas, VA20108, USA) and Korea Cell Line Bank. (KCLB) (Seoul National University College of Medicine Cancer Research Institute, KOREA) was purchased and used as a monolayer (monolayer). These details are shown in Table 1.

The second sample was used to obtain cervical tissue from 68 Korean women who were confirmed by biopsy and surgery for cervical cancer or intraepithelial cancer of the cervix. After formalin fixation, the tissues stored in the formal-fixed (paraffin-embedded status) were obtained by 5-10 pieces in 10 μm thick sections, and the cells were placed on a glass slide for microdissection. Among the 68 cervical cancer lesions, 61 cases were cervical squamous cell carcinoma and 7 cases were cervical intraepithelial neoplasma (CIN). Their age distribution ranged from 32 to 69 years with an average age of 49 years.

Third, from 2003, 4,898 cervical specimens were examined at the gynecology clinic in Korea through the Hamchun Diagnostic Center (Seoul, South Korea) and the Korean Gynecologic Cancer Foundation (Seoul, South Korea). . The age distribution was 0.2% for 16-19 years old, 18% for 20s, 38% for 30s, 32% for 40s, 7% for 50s, 1% for 60s, and 3% for others. In 4741 of these cases, HPV test and cytology and / or biopsy of the cervix were performed to provide a cytological and histological diagnosis. Cervical cells were collected by inserting a Pap brush from Sanga Medical (Songpa-gu, Seoul, Korea) or a cotton swab to the inside of the cervix and turning them from side to side to allow the cervical cells to accumulate well. Afterwards, the tip of the Pap brush or swab was moved and stored by placing the tip of the brush in a tube with a sterile transfer buffer and a screw cap. Here, 3 ml of CytoLyt Solution (CYTYC Corporation, MA 01719, USA) was mainly used as a mobile buffer.

Table 1. Breakdown of control cell lines

Cell line name  HPV Infection Mold of Infected HPV ATCC 45022 + HPV-2a ATCC 45150 + HPV-6b ATCC 45151 + HPV-11 ATCC 45113 + HPV-16 ATCC CRL-1550 (CaSki) + HPV-16 ATCC 45152 + HPV-18 ATCC CCL-2 (HeLa) + HPV-18 ATCC 65446 + HPV-31 ATCC 40331 + HPV-35 ATCC 40338 + HPV-43 ATCC 45353 + HPV-44 ATCC 45548 + HPV-56 KCLB-10243 * -

Example 2: DNA Separation

DNA was isolated by the following method by establishing a titration method from various samples collected in Example 1.

In order to separate DNA from cell lines, single cell cultured cells were separated and placed in a 50 ml centrifuge tube, centrifuged at 3500 rpm for 30 minutes, discarded the supernatant, and pelleted with 500 μl of PBS solution. After transfer, the resultant was further centrifuged at 12,000 rpm for 2 minutes and washed to remove the remaining medium. Then, 200 μl of PBS solution and 20 μl of protease K (20 μg / μl) were added to the cell pellet and mixed with a shake mixer. After 200 μl of GC solution was added and mixed, the solution was dissolved in a 60 ° C. heating block for 20 minutes. Add 100 µl of isopropanol to the finished sample and mix. Put all the solution in the column for filtration (column), centrifuged for 1 minute at 10000rpm, discard the filtrate passed through the column, and then put into 500μl W1 buffer and centrifuged. Then, 500 μl of W2 buffer was added and centrifuged again. The empty column was centrifuged at 12,000 rpm for 2 minutes to completely remove ethanol. Thereafter, 60 µl of sterile distilled water was added thereto, followed by 10 minutes, followed by centrifugation at 1200 rpm for 2 minutes to obtain DNA.

Also, in order to separate DNA from paraffin-embedded cervical tissue, cervical tissue attached to a glass slide for microscopy with a thickness of 10 μm is pin point slide DNA isolation system (Zymo Research, CA, USA). Only cancer cells were micro-leaved using. About 1000 to 2000 cells were obtained for each slide in the liquid phase, and all of them were collected and transferred to a microcentrifuge tube, followed by two treatments with 1 ml xylene to remove paraffin and excess xylene with anhydrous ethanol. 100 μl DNA extraction and cell lysis buffer (50 mM KCl, 10 mM Tris-HCl [pH 8.3], 2.5 mM MgCl ₂ , gelatin, 0.45% IGEPAL, 0.45% Tween 20) After treatment with proteinase K [60 μg / ml]), the reaction was carried out at 55 ° C. for 3 hours and then warmed to 95 ° C. for 10 minutes to inactivate proteinase K. Supernatants were used for PCR after centrifugation.

To isolate DNA from cervical swab samples, the DNA was concentrated and purified using AccucupLab Genomic DNA Extraction Kit (Cat.No. K-3032, Bioneer, Korea). Same as 1.5 ml of cervical cell smear samples were taken and centrifuged at 12.000 rpm for 2 minutes in a centrifuge, and 1.5 ml of phosphate buffer (PBS) was added to the precipitated cells, followed by washing with an appropriate amount of proteinase K and cell lysis buffer. After the addition, incubate at 60 ° C. for 20 minutes. The reaction solution was passed through a DNA binding column using a centrifuge, washed with centrifuges with washing solutions 1 and 2, and then 100 ul of DNA elution buffer was added to recover DNA. It was.

Example 3: PCR Amplification

To test the genotype of HPV, first, the E6 / E7 gene and the L1 gene of HPV were amplified by PCR, and the human-type beta globurin gene was amplified by internal control.

Oligonucleotide primers were first selected and designed for these PCR amplifications. The primers include the HPCF / HPCR primer for detecting the E6 / E7 gene of HPV, the MY11 and GP6-1 primers for detecting the L1 gene (SEQ ID NO: 1), and the beta of the human body used to confirm the efficiency of DNA extraction and PCR. It consists of the HBBF / HBBR primers of the Groburin gene. GP6-1 primers are designed and the remaining primers are selected from known primers. The PCR of the HPV E6 / E7 gene amplifies the product of about 225 bp in length, the PCR of the HPV L1 gene of 182 bp and the beta globulin gene PCR amplifies the product of 110 bp in length, respectively. Base sequences of PCR primers for each gene are summarized in Table 2, and PCR reaction conditions are as follows.

PCR was established differently in single, duplex, and triplex to establish the appropriate conditions for each. Accordingly, PCR was performed on HPV E6 / E7, HPV L1, and human beta globulin genes using the DNA isolated in Example 2 as a casting. The method of PCR is as follows.

