KR101459074B1 - Dna chip for determining genomic types of human papillomavirus, kit comprising the same and determining method of genomic types of human papillomavirus using the same - Google Patents

Abstract

The present invention relates to a DNA chip for analyzing a genotype of HPV, a diagnostic kit comprising the DNA chip, and a method for analyzing genotypes of HPV using the same. The oligonucleotide synthesized in the present invention can be used as a novel type-specific primer that can complementarily bind HPV type HPV type of tumorigenic HPV type and specifically amplify the HPV type nucleic acid. In particular, the oligonucleotide used in the production of the DNA chip according to the present invention can be utilized for the detection / diagnosis of the presence and type of HPV nucleic acid in the sample, and thus can be used for early screening of cervical cancer caused by HPV . Since the HPV infection can be diagnosed prematurely through the gene approach using the genome according to the present invention, accurate and long-term accurate screening can be carried out, which is expected to prevent the cervical cancer. In addition, HPV diagnosis can be performed at a relatively low cost, and it is possible to provide advanced results to the examinee at an early stage, thereby giving credibility and satisfaction. Also, I think you can take charge of.

Description

DNA chip for human papillomavirus genotyping analysis, kit containing the same, and human papillomavirus genotyping method using the same

The present invention relates to a DNA chip for analyzing the genotype of human papillomavirus, a diagnostic kit including the DNA chip, and a method of analyzing the genotype of human papillomavirus using the same.

Cervical cancer is a malignant tumor that occurs in the cervix of women and accounts for more than 95% of the incidence of uterine cancer. It is the second most common female cancer in the world, after breast cancer, and approximately 440,000 new patients annually. It is being reported.

In Korea, according to the cancer registration survey statistics of the Ministry of Health and Welfare in 2000, it is confirmed that about 5,000 new patients occur per year. This accounts for about 10.6% of all female cancers, and ranks third after gastric cancer (15.7%) and breast cancer (15.1%) in terms of incidence. In particular, in recent years, the infection rate of young women in their 20s to 30s has increased significantly, accounting for about 32% of all cervical cancer patients, which is a serious problem in public health. For this reason, periodic HPV testing is essential in adult women, and HPV testing is basically included when testing for sexually transmitted diseases (USDEPARTMENT OF HEALTH AND HUMAN SERVICES, Centers for Disease Control and Prevention National Center for HIV/AIDS, Viral Hepatitis, STD, and TB. Prevention Division of STD Prevention.Sexually Transmitted Disease Surveillance 2008. Division of STD Prevention. 2009: November; Tchernev G. Sexually transmitted papillomavirus infections: epidemiology pathogenesis, clinic, morphology, important differential diagnostic aspects, current diagnostic and treatment options. An Bras Dermatol. 2009; 84(4): 377-89).

HPV is a virus that has been clearly proven to cause cancer and can cause tumors in human infections. HPV causes hyperproliferation after infecting human epithelial cells at the contact site. The overgrowth at this time is mostly a benign tumor such as a simple skin wart, an external genital organ, a stiffness around the anus, or a condyloma accuminata. However, HPV can be a cause of carcinogenesis, and in reality almost all cervical cancer (uterine cervix cancer or cervical cancer), oral or pharyngeal cancer, a significant number of laryngeal cancer, and many anal cancers are caused by HPV. Is being confirmed. HPV is of great importance in that it can cause cancer and kill life. On the other hand, HPV can be used to diagnose cancer and precancerous lesions such as the cervix and anus early. Actually, HPV test has been found to have better predictive sensitivity of cervical cancer than Papa nicolaou cytology (Pap smear), which is a standard test for early cervical cancer screening, and accordingly, it is recognized as a screening test for cervical cancer in various countries including the US FDA. (Howley PM. Virology. Vol 2, 1996, 2045-2109; Murinoz N et al., N Engl J Med, 2003, 348:518-27; Parkin M, F. Bray F, J. Ferlay J and P. Pisani P. Global cancer statistics, 2002. CA Cancer J. Clin. 2005; National Network of STD/HIV Prevention Training Center. Genital human papillomavirus infection). For these reasons, the market for HPV-related fields is very large, and the economic value of HPV testing is reported to be very large.

Cervical cancer has been reported to be closely related to human papillomavirus (HPV). In other words, after HPV infects the cervical epithelial basal cells, the final invasion through long progenitor stages such as low-grade SIL, high grade SIL, and squamous intraepithelial lesion (SIL). It develops into cancer, and since precancerous lesions, which are the stage before the development of cancer, exist, it is possible to prevent cervical cancer by treating these lesions early and effectively.