1. Single PCR

The PCR reaction composition for detecting HPV infection was obtained from SuperTaq plus pre-mix (10 × buffer 2.5 μl, 10 mM MgCl ₂ 3.75 μl, 10 mM dNTP 0.5 μl, Taq purchased from Super Bio, Seoul, Korea). Based on 15 μl of polymerase 0.5 μl) and 1 μl (10 pmoles / μl) of primers of MY11 / GP6-1, HPCF / HPCR, and HBBF / HBBR, respectively, as described in Table 2. 4.0 μl (150 ng / μl) of template DNA was added and the total reaction solution was adjusted to 30 μl in distilled water.

The reaction solution containing HBB primers for PCR of human beta globulin is predenaturated at 95 ° C. for 5 minutes, and then repeated for 40 cycles at 95 ° C. 30 seconds, 50 ° C. 30 seconds, and 72 ° C. 30 seconds. And extension at 72 ° C. for 5 minutes.

Reaction solution containing HPCF / HPCR primer for PCR of HPV E6 / E7 was premodified at 95 ° C. for 5 minutes, then repeated for 40 cycles at 95 ° C. 30 seconds, 56 ° C. 30 seconds, 72 ° C. 30 seconds, and 72 Extension was carried out for 5 minutes at < RTI ID = 0.0 >

The reaction solution containing the MY11 and GP6-1 primers for the PCR of L1 of HPV was premodified at 95 ° C. for 5 minutes, followed by 40 cycles of 95 ° C. 30 sec, 50 ° C. 30 sec, 72 ° C. 30 sec, and 72 ° C. Extension was performed for 5 minutes.

2. Duplex PCR

The primer combination of duplex PCR for detecting HPV infection is (1) the combination of HPCF / HPCR primer for detecting E6 / E7 gene of HPV and HBBF / HBBR primer of betagloburin gene and (2) for detecting L1 gene of HPV. It consists of two combinations of a MY11 / GP6-1 primer and a betagloburin primer.

HPV E6 / E7 and HBB gene duplex PCR proceeded as follows. The PCR reaction mixture was mixed with 1 μl (10 pmoles / μl) of HPCF / HPCR primer and HBBF / HBBR primer in 15 μl of SuperTaq plus pre-mix solution, and then added 4.0 μl of template DNA (150 ng / μl) in distilled water. The reaction solution was prepared by adding 30 μl in total. The PCR reaction was premodified at 95 ° C. for 5 minutes, and then repeated for 10 cycles of 95 ° C. 1 minute, 47 ° C. 1 minute, 72 ° C. 1 minute, and then 95 ° C. 1 minute, 50 ° C. 1 minute, and 72 ° C. Repeated for 30 minutes at 1 minute and extended for 5 minutes at 72 ℃.

Duplex PCR of HPV L1 and beta globulin gene was performed as follows. PCR reaction composition was mixed with 1 μl (10 pmoles / μl) of MY11 / GPG-1 and HBBF / HBBR primers in 15 μl of SuperTaq plus premix solution. The reaction solution was prepared by adding 30 μl in total. The PCR reaction was premodified at 95 ° C. for 5 minutes, followed by 10 cycles of 95 ° C. 1 minute, 47 ° C. 1 minute, and 72 ° C. 1 minute, followed by 95 ° C. 1 minute, 50 ° C. 1 minute, and 72 ° C. The procedure was repeated for 30 minutes at 1 minute and extended at 72 ° C. for 5 minutes.

3. Triplex PCR

Triplex PCR of HPV E6 & E7, L1 and HBB gene was performed as follows.

PCR reaction composition was prepared by adding 15 μl of MY11 / GP6-1, HPCF / HPCR, and HBBF / HBBR to 15 μl of SuperTaq plus pre-mix solution, and adding 1 μl (10 pmoles / μl) of template DNA 4.0. ㎕ (150ng / ㎕) was added and distilled water was added to form a reaction solution with a total of 30㎕. The PCR reaction was premodified at 95 ° C. for 5 minutes, followed by 10 cycles of 95 ° C. 1 minute, 47 ° C. 1 minute, and 72 ° C. 1 minute, followed by 95 ° C. 1 minute, 50 ° C. 1 minute, and 72 ° C. This was repeated for 30 minutes at 1 minute and extended at 72 ° C. for 5 minutes.

The results of this experiment are illustrated in FIGS. 1 to 5. 1 to 5 it was confirmed that the conditions of the single, duplex and triplex PCR of HPV was properly established, showing that the PCR is well performed in cervical swap samples and paraffin embedded cervical cancer tissue.

The PCR results of HPV L1 and E6 / E7 genes for 4,898 clinical specimens of cervical cells are shown in Table 3. PCR was positive in 1,414 cases, and it should be noted that only 50% of them were L1 and 66% were E6 / E7. Only one of the L1 and E6 / E7 genes was detected. When searching, the frequency of not finding HPV was 50.2% and 34.7%, respectively. This can lead to the loss of a significant number of HPVs when searching for HPV in cervical cells, such as commercially available HPV reverse line hybridization kits or similar DNA chips. Strongly suggests In addition, in order to accurately detect HPV, not only L1 but also E6 / E7 are amplified by PCR to indicate that the base sequence needs to be confirmed. This was the important reason for devising the original HPV genotype DNA chip of the present invention.

Table 2. Primers for PCR

gene SEQ.ID.No. designation Sequence (5 '-3') Length HPV L1 One MY11 (forward direction) GCMCAGGGWCATAAYAATGG 20mer 2 GP6-1 (Reverse) AATAAACTGTAAATCATATTCCTC 24mer HPV E6 / E7 3 HPCF (Forward) TGTCAAAAACCGTTTGTGTTC 21mer 4 HPCR (Reverse) GAGCTGTCGCTTAATTGTCC 20mer Beta globurin 5 HBBF (Forward) ACACAACTTGTGTTCACTAGC 21mer 6 HBBR (Reverse) CAAACTTCATCCACGTTCACC 21mer

Table 3. Results of HPV PCR of Cervical Cell Specimens in Korea (Total 4,898 Cases)

Infected DNA Positive PCR result (%) Positive sequencing confirmation (%) HPV-E6 / E7 924 (65.3) 649 (64.1) HPV-L1 704 (49.8) 553 (54.6) both 214 (15.1) 96 (9.5) One of the two 1200 (84.9) 917 (90.5) all 1414 (100) 1013 (100)

Example 4: Sequencing Analysis and Database Construction

After PCR amplification of Example 3, the sequencing analysis (automated sequencing analysis) was performed with the PCR product to analyze the nucleotide sequences of HPV-E6 / E7 and HPV L1 and to organize the data to build a database. In addition, the clinical DNA samples of HPV genotype were stored and then used for the accuracy analysis of the DNA chip of the present invention.

The method of sequencing reaction is as follows.

PCR products were sequenced using an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin Elmer Biosystems, USA), and then sequenced using an ABI Prism 377 automatic sequencing analyzer (Perkin Elmer, USA). This was done in the following order.