Human Papillomavirus (HPV) is an 8kb circular double-stranded DNA virus.All types of HPV viruses have open reading frames (ORFs), which are DNA parts that synthesize proteins of similar properties, and are largely early It is divided into early gene and late gene. The initial gene of about 4.5 kb triggers or inhibits the action of DNA to form proteins that cause viral DNA replication (E1), malignant transformation of host cells (E2), and proteins involved in host cell and viral growth. Synthesis (E4), activation of EGF (epidermal growth factor) and CSF (colony stimulator factor) receptors (E5), permanent survival of cells, activation of cancer genes, and malignant modification by inactivation mechanisms of cancer suppressors (E7), etc. Can be divided into. In particular, the oncogenic proteins E6 and E7, which are expressed after HPV infects the host epithelial cells, binds to p53 and pRB, respectively, the tumor suppressor proteins of the host cell, thereby inhibiting the function of these tumor suppressor proteins. It has been found to develop into tumor formation following transformation of infected cells. On the other hand, the 2.5 kb late gene is 1 kb in size, which is the DNA responsible for the synthesis of the virus main coat protein (L1) and the sub coat protein (L2), and a non-coding region that controls their transcription and translation functions. It consists of a long control region (LCR).

To date, more than 120 different types of HPV have been discovered, of which about 36 HPV types (HPV-2, -3, -6, -10, -11, -13, -16, -18 , -26, -30, -31, -32, -33, -34, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53,- 54, -55, -56, -57, -58, -59, -61, -66, -67, -68, -69, -70, -73) is a so-called tumorigenic HPV type that causes cervical cancer. It turned out.

Among them, HPV-16, -18, -26, -30, -31, -33, -35, -39, -45, -51, -52, -53, -56, -58, -59, -66 , -67, -68, -69, -70, and -73 types of HPV are classified as high-risk HPV because it has been found to have a relatively high progression to cervical cancer, and HPV -2,- Types of HPV such as 3, -6, -7, -10, -11, -13, -32, -34, -40, -42, -43, -44, -54, and -61 can lead to cervical cancer. Due to its low progression rate, it is classified as a low-risk HPV (Garrenstroom et al., J. Gynecol. Cancer 4:73-78, 1994).

Another important fact related to HPV is that with the recent development of vaccines, it is possible to prevent cancers caused by viruses as well as to prevent viruses. There are currently two types of vaccines for preventing HPV on the market. One is Gardasil (Merck & Co. Inc., Whitehouse Station, NJ, USA), which is a tetravalent vaccine designed to prevent 4 types of HPV, HPV types 16, 18, 6 and 11. Another is Cervarix (GlaxoSmithKline Biologicals, Rixensart, Belgium), a bivalent vaccine designed to prevent two types of HPV, types 16 and 18. These vaccines are most effective in adolescent women before sexual intercourse, and are less effective in women who have previously been infected with HPV type 16 or HPV 18. For this reason, there is a controversy over whether or not to adapt to adult women, but even if you have been infected with HPV, if the type is not type 16 or 18, HPV vaccine may be adaptable. Therefore, it is becoming more and more important to know exactly the type of HPV, as well as the presence or absence of infection (Selva L, Gonzalez-Bosquet E, Rodriguez-Plataa MT, Esteva C, Sunol M and Munoz-Almagro C. Detection of humans). papillomavirus infection in women attending a colposcopy clinic.Diagnostic Microbiology and Infectious Disease. 2009; 64: 416-421; Reynales-Shigematsu LM, Rodrigues ER, Lazcano-Ponce E. Costeffectiveness analysis of a quadrivalent human papilloma virus vaccine in Mexico. Arch Med Res. 2009 Aug;40(6):503-13).

At present, with regard to the primary diagnosis of cervical cancer and its progenitor lesions, the Pap smear (Papanicolaou(Pap) Smear) has been basically performed as a standard test method since the 1940s. The Pap test diagnoses cervical cancer based on the cytological morphology of the Pap smear, which has contributed to greatly reducing the mortality rate from cervical cancer. However, there is a disadvantage that the accuracy of the test is poor depending on the skill level of the tester (Menezes et al., Acta Cytol. 45:919-926, 2001). In addition, a colposcopy can diagnose up to 70% of HPV infections, but it requires a trained specialist and expensive equipment, and has the disadvantage of being unable to classify the genotype of human papillomavirus (Reidet al., Clin Obstet Gynecol. 32:157-179, 1989).

On the other hand, since the "HPV hybrid capture" method, which detects liquid complementary binding between HPV DNA and RNA probes in cervical cytology by coloration of antibody enzymes, was developed in 1994, secondary screening or tracking of cervical cancer and its progenitor lesions It is used as a method of screening, and has recently been approved for use by the US FDA for primary screening for cervical cancer.