(1) The PCR product obtained in each sample obtained in Example 4 is adjusted to the most suitable concentration for use as a casting of the sequencing reaction. For example, if it is 100-200bp long, 1-3ng / μl is needed, and if it is 200-500bp long, about 3-10ng / μl) is required.

(2) Put 8 µl of each PCR product and 3.2 pmole of primer and terminator ready reaction mix into a thin wall microcentrifuge tube. Add sterile distilled water to make 20 µl of final mixing.

(3) Cycle sequencing of the mixture of (2) was carried out using Genamp 2700 (PE Biosystems, USA) at 25 ° C for 10 seconds at 96 ° C, 5 seconds at 50 ° C, and 6 minutes at 60 ° C. Was performed.

(4) The obtained reactant was precipitated with ethanol and centrifuged to remove fluorescence labeled ddNTPs in free primer and terminator ready reaction mix and dried.

(5) The DNA obtained in (4) was mixed with formamide: 25 mM EDTA (pH 8.0): bluedextran mixture and 10 µl of loading buffer, denatured in boiling water for 5 minutes, and then the sample was cooled and stored. do.

(6) The denatured DNA sample of (5) was loaded into each well of a plate previously casted with 5.5% long ranger gel (BMA, Cat No. 50611, USA) and subjected to electrophoresis for 2-4 hours. The sequence was analyzed by the sequencer.

PCR-sequencing analysis of cervical cancer samples revealed HPV in all 68 cases. All of the types found were so-called high-risk types. Among them, HPV type 16 was 33 cases, type 58 was 12 cases, type 31 was 11 cases, type 18 and 35 were 4 cases, type 33 was 3 cases, respectively. This accounted for 99%. Complex infection types could not be detected by PCR-sequencing.

Sequences of L1 and E6 / E7 of each HPV type were analyzed by sequencing of 1,414 positive cervical swabs among 4,898 cervical swabs collected from an obstetric clinic for early screening of cervical cancer in Korean women. The results of the analysis are summarized in Table 4, examples of which are shown in FIGS.

Of 4,898 cervical cell specimens in Korean women, 1,013 cases of HPV infection were confirmed in 2 cases. There were 35 types of HPV found, 15 of which were high risk, 11 of low risk, 4 of medium risk and 5 of unknown type. Among the HPVs found, the so-called high-risk type was 838 cases (82.7%), and the overall frequency was 17.1%. The results of this high-risk HPV bias were due to the fact that all women in the test were HPV-tested for early screening for cervical cancer. Accurate identification of the type's HPV is consistent with the main purpose of this study. In terms of the type of HPV found, HPV 16 is also the most common, followed by HPV-58, followed by HPV-31, HPV-52, HPV-33, HPV-53, HPV-35, In order of HPV-18. These data are distinctly different from those in the West, after HPV-18, followed by HPV-18, followed by 45, 52, 31, 33, and 58 (Murinoz N et al., N Engl J Med). , 2003, 348: 518-27).

Another thing to note is that among the nucleotide sequences of HPV E6 / E7 found in the study of the present invention differ from the wild type nucleotide sequence described in the Western HPV database, mutant nucleotide sequences have not been reported in Korea so far Is that many appeared. They were especially found in E6 / E7 of high risk HPV. They may play an important role in the development of cervical cancer in Koreans.

In addition, as described in Example 3, in the case of a swap sample of cervical cells, only 50% of all HPV infections were detected by testing only HPV L1 when analyzed by PCR sequencing. Examination of HPV E6 / E7 together revealed a discovery. In addition, it was soon understood that HPV sequences unique to Korean women should be considered. The results of detailed studies of HPV genotypes in Korean women are as follows: (1) analysis of L1 and E6 / E7 of HPV together, and (2) the design of the original DNA chip of the present invention considering the nucleotide sequence of female HPV in Korea. It became the basis.

Table 4. PCR-Sequencing Analysis of HPV in Cervical Swap Specimens in Korean Adult Women

Total samples 4898 HPV Discovery Samples (%) 1414 (28.9%) HPV Types Detected and Number of Samples (%) 1013 (20.7%) Risks HPV type Case  % High risk 16 351 35 18 27 3 31 83 8 33 52 5 34 One 0 35 35 3 39 8 One 52 59 6 53 40 4 56 5 0 58 131 13 66 22 2 67 8 One 68 10 One 70 6 One Low risk 6 25 2 11 15 One 54 2 0 61 28 3 62 13 One 63 One 0 64 One 0 72 3 0 74 One 0 83 / MM7 6 One LVX160 19 2 Medium risk 82 / MM4 2 0 84 / MM8 14 One CP4173 6 One Cp8304 19 2 Unknown 71 8 One 87 One 0 CP8061 6 One IS887 4 0 JC9710 One 0 all 1013 100

In Figures 26 and 27, peaks on the electrophoresis are superimposed, which is a phenomenon when several different casting DNAs are analyzed, that is, when a plurality of types of HPV are mixed. It can only be confirmed by a blast search. This indicates that the PCR product should be cloned to resequence and analyze multiple clones. In this case, the DNA chip of the present invention that can diagnose the complex HPV infection is very useful. In this case, the DNA chip of the present invention is a complex infection of HPV-18 and HPV-70 (see FIG. 51) and HPV-16, respectively. It was later confirmed that there was a combination infection of HPV-52 (see FIG. 52).

Example 5: Cloning for HPV Analysis

PCR products identified by the specific HPV genotype by PCR sequencing reaction of Example 4 were cloned (cloning) using a plasmid vector and E. coli. This clone was then used as a standard and control sample when establishing the reaction conditions of the DNA chip of the present invention. The cloning method is as follows.

1) PCR products of the PCR-amplified E6 / E7 gene and L1 gene were isolated from agarose gel using a gel recovery kit (Zymo Research, USA), and the concentrations thereof were measured on a spectrophotometer or agarose gel. .

2) pGEM stored at -20 ℃ ^? -T Easy Vector (Promega, A1360, USA) and 2 x Rapid Ligation Buffer are melted and agitated by shaking the tube slightly with your fingertips, then gently centrifuged and mixed with the insert DNA to be cloned at the following ratio It was placed in a 0.5ml tube and prepared for ligation.

Table 5.

Standard response Positive control group Background control 2x Rapid Ligation Buffer, T4 DNA Ligase 5 μl 5 μl 5 μl pGEM ^? -T Easy Vector (50ng) 1 μl lμl 1 μl PCR product                                          X μl ^* - - Control Insert DNA - 2 μl - T4 DNA Ligase (3 Wess units / μl) 1 μl 1 μl 1 μl Final volume 10 μl 10 μl 10 μl ^* The PCR product and the plasmid vector 3: adjusted such that the ratio of 1: 1 that is, mixed with the vector of 50ng of the 3.0 kb PCR product size of 0.25 or 0.45 kb in size respectively, 12.4ng and 22.5ng.