As such, various analysis methods exist for diagnosing cervical cancer including hybrid capture, but as can be seen from the worldwide death of 50,000 to 500,000 people every year due to cervical cancer, it is a comprehensive early detection of cervical cancer and its progenitor lesions. The reality is that the development of a universal method for detection or diagnosis is urgent.

Recently, as the polymerase chain reaction (PCR) technique, which can quickly and simply amplify a DNA fragment of a specific base sequence, has become common in detecting/diagnosing the presence of infection of various HPV types, all types of HPV discovered so far using it have become common. Efforts to comprehensively detect are being actively attempted.

In addition, PCR-RFLP (Restriction Fragment Length Polymorphism) using restriction enzymes after amplifying the L1 site by PCR (polymerase chain reaction) has the advantage of being simple and easy to obtain results, but the restriction enzyme used recognizes the mutation part. Failure to do so has the disadvantage of not being able to analyze (Lungu et al., JAMA 267:2493-2496, 1992).

PCR technique involves adding a sequence of complementary nucleic acid fragments (primers) that specifically bind to the nucleic acid sequence of the target pathogen, and repeating the processes of denaturation, recombination, and polymerization according to temperature. As a technology capable of amplifying and detecting the presence or absence (U.S. Patent Nos. 4,683,195 and 683,202), it is one of the representative technologies used to diagnose the presence or absence of various types of HPV infection.

In practical aspects of clinical diagnosis, this PCR technique enables objective large-scale tests, unlike cytological tests of Pap smear, and because of the measurement principle, test costs, experimental procedures, and detection sensitivity are compared to cytology or liquid hybrid capture. ) And specificity. However, until now, there is a lack of a common primer suitable for early and broadly primary detection/diagnosis of HPV infection, and thus, it has been difficult to clinically apply whether or not HPV is infected using PCR.

Currently, representative common primers widely used to detect/diagnose HPV infection in clinical practice worldwide include the MY09/MY11 primer set mainly used in North America, South America, and Asia, and GP5 ⁺ / mainly used in Europe. It can be divided into a GP6 ⁺ primer set and an SPF1/SPF2 primer set. In addition, there are recently developed and used FAP59/FAP64 primer sets and PGMY09/PGMY11 primer sets, and there are many common primer sets for detection/diagnosis of HPV used for some research purposes. In comparison, it was found that there are many problems, such as being limited to the detection/diagnosis of extremely limited types of HPV, and the sensitivity of detection is significantly lowered depending on the HPV type. In addition, the efficiency of PCR amplification is different depending on the HPV genotype, so the accuracy of the test may be problematic. In addition, in the case of all the DNA chips currently approved by KFDA, the screening primer and the internal control primer must be individually amplified and mixed before performing a hybridization reaction during analysis, so economical costs are inevitable (Qu et al., J. Clin). Microbiol. 35:1304-1310, 1997; Karksen et al., J. Clin. Microbiol. 34:2095-2100, 1996; Gravitt et al., J. Clin. Microbiol. 38:357-361).

Accordingly, the current detection system for preventing cervical cancer caused by the detection of human papillomavirus has a great limitation in its practical use in clinical purposes despite its value and necessity. In particular, since no clue can be found as to whether the newly identified and classified HPV type is a tumorigenic HPV type closely related to cervical cancer or a high-risk group, a lot of confusion is caused with regard to HPV detection/diagnosis.

KR 10-0786637 B KR 10-2011-0126076 A

The present invention was conceived to solve the problems of the prior art as described above, and an object to be solved in the present invention is to provide a DNA chip for human papillomavirus genotyping for detection/diagnosis of tumorigenic HPV DNA.

Another object of the present invention is to provide a primer set for amplifying the human papillomavirus type-specific E6/E7 gene.

Another object of the present invention is to provide a diagnostic kit including a DNA chip for human papillomavirus genotyping analysis and a primer for amplifying a human papillomavirus type-specific E6/E7 gene.

Another object of the present invention is to provide a method for analyzing human papillomavirus genotypes using the DNA chip and primers for human papillomavirus genotyping of the present invention.

In order to solve the above problems, the present invention is a human papillomavirus of a specimen, characterized in that it comprises one or more oligonucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 29 or their complementary nucleotide sequences ( HPV) provides a DNA chip for genotyping.

The DNA chip is a high-risk HPV, HPV-16, HPV-18, HPV-26, HPV-30, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51, HPV-52 , HPV-53, HPV-56, HPV-58, HPV-59, HPV-66, HPV-67, HPV-68, HPV-70, and HPV-73 and HPV-6, HPV-11 as low-risk HPV, For analysis of HPV genotypes including HPV-34, HPV-40, HPV-43, HPV-44, HPV-54, HPV-55 and HPV-61.

The oligonucleotide binds complementarily to the type-specific E6/E7 gene region of HPV.

As a positive control, the DNA chip may include an oligonucleotide having a nucleotide sequence of SEQ ID NO: 30 complementarily binding to a human GAPDH gene or a nucleotide sequence complementary thereto.

It is preferable that the DNA chip has eight wells in which oligonucleotides can be accumulated.

It is preferable that the concentration of the oligonucleotide is 50 pmol or more.

The oligonucleotide is preferably integrated on a support coated with a superaldehyde group by binding to a C6 amine-modified dideoxythymidine as a linker.

The support is preferably selected from the group consisting of glass slides, paper, nitrocellulose membranes, microplate wells, plastics, silicon, DVDs and beads.

The specimen is a cervix or vaginal swab; Tissue of the cervix; Tissue of the male genital organs; Pee; It is preferable to be selected from the group consisting of an anus, rectum, pharynx, oral or head and neck swap.

The specimen is preferably selected from the group consisting of male genital cancer, male urinary tract cancer, anal cancer, head and neck cancer, and precancerous cells thereof.

In addition, the present invention provides a primer for amplifying HPV E6/E7 genes, characterized in that it is selected from the group consisting of nucleotide sequences of SEQ ID NOs: 31 to 88.

In addition, the present invention provides a kit for genotyping human papillomavirus (HPV) comprising the DNA chip of the present invention, the primer of the present invention, and a labeling means for detecting amplified DNA.

The primer may further include a primer for amplifying human GAPDH gene having nucleotide sequences of SEQ ID NOs: 89 and 90.

The labeling means is Cy3, Cy5, Cy5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, Biotin, Au, Ag and polystyrene It is preferably selected from the group consisting of.

In addition, the present invention comprises the steps of: (a) amplifying a target gene of a specimen by a multiplex PCR method using a primer selected from the group consisting of SEQ ID NOs: 31 to 88; (b) hybridizing the amplified PCR product to the DNA chip according to claim 1 or 2; And (c) detecting a hybrid product obtained by the hybridization.

The DNA chip is an oligonucleotide Cy3, Cy5, Cy5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670 and biotin It is preferable to label with a material selected from.

The analysis method may further include analyzing plasmid vectors into which HPV-type E6/E7 genes are inserted as positive control clones.

The specimen is a cervix or vaginal swab; Tissue of the cervix; Tissue of the male genital organs; Pee; It is preferable to be selected from the group consisting of an anus, rectum, pharynx, oral or head and neck swap.

The oligonucleotide synthesized in the present invention can be used as a novel type-specific primer capable of specifically amplifying the HPV-type nucleic acid by complementarily binding to the oncogenic HPV-type HPV nucleic acid.

In particular, since the oligonucleotide used in the manufacture of the DNA chip according to the present invention can be used to detect/diagnose the presence or type of HPV nucleic acid in a sample, it can be used for early screening such as cervical cancer caused by HPV. .

Since it is possible to diagnose HPV infection early through the genetic approach method using the genome according to the present invention, it is possible to continuously and long-term accurate screening in the future, and thus the preventive effect of cervical cancer is expected.

In addition, HPV diagnosis can be performed at a relatively inexpensive cost, as well as early notification of cutting-edge results to subjects for examination, providing a sense of reliability and satisfaction, and contributing to national health such as cervical cancer, which is a major problem at the national level. I think I can be in charge of it.

1 shows the location of the conventional DNA chip gene sequence and the location of the gene sequence used in the DNA chip of the present invention in the entire HPV gene sequence.
2A to 2C are HPV-16 infected cell lines Caski (ATCC CRL-1550), HPV-18 infected cell lines HeLa (ATCC CCL-2) and HPV non-infected cell lines K562 using a primer set synthesized according to the present invention. This is a picture of DNA chip analysis after PCR was performed using (KCLB-10243, Korean Cell Line Bank) as a target DNA.
3A to 3O are photographs showing PCR for 10 cervical cancer-related samples and 5 normal samples using a primer set synthesized according to the present invention, respectively, and then confirming the type through DNA chip analysis.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA chip for analysis of human papillomavirus (HPV) genotyping of a specimen, characterized in that it comprises one or more oligonucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 29 or their complementary nucleotide sequences. do.