3) After each reaction solution was mixed well with a pipette, the reaction was performed at room temperature for about 1 hour. If desired, a large number of products were reacted overnight at 4 ° C.

4) The linked samples were transformed using 50 μl of JM109 competent cells (≥1 × ^{10 8} cfu / μg DNA) stored at minus 70 ° C.

5) First, add 2 µl of the above-connected product to a 1.5 ml tube, and 50 µl of competent cell of 4) dissolved in an ice bath immediately before mixing. After mixing well, react for 20 minutes on ice.

6) Heat shock for 45-50 seconds in 42 ℃ constant temperature water bath and immediately put it back in ice bath for 2 minutes.

7) 950 μl of SOC medium adjusted to room temperature was added thereto and incubated for about 1 hour and half on a shaker at 37 ° C.

8) Place about 100µl of this on LB / ampicillin / IPTG / X-Gal plate, invert the plate, incubate for 16-24 hours on a 37 ℃ shaker, and perform colony counting. After that, only white colonies were selected and incubated in 3ml LB / ampicillin broth, and then minipreps the plasmid DNA to check whether the inserted DNA was correctly inserted by PCR or restriction enzymes. All of the clones obtained above were analyzed using an automatic sequence analyzer.

Example 6 Probe Design of DNA Chip

This is the process of designing the oligonucleotide probe to be placed on the DNA chip, which is the core of the present invention. In Examples 4 and 5, DNAs were isolated from positive and malignant cervical specimens of Koreans and analyzed for a vast database of nucleotide sequences of E13 / E7 and L1 of 1,013 HPV identified by PCR sequencing and HPV database of the United States. We then analyzed the frequency of HPV genotypes and the intra variant sequences of each gene according to genotypes. Accordingly, 40 types of genital type HPVs invading the cervix were selected and oligoprobes were designed to search for their genotypes. The nucleotide sequences are summarized in Table 5.

Probe design designs oligonucleotides as genotype specific probes capable of specifically binding to DNA of L1 genes and E6 / E7 genes of 40 types of various HPVs in accordance with the purpose of the present invention. It was.

First, (1) the HPV database of the US National Center for Biotechnology Information (NCBI) and (2) the US National Los Alamos HPV database, and (3) the 35 types of cervix found in the cervix of Korean women in Example 4. Aggregate all of the HPV's databases: HPV-1a, -2a, -3, -4, -5, -6b, -7, -8, -9, -10, -11, -12, -13, -15, -16, -16r, -17, -18, -19, -20, -21, -22, -23, -24, -25, -26, -27, -28, -29, -30, -31 -32, -33, -34, -35, -35h, -36, -37, -38, -39, -40, -41, -42, -44, -45, -47, -48,- 49, -50, -51, -52, -53, -54, -55, -56, -57, -58, -59, -60, -61, -63, -65, -66, -67, A total of 76 HPV types of genomic DNA sequences of -68, -70, -72, -73, -75, -76, -77, -80, MM4, MM7, MM8, and CP8304 were obtained. Using the computer program DNASTAR (MegAlign ^TM 5, DNASTAR Inc.), the acquired DNA sequence is subjected to pairwise alignment and multiple sequence alignment using the ClustalW method, and then to create a Phylogenetic tree. After selecting the type specific sequences for each group, the type specific probes were designed using the computer program primer premier 5 (PreMIER Biosoft International Co.). In this case, the length of the probe was set to 20 ± 2 and 18 ± 2 bp of oligonucleotides to design 110 types of specific probes. The genotype diagnostic DNA chip and kit of HPV according to the present invention, the DNA probe is a high risk HPV 8 E6 & E7 gene, 20 high risk HPV L1 genes, 17 low risk HPV L1 genes, 3 medium It is characterized by searching and targeting 40 kinds of L1 gene of HPV up to L1 gene of risk type HPV. The high-risk HPVs here are HPV-16 and HPV-18, HPV-31, HPV-33, HPV-35, HPV-52, HPV-58, HPV-67, HPV-26, HPV-30, HPV-34 , HPV-39, HPV-45, HPV-51, HPV-53, HPV-56, HPV-57, HPV-66, HPV-68, HPV-70, and low-risk HPVs include HPV-6, HPV-7, HPV-10, HPV-11, HPV-27, HPV-32, HPV-40, HPV-42, HPV-44, HPV-54, HPV-55, HPV-59, HPV-61, HPV- 62, HPV-72, HPV-73 and HPV-83 were selected, and HPV-MM4 / 82, HPV-MM8 / 84 and HPV-CP8304 / 81 were selected as the medium risk HPV.

A total of 110 probes designed in this process were analyzed using a computer program (Amplify 1.2, University of Wisconsin) to analyze the virtual binding capacity of a total of 76 different HPV types already acquired during the design process. In this example, HPV-16, HPV-58, HPV-31 and HPV-33 probes, which are common in Korean and directly related to cervical cancer, were designed. Next is HPV-39, HPV-45, HPV-51, HPV-56, HPV-59, HPV-61, HPV-68, HPV-70, HPV-73, HPV-74, HPV-6, HPV-7 For HPV-11, HPV-32, HPV-34, HPV-40, HPV-42, HPV-44, HPV-55, and HPV-66, respectively Selected. The names, sequence numbers and types of probes are summarized in Table 5.