The DNA chip includes one or more oligonucleotides having the nucleotide sequence, and the oligonucleotide may be limited to an appropriate number according to the genotype to be analyzed.

Preferably, the DNA chip is a high risk group HPV, HPV-16, HPV-18, HPV-26, HPV-30, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51 , HPV-52, HPV-53, HPV-56, HPV-58, HPV-59, HPV-66, HPV-67, HPV-68, HPV-70, and HPV-73 and HPV-6 as a low-risk HPV, For analysis of HPV genotypes including HPV-11, HPV-34, HPV-40, HPV-43, HPV-44, HPV-54, HPV-55 and HPV-61.

The oligonucleotide binds complementarily to the type-specific E6/E7 gene region of HPV.

Common oligonucleotide primers capable of hybridization or complementary binding with various types of HPV DNA present in the sample using conventional PCR techniques are detected when compared to the number of HPV types found to date. /Not only is the number of types that can be diagnosed greatly limited, but the sensitivity is greatly reduced depending on the type of HPV. As described above, the existing PCR common primers for HPV detection/diagnosis were targeting oligonucleotides capable of complementarily binding to the L1 region of the HPV genome.

As described above, the E6 gene and E7 gene constituting the HPV genome each have a specific nucleic acid sequence encoding a binding site to p53 or pRb, which is one of the tumor suppressor proteins of the host cell. In closely related tumorigenic HPV types, such as high-risk HPV types, the nucleic acid sequence encoding the binding site to p53 or pRb is well preserved. In addition, since the E1 gene of the HPV genome encodes a protein that initiates replication of the HPV genome, HPV is an essential sequence for growth in a host cell.

The present inventors designed a type-specific primer capable of complementarily binding to a nucleic acid sequence of an oncogenic HPV type based on this discovery, and thus amplifying a nucleic acid sequence of a corresponding HPV type. Since the type-specific primer synthesized according to the present invention can complementarily bind to the E6/E7 region in the HPV genome, in particular, the presence or absence of HPV DNA in the sample can be confirmed through the amplification of these genes in the sample.

Therefore, if the type-specific primer synthesized according to the present invention is used, the presence or absence of a tumorigenic HPV type can be analyzed/detected through a single PCR process, and these types can be accurately identified.

As a positive control, the DNA chip may include an oligonucleotide having a nucleotide sequence of SEQ ID NO: 30 complementarily binding to a human GAPDH gene or a nucleotide sequence complementary thereto.

It is preferable that the DNA chip has eight wells in which oligonucleotides can be accumulated.

It is preferable that the concentration of each oligonucleotide to be accumulated is 50 pmol or more.

The oligonucleotide is preferably integrated on a support coated with a superaldehyde group by binding to a C6 amine-modified dideoxythymidine as a linker.

The support is preferably selected from the group consisting of glass slides, paper, nitrocellulose membranes, microplate wells, plastics, silicon, DVDs and beads.

The specimen is a cervix or vaginal swab; Tissue of the cervix; Tissue of the male genital organs; Pee; It is preferable to be selected from the group consisting of an anus, rectum, pharynx, oral or head and neck swap.

The specimen is preferably selected from the group consisting of male genital cancer, male urinary tract cancer, anal cancer, head and neck cancer, and precancerous cells thereof.

In addition, the present invention provides a primer for amplifying HPV E6/E7 genes, characterized in that it is selected from the group consisting of nucleotide sequences of SEQ ID NOs: 31 to 88.

In addition, the present invention provides a kit for genotyping human papillomavirus (HPV) comprising the DNA chip of the present invention, the primer of the present invention, and a labeling means for detecting amplified DNA.

The primer may further include a primer for amplifying human GAPDH gene having nucleotide sequences of SEQ ID NOs: 89 and 90.

The labeling means is Cy3, Cy5, Cy5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, Biotin, Au, Ag and polystyrene It is preferably selected from the group consisting of.

In addition, the present invention comprises the steps of: (a) amplifying a target gene of a specimen by a multiplex PCR method using a primer selected from the group consisting of SEQ ID NOs: 31 to 88; (b) hybridizing the amplified PCR product to the DNA chip according to claim 1 or 2; And (c) detecting a hybrid product obtained by the hybridization.

The DNA chip is an oligonucleotide Cy3, Cy5, Cy5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670 and biotin It is preferable to label with a material selected from.

The analysis method may further include analyzing plasmid vectors into which HPV-type E6/E7 genes are inserted as positive control clones.

The specimen is a cervix or vaginal swab; Tissue of the cervix; Tissue of the male genital organs; Pee; It is preferable to be selected from the group consisting of an anus, rectum, pharynx, oral or head and neck swap.

Hereinafter, the present invention will be described in more detail through specific examples. However, the following examples are only for describing the present invention in detail, and the present invention is not limited by the following examples.

[ Example ]

1. Human papillomavirus type analysis chip ( chip ) Production

The DNA chip for diagnosis of HPV type has a total of 29 probes that can distinguish 29 types of HPV types with high specificity (Table 1). As an internal control, a probe for the human Gap DH (GAPDH) gene is immobilized. A chip layout was devised so that 8 grids capable of high-throughput analysis of a total of 29 genes were included on one chip substrate, and 8 individual samples were processed through an 8 well hybridization reaction chamber. It was designed to be able to proceed with the analysis simultaneously. After thawing the probe stock stored at -70°C at room temperature, it was diluted to a final concentration of 100 M in deionized sterilized tertiary distilled water and used as a working stock. Each of the probes diluted 50 times in the working stock in a 3X SSC spotting solution (500 mM NaCl, 3 mM sodium citrate, 1.5 MN,N,N-trimethylglycine, pH 6.8) and 1: 5-10 ratio (v/v) The mixture was mixed so that the concentration range of the probe dispensed into the final 96 well plate was 20-30 pmole/uL. The plate was mounted on a Microssys 5100 microarrayer (Cartesian Technologies, Ann Arbor, MI, USA) from which an aldehyde-, thioisocyanate-activated glass slide (CEL associates Inc., Houston, TX, USA). , Epoxy-activated plastic chips, or probes were spotted in duplicate on the surface of the gold film, two at a time. The average diameter of the spots was 80-140 micrometers, and the distance between the spots was kept 350-500 micrometers in order to minimize the cross-talk effect between spots. Chip fabrication was carried out in a class 10,000 room with 75% humidity. The chip on which the probe was spotted was baked at 120° C. for 1 hour, washed for 3 minutes in 0.25% sodium dodecyl sulfate (SDS) solution, and washed again with sterilized tertiary distilled water. Thereafter, the chip was reacted with a solution containing 0.2% sodium borohydride (NaBH _{4) to block the probe.} Thereafter, the mixture was washed twice with 3rd distilled water, dried, and stored in a desiccator until the point of use.

Sequence number designation Sequence (5'→3') Position (bp) One HPV-16 ATCATGCATGGAGATACACCTACATTGCATG 559-589 2 HPV-18 CAACATTGCAAGACATTGTATTGCATTTAGAG 606-637 3 HPV-26 CAGTGGAAAGGGTTGTGTACAAATTGTTGG 565-596 4 HPV-30 CGTCCACTGAGACAGCAGTATAATCATGC 624-655 5 HPV-31 CTGACCTCCACTGTTATGAGCAATTACCC 618-646 6 HPV-33 ACGTAGAGAAACTGCACTGTGACGTGTAAA 537-566 7 HPV-35 TGTATTACATGTCAAAAACCGCTGTGTCCAGTT 416-448 8 HPV-39 AAGAGAAACCCAAGTATAACATCAGATATGCG 565-596 9 HPV-45 TGCATTTGGAACCTCAGAATGAATTAGATCCT 624-655 10 HPV-51 ATGTACCACAATTAAAAGATGTAGTATTGCAT 570-601 11 HPV-52 ACCCCGACCTGTGACCCAAGTGTAAC 524-549 12 HPV-53 CACTTCCACAATATATTATAGAACTTATACCA 588-619 13 HPV-56 CTGCAAGACGTTGTATTAGAACTAACACCT 593-622 14 HPV-58 CCATGAGAGGAAACAACCCAACGCTAAG 572-599 15 HPV-59 AACAATGCATGGACCAAAAGCAACACTTTG 538-567 16 HPV-66 TACCAACGTTGCAAGAGGTTATATTAGAACTTG 588-618 17 HPV-67 AGTGTGTTGGAGACCTCAACGAACG 512-538 18 HPV-68 TGCAATGAAATAGAGCCGGTCGACCTTG 4428-4455 19 HPV-70 CGGTCGACCTTGTATGTCACGAGCAATTAGA 659-689 20 HPV-73 AGGCGATATAGACAATCAGTATATGGCACT 333-362 21 HPV-6 AGGTAAAACATATACTAACCAAGGCGCGG 448-476 22 HPV-11 TTACCTGTGTCACAAGCCGTTGTGTGAAA 413-441 23 HPV-34 TAGAAGATATAACCAATCAGTGTATGGACGG 332-362 24 HPV-40 CTGCACCCTGAACCTGTATGTCTAAACT 569-596 25 HPV-43 CATGGAAAAAAGCCGACGATCAGAGACTATG 591-616 26 HPV-44 GAAACAAATAAGTCAATTCTGGACGTGCTG 378-407 27 HPV-54 ACACAGGCATAAGGGTACTGCAGGAACTG 558-589 28 HPV-55 CGTTCGGCTGGTTGTGCAGTGCACAGGAAC 595-612 29 HPV-61 AACCATAAAGGACATAGTCCTTGAAGAGCG 535-564 30 Internal Control CTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACT

2. HPV E6 / E7 For amplifying specific genes Of the primer synthesis

In the present invention, a target region was selected for each type of primer, that is, a human papillomavirus type-specific amplification. In addition, if necessary, multiple alignment was performed using the ClustalW method for the nucleotide sequence of each type of target site, and accordingly, each type-specific primer target site was selected. Thereafter, primer premier version 5, Premier Biosoft International, Palo Alto, CA, USA), DNA MAX Version 2.7, MiraiBio Group, South San Francisco, CA, USA program from the selected primer target site. By application, the type-specific or gene-specific pride (Tm) was made to be 74-80°C, and the GC content at the 3'end should not be high, and 4 or more bases in the primer sequence should not be consecutively complementary. The formation of the secondary structure of the hairpin was prevented, and the formation of a primer dimer was prevented by preventing three or more of the same bases from being consecutively located at the 3'end. In addition, high specificity was secured by not including single nucletide polymorphism (SNP) in the target site. In addition, the primer sequence does not show cross-reactive properties with other gene or pathogen sequences constituting the chip of the present invention, using various sequence search tools such as the NCBI sequence database. Verified. The primers used in the present invention were synthesized through US IDT (Integrated DNA Technologies, Inc., San Jose, CA, USA) (Table 2).

type Sequence number forward primer(5'-3') Sequence number reverse primer(5'-3') TSP-16 31 GAGCGACCCAGAAAGTTACCACAGTTATGCACAGAG 32 GCACACAATTCCTAGTGTGCCCATTAACAGGTC TSP-18 33 GAGGATCCAACACGGCGACCCTACAAGCTAC 34 TGCTGAGCTTTCTACTACTAGCTCAATTCTGGC TSP-26 35 GAGCTATGTGAAAGCTTGAATACTACTTTGC 36 GTGCAGCACACTGATGGCACACC TSP-30 37 CACCATCTTTGTGAGGTACAAGAAACATCGTTGC 38 GCACACAGGGGACACACTAGCTCCAG TSP-31 39 CCTGCAGAAAGACCTCGGAAATTGCATGAAC 40 GGCACACGATTCCAAATGAGCCCA TSP-33 41 GCAGTAAGGTACTGCACGACTATGTTTCAAGACACTG 42 TAGGTCACTTGCTGTACTGTTGACACATAAACGAACTG TSP-35 43 TTACAAACTGCATGATTTGTGCAACGAGGTAGAAG 44 GAACAGCCGGGGCACACTATTCCAAATG TSP-39 45 TAGCCTGTGTCTATTGCAGACGACCAC 46 GTTGCACACCACGGACACACAAATCCTAGTG TSP-45 47 TACAAGACGTATCTATTGCCTGTGTATATTGCAAAGC 48 ACGGACACACAAAGGACAAGGTGCTC TSP-51 49 CAAGAGGGAAAGACCACGAACGCTGCATG 50 TAACATCTGCTGTACAACGCGAAGGGTGTC TSP-52 51 CGGCCATGTTTGAGGATCCAGCAACAC 52 CAACAGCATTTGCTGTAGAGTACGAAGGTCCGTC TSP-53 53 GCACTGTGTACAACACCCAGGACATCC 54 CTGCACCAACGACTCACACCTACAACACTG TSP-56 55 CCACAATTCAACAATCCACAGGAACGTCCACG 56 CAGGTCCTCTTTGGTACTCTGAATGTCCAACTG TSP-58 57 GATTTGTGTCAGGCGTTGGAGACATCTGTGCATG 58 GTGCACAGCTAGGGCACACAATGGTACATG TSP-59 59 ATTTGAGCACAACATTGAATATTCCTCTGCATGATATTCGC 60 CAGCTGCTGTAAGGCTCGCAATCCGTC TSP-66 61 CCATATTCAGCAATACACAGGAACGTCCACGAAGC 62 CGTAGCTCCTCTTTGGTACTCTGAATGTCCAACTGC TSP-67 63 CAGACGAAAAACCACGCAACCTGCACGAATTGTG 64 CTATTCCTAGTGTGTTCATAAGCATCTGCTGGATTGTTCGG TSP-68 65 CATTGGACACCACATTGCATGACGTTACAATAGACTG 66 GTCCATAAACAGCAGTTCTACGTTCCGCAGG TSP-70 67 TAGACTGTGTCTATTGTAAAACACAGCTACAGCAAAC 68 GATGCACACCAGGGACACACAAATGACAGTG TSP-73 69 GTTTCCCAATTCAGAAGAACGACCATACAAGCTAC 70 GGCACACAATACCTAGTGTACCCATAAGCAACTC TSP-6 71 GGCATTATGGAAAGTGCAAATGCCTCCACGTCTGCAAC 72 GGTCTTCGGTGCGCAGATGGGACACACTATGTTTAG TSP-11 73 GCAGACGAGGCATTATGGAAAGTAAAGATGCCTCCACG 74 GTGTGCCCAGCAAAAGGTCTTGTAGTTGTCTGATGTCTC TSP-34 75 CAATCCTGAGGAACGGCCATACAAGCTACCAGC 76 CACCCATAAGCAGGTCTTCTAACACTAATAGGTCAGCG TSP-40 77 CCAGGACCCTGTATGAACTGTGTGACCAGTGC 78 CACTCTGTAGCTGCACAGTTGGGGCACACTATATGTAATGTG TSP-43 79 GACTGCACGTAGCTGCTCCCAAAACG 80 CCCAACAGCAGGTCTTCTAGCTTCTTGATG TSP-44 81 GCAAGCGGGGCATAATGGAAAGTGCAAATGC 82 CACACAGGACACAATATATCCAGTGAACCCAGCAG TSP-54 83 CCGAAACCGGTACATATAAAAGCGGTTGTAGAAAACAG 84 GTCGTGAAGCACAGGTGGGACACACTATTTGCAGTGC TSP-55 85 GCAAGCGGGGCATAATGGAAAGTGCAAATGC 86 CAGGACACAGTATTTCCAGTGAACCCAGCAGAAGCGTATG TSP-61 87 CGTAGGGTCAGCAAAGCACACTCATCTATGGGACCG 88 CAGCCAGGACACACTATGGACAAGTCGCCCAGCAG internal control 89 CCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCC 90 GCAGAATCCAGATGCTCAAGGCCCTTCATAATATCC