Table 6. Base sequences of oligonucleotide probes

SEQ. ID. No. designation Sequences (5 '-3') Length 7 16 W TTGTTGCAGATCATCAAGAA 20mer 8 18 W CACGACAGGAACGACTCC 18mer 9 31 W CAAGTGTAAACATGCGTGG 19mer 10 33 W CTGTGACGTGTAAAAACGCC 20mer 11 35 W GTCCTGTTGGAAACCAAC 18mer 12 52 W GACCCCGACCTGTGACC 17mer 13 58 W CCGACGTAGACAAACAC 17mer 14 67 W GAAGCCATGCGTGGAG 16mer 15 16L1 TGCCATATCTACTTCAGAAACT 22mer 16 18L1 TGTTTGCTGGCATAATCAATTA 22mer 17 31L1 GTCTGTTTGTGCTGCAATT 19mer 18 33L1 CAGTACTAATATGACTTTATGCACA 25mer 19 35L1 TCTGCTGTGTCTTCTAGTGACAGTA 25mer 20 52L1 TGACTTTATGTGCTGAGGTTAAA 23mer 21 58L1 GCACTGAAGTAACTAAGGAAGGTAC 25mer 22 67L1 AAAATCAGAGGCTACATACAAAA 23mer 23 26L1 CCTTACCATTAGTACATTATCTGCA 25mer 24 30L1 AACCACACAAACGTTATCCA 20mer 25 34L1 CCACAAGTACAACTGCACC 19mer 26 39L1 ACCTCTATAGAGTCTTCCATACCTTCTAC 29mer 27 45L1 CACAAAATCCTGTGCCAAG 19mer 28 51L1 GGTTTCCCCAACATTTACTC 20mer 29 53L1 GCAACCACACAGTCTATGTCTACA 24mer 30 56L1 GACTATTAGTACTGCTACAGAACAGTTAAGTAAA 34mer 31 57L1 CCACTGTAACCACAGAAACTAATT 24mer 32 66L1 AATGCAGCTAAAAGCACATTAACTAA 26mer 33 68L1 CTACTACTACTGAATCAGCTGTACCAAATAT 31mer 34 70L1 CCGAAACGGCCATACCT 17mer 35 MM4L1 / 82 CATTTGCTGGAATAATCAGC 20mer 36 MM8L1 / 84 TATATGCTGGTTTAATCAATTGTT 24mer 37 CP8304L1 / 81 GCTACATCTGCTGCTGCAGA 20mer 38 6L1 TTTGTTGGGGTAATCAACTG 20mer 39 7L1 ACACCAACACCATATGACAATA 22mer 40 10L1 GCAGTACCAATATGTGCTGTG 21mer 41 11L1 ATTTGCTGGGGAAACCAC 18mer 42 27L1 CAGCTGAGGTGTCTGATAATACTAAT 26mer 43 32L1 GACACATACAAGTCTACTAACTTTA 25mer 44 40L1 AGTCCCCCACACCAAC 16mer 45 42L1 CACTGCAACATCTGGTGA 18mer 46 44L1 TACACAGTCCCCTCCGTC 18mer 47 54L1 TACAGCATCCACGCAGG 17mer 48 55L1 CTACAACTCAGTCTCCATCTACAA 24mer 49 59L1 TCTATTCCTAATGTATACACACCTACCAG 29mer 50 61L1 TGCTACATCCCCCCCTGTAT 20mer 51 62L1 ACTATTTGTACCGCCTCCAC 20mer 52 72L1 CACAGCGTCCTCTGTATCAGA 21mer 53 73L1 AGGTACACAGGCTAGTAGCTCTACTAC 27mer 54 MM7L1 / 83 TGCTGCTACACAGGCTAATGA 21mer 55 HBB GAGGAGAAGTCTGCCG 16mer

Example 7: Preparation of DNA Chip

After devising a grid according to the probe designed in Example 6, the probe mixed in a titration buffer was integrated on a glass slide for microscope. After that, it was stabilized through proper treatment and stored until inspection through quality control.

The manufacturing process of DNA chip is as follows.

1. Create an order grid of HPV genotyping probes to be placed on DNA chips

In the present invention, a grid was prepared by grouping the searched genotypes according to the HPV genotype on a single chip so that the genotypes of the HPV genotypes can be easily identified. The flowchart is the same as FIG. According to FIG. 28, eight HPV high-risk type E6 / E7 probes and 20 HPV high-risk type L1 probes are integrated on the left side, and HPV medium-risk type L1 probes are integrated on the right side. There were integrated HPV low risk 17 types of L1 probes. In addition, two oligonucleotide probes specific to the human beta globulin gene for quality control (QC) of corner markers and DNA isolation and PCR amplification were integrated at the top left and top to bottom. The right side was integrated to be located at the bottom.

In addition to the human beta globurin gene, actin and glyceraldehyde-3-phosphate dehydrogenase gene may be used as a reference marker probe.

Each oligonucleotide probe was direct using an arrayer. At this time, by integrating the same probe in a duplicate (duplicate) was designed so that the genotype of each HPV is at least two times, at most four times. There are four main reasons for adding oligoprobes specific to the E6 / E7 genes of eight HPVs in the present invention. First, these eight genotypes are the most frequent types in the world, including Koreans. Second, these eight types of HPV are representative high risk types and are closely related to the development of cervical cancer. Third, it is important to know the genotype of their E6 / E7 when they want to administer a therapeutic vaccine against high risk HPV. Fourth, the L1 gene may not be amplified by PCR due to intragenic variation in the PCR process, and these blind spots need to be supplemented by amplification of the E6 / E7 gene. This is the basis of the original design of the DNA chip of the present invention, and plays an important role in increasing the accuracy of analysis of the HPV genotype of the DNA chip.

One of the important features of the DNA chip of the present invention is to use a compartment cover so that the grid as shown in FIG. 28 is repeatedly divided into 6 to 8 compartments on one chip (see FIG. 29). This allows searching for six to eight different samples on a single chip, which is very useful for saving time, manpower and cost.

2. Preparation of the solution to be spattered with the synthesized oligoprobe and dispensing into a master plate

Oligonucleotides prepared according to Example 6 and prepared by attaching amines to C6 sites were synthesized and purified using HPLC, and then dissolved in tertiary distilled water to a final concentration of 200 pmole / μl. The oligoprobes thus prepared were mixed with a micro spotting solution Plus (Telechem, TC-MSP, USA), a spotting solution, to a concentration of 38 pmole / μl. That is, 32.4 μl of the spotting solution is mixed with 7.7 μl of 200 pmole / μl oligoprobe to 40 μl. The mixture thus prepared was dispensed into 96-well master plates in order.

3. Integrate oligoprobe on glass slide using arrayer

The oligoprobe-containing spotting solution from the 96-well master plate prepared above is spotted and arrayed onto a specially coated glass slide using an arrayer. In one spot, an average volume of probe solution of about 0.005 μL is accumulated. As a raw material for the chip, BMT aldehyde glass slide coated with super aldehyde (Biometrix technology, Korea) is suitable. For arrays, GMS 417 arrayer (Pin-Ring Type, Affymetrix, USA) or MGII (Biorobotics Inc, MA01801, USA) or equivalent equipment is suitable.

4. Induction and post-treatment of Schiff base reaction between integrated oligoprobes and aldehyde groups of glass slides

As described above, the DNA chip prepared by integrating the probe on the glass slide is placed in a glass jar maintained at a humidity of 80% and reacted at room temperature for 15 minutes. After the reaction is completed, the fixed slide is dried in a dryer oven. After baking at 120 ° C. for 1 hour and 30 minutes, the slides were washed twice in a 0.2% sodium dodecyl sulfate (SDS) solution for 2 minutes, then transferred to tertiary distilled water and washed twice for 2 minutes. , an oligonucleotide soak 3 minutes immobilized on the floating geoun deionized water of 95 ℃ and denaturation (denaturation) the nucleotide probe again transferred to deionized water and washed 1 minute. slides finish washing a reducing solution (blocking solution, 1g NaBH _4, 15 minutes in 300 ml phosphate buffer solution (PBS) and 100 ml ethanol), and then washed twice with 0.2% sodium dodecyl sulfate solution for 2 minutes, transferred to tertiary distilled water and washed twice for 2 minutes, at 800 rpm for 1 minute 30 seconds. copper Dry the slides using an inner centrifuge and place in a slide box (slide box) in a desiccator and stored at room temperature.

The chip of the present invention manufactured as described above uses the same method as in Example 8 to determine the state and manage the quality.

Example 8: Establishing Hybridization Reaction and Assay Conditions in DNA Chips

PCR of the genes of HPV E6 / E7, HPV L1, and betagloburin using 100 artificial standard specimens prepared in various combinations and concentrations of one, two, or three clones of each type of HPV established in Example 5 above. After amplification, the hybridization reaction was carried out three times or more on the chip prepared according to Examples 6 and 7, and analyzed by a fluorescence scanner to establish appropriate conditions. The method is as follows.

PCR

PCR of E6 / E7 and L1, and human beta globulin gene of HPV was followed the method of Example 3, except that Cy-5 fluorescence was expressed in the reverse primers of the primer combinations, namely GP6-1, HPCR, and HBBR. One oligonucleotide was used.

The label means Cy-3, biotin-binding material, EDANS (5-2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), x It is also possible to use rhodamine and Texas red.

2. Hybridization reaction

A hybridization reaction is carried out by placing amplified HPV PCR products on a slide substrate on which various HPV oligonucleotide probes are immobilized. At this time, a 100 μl 8-well compartment chamber (perfusion 8 wells chamber, Schleicher & Schuell BioScience, German) was used as the hybridization reaction chamber.

10 μl of each of the amplification products of the E6 / E7, HBB and L1 genes was mixed, and tertiary distilled water was added to make a final volume of 50 μl. The mixture was denatured at 95 ° C. for 5 minutes and immediately left on ice for 3 minutes. 50 μl of the digestion reaction solution (20X SSC, 2 ml of 90% glycerol, 6.3 ml of 50 mM phosphate buffer solution was added to make the final 10 ml) was added to adjust the final volume to 100 μl and fixed to the slide at 45 ° C. And reacted with the probe for 30 minutes.

3.Washing

After completion of the hybridization reaction, remove the compartment cover from the DNA chip, immerse the slide in 3X SSPE solution, wash for 2 minutes at room temperature, and again wash at room temperature for 2 minutes with 1X SSPE solution, and then at 800 rpm at room temperature. Dry by centrifugation for 1 minute 30 seconds.

4. Scanning Analysis

After hybridization, non-specific signals were removed after washing, and the dried slides were analyzed by using a confocal laser fluorescence scanner. The scanner at this time is suitable if it is an Affymetrix 428 Array Scanner (Affymetrix, USA), ScanArray Lite (Packard Bioscience, USA), or equivalent equipment.

Example 9 Clinical Sample Analysis on DNA Chips

After performing PCR in Example 3 and 4 again, triplex PCR was performed on the DNA of clinical specimens of cervix where HPV was present and its type was confirmed by sequencing reaction. PCR products were placed on the DNA chips prepared according to Examples 6 and 7, and subjected to a hybridization reaction according to the method of Example 8, followed by washing and analysis with a fluorescence scanner. As a result, the sensitivity, specificity, and reproducibility of the DNA chip were analyzed, and the optimal condition of the DNA chip of the present invention for the diagnosis of genotype of HPV was again checked. Examples of the results are shown in FIGS. 30 to 53.

30, 31, and 32 are photographs of DNA microarray hybridization experiments using 30 sets of HPV type probes synthesized in the present invention for CaSki, HeLa, and K-562, respectively. Circles in the figure represent positions according to probe types. In the figures it can be observed that the specific expression of only clean HPV-16 and HPV-18 probes without causing cross-hybridization reaction between different probes.

33 to 52 are photographs of hybridization reactions of specimens having various types of HPV using 48 sets of oligonucleotide probes integrated in the DNA chip of the present invention. As shown in the figure, as a result of the hybridization reaction due to the plasmid DNA amplification product, it was observed that each of the unique probes was clearly type-specific without causing cross-hybridization reactions.

In other words, each of the 48 HPV-type probes in the DNA chip of the present invention specifically binds to specific HPV-type DNA and did not exhibit cross-hybridization reaction between the probes. In addition, all infected samples containing more than one type of HPV were correctly diagnosed. In other words, in the genotyping of single to multiple infection HPV, the DNA chip of the present invention showed 100% sensitivity and 100% specificity. In addition, when the same test was repeated three or more times at different intervals, all of the same results showed the same results and showed 100% reproducibility. Based on this, it is determined that the 48 sets of probes synthesized in the present invention can be accurately analyzed even for a large number of combinations of HPV types not covered in this DNA microarray hybridization reaction example.

In particular, FIG. 51 shows multiplex PCR of the E6 / E7 and L1 genes and human betagloburin gene of HPV using DNA extracted from a cervical swab sample of a Korean adult woman whose high grade squamous epithelial lesion was confirmed in the cervix. The photograph of the scanning image analyzed using the DNA chip for HPV genotyping of the invention. The results showed that HPV-18 and HPV-70 were duplicated. In this case, only HPV-70 was found in the first direct sequencing analysis, and HPV-18 was also found in the second sequencing analysis after cloning. However, the HPV genotyping DNA chip of the present invention confirmed the complex infection of HPV-18 and HPV-70 quickly and easily with only one analysis.

In addition, FIG. 52 shows a case where epithelial cancer was present in the cervix and was later confirmed by biopsy. In this case, multiplexes of the E6 / E7 and L1 genes and human betaglobulin gene of HPV using DNA extracted from a cervical swap sample PCR is a photograph of the scanned image after analysis using the DNA chip for HPV genotyping of the present invention. The results showed that HPV-16 and HPV-52 were duplicated. In this case, the first direct sequencing analysis was not possible to read, but after cloning, the second sequencing analysis revealed HPV-16 and HPV-52. However, the HPV genotyping DNA chip of the present invention confirmed the complex infection of HPV-18 and HPV-70 quickly and easily with only one analysis.

In other words, the DNA chip fabricated in the present invention was able to accurately determine each type of HPV from the cervical swab sample in the clinic. Each HPV type-specific probe specifically bound to a specific HPV type of DNA in clinical specimens and did not exhibit cross-hybridization reaction between the probes. In addition, the DNA chip of the present invention accurately diagnosed a complex infectious sample mixed with one or more types of HPV, which is difficult to diagnose by direct sequencing, and can be known after multiple sequencing analysis. In other words, in the genotyping of single to multiple infection HPV, the DNA chips of the present invention showed 100% sensitivity and nearly 100% specificity, respectively. In addition, when the same test was repeated three or more times at different intervals, all of the same results showed the same results and showed 100% reproducibility.

Example 10: Analysis of correlation with clinical data after clinical sample analysis in DNA chip

In Example 9, the result of PCR analysis was compared with clinical data such as biopsy of cervix and cytology of cervix, and the correlation between them was examined. It was analyzed whether it was useful for the prediction of lesions. This demonstrated that this DNA chip is useful for screening cervical cancer as well as for analyzing HPV genotypes.

First, HPV type was analyzed by DNA chip and sequencing method of 68 cervical cancer tissues and 49 normal cervical tissues embedded in paraffin. The high-risk HPV was found in all 68 cervical cancer tissues. In normal cervical tissue, no high-risk HPV was found, and only 5 low-risk HPVs (10.2%) were found. These results indicate that the present HPV DNA chip predicts cervical conditions and is particularly useful for screening cervical cancer and cervical epithelial cancer. In addition, 20 adult women who visited the Korean Society of Gynecologic Hospital in cooperation with the Korean Gynecologic Cancer Foundation have seen cervical swap specimens along with cervical magnification, cervical imaging, cervical smear cytology and cervical biopsy. The study which carried out the analysis of the HPV DNA chip of the invention and the sequencing was performed by the prospective blind study, and the result was analyzed. The correlation between cervical cytology and biopsy results and HPV chip test and sequencing results of the subjects are summarized in Table 7. As a result of this analysis, HPV was found in both single and multiple infections in both precancerous lesions, HSIL and LSIL, as well as cervical cancer, and HPV was not found in normal cervical specimens. These results also indicate that the HPV DNA chip is useful for predicting cervical conditions, especially for cervical cancer as well as HSIL and LSIL, which are precancerous lesions of the cervix. We also reaffirmed that accurate readings were possible even in the case of multiple HPV infections that were impossible to read by sequencing.

In the above, embodiments of the present invention have been described in part, but these are only examples, and it will be apparent to those skilled in the art that various modifications and changes can be made without departing from the spirit of the present invention. It will also be apparent from the appended claims that such modifications and variations are all within the scope of the present invention.

Table 7. Comparison with Prior Blind Test and DNA Chip Diagnostic Results

Sample number Pathological readings DNA chip reading Sequencing Readout One Epithelial cancer HPV-16 HPV-16 2 High Grade Squamous Epithelial Lesion (HSIL) HPV-31 HPV-31 3 High Grade Squamous Epithelial Lesion (HSIL) HPV-58 HPV-58 4 High Grade Squamous Epithelial Lesion (HSIL) HPV-34 HPV-34 5 Epithelial cancer HPV-68 HPV-68 6 High Grade Squamous Epithelial Lesion (HSIL) HPV-56 HPV-56 7 Low grade squamous epithelial lesion (HSIL) HPV-35 HPV-35 8 High Grade Squamous Epithelial Lesions (HSIL) HPV-18 & 70 HPV-18 9 Squamous cell carcinoma HPV-16 & 52 Unknown 10 High Grade Squamous Epithelial Lesions (HSIL) HPV-18 HPV-18 11 normal voice voice 12 normal voice voice 13 normal voice voice 14 normal voice voice 15 normal voice voice 16 normal voice voice 17 normal voice voice 18 normal voice voice 19 normal voice voice 20 normal voice voice

Oligonucleotide probe of HPV of the present invention, DNA chip and diagnostic kit including the same, and HPV genotyping method using the same are all found in human cervix and cause all 40 types of HPV that cause various conditions such as cervical cancer and nasal diameter. Diagnose and predict the risk, and analyze the E6 / E7 gene, not the L1 gene of HPV, to compensate for the defects of L1's analysis to maximize accuracy, even in the case of multiple infections of different types of HPV It can be diagnosed accurately, the diagnostic sensitivity, specificity and reproducibility of HPV genotype is close to 100%, easy and simple to interpret test methods and results, and low test cost.

In particular, the HPV genotype diagnostic DNA chip of the present invention and a diagnostic kit using the same may be very useful for the rapid and accurate large-scale automatic analysis of HPV infection and its genotype in a sample such as cervical cells or urine in the clinic. Used in combination with a cytology test or alone, it is widely used for screening cervical cancer and its prognostic lesions, replacing the existing HPV test and reducing the cost, manpower and time. It is also useful when applying a customized vaccine that analyzes and treats the exact E6 / E7 genotype in HPV infection. Therefore, the present invention can greatly contribute to national health promotion and well-being by reducing the incidence and mortality of cervical cancer has a very useful effect in the medical industry.

<110> MOON Woo Chul; GOODGENE INC. <120> Probe Of Human Papillomavirus, Oligonucleotide Microarray And          Genotyping Kit Comprising The Same, And Genotyping Method For          Human Papillomavirus Using The Same) <130> NPF4906 <160> 55 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human papillovirus L1 gene (forward) <400> 1 gcmcagggwc ataayaatgg 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human papillovirus L1 gene (reverse) <400> 2 aataaactgt aaatcatatt cctc 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human papillovirus E6 / E7 gene (forward) <400> 3 tgtcaaaaac cgtttgtgtt c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human papillovirus E6 / E7 gene (reverse) <400> 4 gagctgtcgc ttaattgtcc 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human beta-globulin gene (forward) <400> 5 acacaacttg tgttcactag c 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for cloning Human beta-globulin gene (reverse) <400> 6 caaacttcat ccacgttcac c 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 7 ttgttgcaga tcatcaagaa 20 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 8 cacgacagga acgactcc 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 9 caagtgtaaa catgcgtgg 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 10 ctgtgacgtg taaaaacgcc 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 11 gtcctgttgg aaaccaac 18 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 12 gaccccgacc tgtgacc 17 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 13 ccgacgtaga caaacac 17 <210> 14 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 14 gaagccatgc gtggag 16 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 15 tgccatatct acttcagaaa ct 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 16 tgtttgctgg cataatcaat ta 22 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 17 gtctgtttgt gctgcaatt 19 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 18 cagtactaat atgactttat gcaca 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 19 tctgctgtgt cttctagtga cagta 25 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 20 tgactttatg tgctgaggtt aaa 23 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 21 gcactgaagt aactaaggaa ggtac 25 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 22 aaaatcagag gctacataca aaa 23 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 23 ccttaccatt agtacattat ctgca 25 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 24 aaccacacaa acgttatcca 20 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 25 ccacaagtac aactgcacc 19 <210> 26 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 26 acctctatag agtcttccat accttctac 29 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 27 cacaaaatcc tgtgccaag 19 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 28 ggtttcccca acatttactc 20 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 29 gcaaccacac agtctatgtc taca 24 <210> 30 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 30 gactattagt actgctacag aacagttaag taaa 34 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 31 ccactgtaac cacagaaact aatt 24 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 32 aatgcagcta aaagcacatt aactaa 26 <210> 33 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 33 ctactactac tgaatcagct gtaccaaata t 31 <210> 34 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 34 ccgaaacggc catacct 17 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 35 catttgctgg aataatcagc 20 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 36 tatatgctgg tttaatcaat tgtt 24 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 37 gctacatctg ctgctgcaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 38 tttgttgggg taatcaactg 20 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 39 acaccaacac catatgacaa ta 22 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 40 gcagtaccaa tatgtgctgt g 21 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 41 atttgctggg gaaaccac 18 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 42 cagctgaggt gtctgataat actaat 26 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 43 gacacataca agtctactaa cttta 25 <210> 44 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 44 agtcccccac accaac 16 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 45 cactgcaaca tctggtga 18 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 46 tacacagtcc cctccgtc 18 <210> 47 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 47 tacagcatcc acgcagg 17 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 48 ctacaactca gtctccatct acaa 24 <210> 49 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 49 tctattccta atgtatacac acctaccag 29 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 50 tgctacatcc ccccctgtat 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 51 actatttgta ccgcctccac 20 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 52 cacagcgtcc tctgtatcag a 21 <210> 53 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 53 aggtacacag gctagtagct ctactac 27 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for searching Human papillovirus gene <400> 54 tgctgctaca caggctaatg a 21 <210> 55 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe for searching for Human beta-globulin gene <400> 55 gaggagaagt ctgccg 16  

Claims (23)

An oligonucleotide having a nucleotide sequence shown in SEQ ID NOS: 7-54, and an oligonucleotide having a nucleotide sequence complementary to the oligonucleotide, and complementarily binding to a nucleic acid of human papillomavirus (HPV) Probe. Primer for amplification of human Papillomavirus (HPV) L1 DNA having the nucleotide sequence of SEQ ID NO: 2. A primer for amplifying HPV L1 DNA, which is a primer set having a nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2. Human Papillomavirus (HPV) comprising at least one probe selected from the group consisting of oligonucleotides having the nucleotide sequences shown in SEQ ID NOS: 7-54, and oligonucleotides having complementary sequences to these oligonucleotides DNA chip for detection or genotyping. DNA chip for the detection or genotyping of human papillomavirus (HPV), comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 7 to SEQ ID NO: 14. DNA chip for detection or genotyping of human papillomavirus (HPV), comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 15 to SEQ ID NO: 54. DNA chip for the detection or genotyping of human papillomavirus (HPV), comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 7 to SEQ ID NO: 54. The DNA chip of claim 4, wherein the DNA chip comprises a reference marker probe selected from the group consisting of beta globurin, actin and glyceraldehyde-3-phosphate dehydrogenase gene. The DNA chip of claim 8, wherein the beta globulin probe has a nucleotide sequence of SEQ ID NO: 55. 10. The DNA chip according to claim 4, wherein the 5 'terminal amine group of the probe DNA is immobilized by a cip group reaction with an aldehyde group on the solid surface of the chip. A DNA chip for detecting or genotyping human papillomavirus (HPV) according to any one of claims 4 to 10, a primer set for amplifying a sample HPV DNA by a PCR method, and hybridized with the DNA chip Kit for the detection or genotyping of human papillomavirus (Huma papilomovirus, HPV) comprising a label means for detecting amplified DNA. 12. The method of claim 11, wherein the labeling means is Cy-5, Cy-3, biotin-binding material, EDANS (5-2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetra Kit for detection or genotyping of human papillomovirus (HPV), characterized in that it is selected from the group consisting of methyltamine isocyanate (TMRITC), x- rhodamine and Texas red. 12. The kit for detecting or genotyping human papilloma virus according to claim 11, wherein the primer set comprises a primer set for amplifying HPV L1 DNA having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2. The primer set according to claim 13, wherein the primer set is a primer set for amplifying HPV E6 / E7 DNA having the nucleotide sequences of SEQ ID NOs: 3 and 4 and a primer for beta globurin DNA amplification having the nucleotide sequences of SEQ ID NO: 6 and SEQ ID NO: 7. Kit for detection or genotyping of human papilloma virus further comprising a set. (a) multiplex PCR amplification of a sample DNA using primers for DNA amplification of human papillomavirus; (b) amplifying DNA on a DNA chip comprising an oligonucleotide having a nucleotide sequence shown in SEQ ID NOS: 7-54, and at least one HPV probe selected from the group consisting of oligonucleotides having a nucleotide sequence complementary to these oligonucleotides Hybridizing; And (c) detecting or genotyping the human papillomavirus comprising detecting a reaction hybridized with the probe. The method of claim 15, wherein the HPV L1 DNA amplification primer having a nucleotide sequence of SEQ ID NO: 2 is used for the multiplex PCR amplification. 17. The method according to claim 16, wherein the primer sets described in SEQ ID NOs: 1 and 2, SEQ ID NOs: 3 and 4, and SEQ ID NOs: 5 and 6 are used for multiplex PCR amplification. 16. The method of claim 15, wherein the detection of the papillae virus is characterized in that the fluorescent signal is analyzed using a confocal laser scanner when the gene is labeled with Cy5. 19. The method of claim 18, wherein the Cy-5 fluorescent material is included in a reverse primer. 19. The method of claim 18, comprising washing with SSPE solution after the hybridization reaction. The multiple PCR amplification of any one of the double PCR amplification of HPV L1 gene and HBB gene, double PCR amplification of HPV E6 / E7 gene and HBB gene, triple PCR amplification of HPV L1 gene, HPV E6 / E7 gene and HBB gene (a) mixing 10 × buffer, MgCl ₂ (10 mM), dNTP (10 mM), Tag polymerase in a volumetric volume of 5: 7.5: 1: 1; (b) adding primer and template DNA to the mixture; (C) diluting the mixture with sterile distilled water to prepare a reaction solution; And (d) the reaction solution was denatured at 95 ° C. for 5 minutes, followed by 10 cycles of 1 minute at 95 ° C., 1 minute at 47 ° C., 1 minute at 72 ° C., and reaction at 72 ° C. for 5 minutes. Multiplex PCR amplification method for detecting or genotyping human papillomavirus, characterized in that consisting of. The detection of human papillomavirus (HVP) according to any one of claims 4 to 10, wherein the DNA chip is divided into six to eight compartments each capable of accumulating one sample. Or DNA chip for genotyping. Cervical cancer and its progenous lesions, red gate cancer and its progenous lesions, and head and neck cancer and their progenous lesions from clinical specimens using a kit for the detection or genotyping of the human papillomovirus (HPV) of claims 11 to 14. Diagnostic method of diagnosing.

Images