Primer for diagnosis of HPV type is a primer labeled with a fluorescent dye at the 5'or 3'end of the DNA sequence, or a general primer that is not labeled with a fluorescent dye is used, and the fluorescent dye is released during the multiplex PCR reaction. Both methods of labeling the amplified product by inducing the labeled deoxyribonucleotide triphosphate to be inserted into the amplification product were confirmed. In addition, for the diagnosis of human papillomavirus type, a fluorescent dye-labeled primer is used in the second PCR step after the first screening, or the fluorescent dye is labeled during the amplification reaction.

Fluorescent pigments used in the present invention are 6-FAM (6-carboxyfluorescein), Cy5, Cy3, Cy5.5, JOE (6-carboxy-4', 5'-dichloro-2', 7'-dimethoxyfluorescein), Rhodamine Green , TAMRA NHS (N-hydroxysuccinimide) Ester, Texas Red. The concentration of the primer was checked through an ND-1000 spectrophotometer (NanoDrop Technologies, Rockland, Maine, USA) and resuspended in tertiary deionized sterilized distilled water to a final concentration in the range of 50-200 pmole/uL, and aliquots were used. It was stored frozen at -70 ℃.

3. Collection of clinical specimens and from them DNA Separation

For non-invasive diagnosis, efficient DNA isolation from specimens such as cervical papillary and urine was one of the major prerequisites. The samples were collected, placed in a virus transport media, and transported to the laboratory. To diagnose human papillomavirus type, bacterial genomic DNA was isolated from the specimen, and a commercially available DNA extraction kit (LaboPass Tissue kit, Cosmo Genetech, Seoul, Korea) was used. If pipetting was possible immediately because of the low viscosity of cervical papillae and other samples, 0.3 mL of the sample was transferred to a 1.5 mL Eppendorf tube without using 2N sodium hydroxide (NaOH). In the case of a sample with high viscosity, 2N NaOH was added in the same amount as the sample to liquefy the sample. When adding NaOH, the sample should be loosened while stirring with a tip, and the sample was released with a pipette to the extent that 0.5 mL could be accurately taken. The Eppendorf tube containing the sample was centrifuged for 1 minute at 12,000 rpm (revolutions per minute) using a Hanil 1524M high-speed centrifuge (Hanil Scientific., Korea). The supernatant was removed, the precipitate was dissolved in 300 μL of PBS solution, and then centrifuged again under the same conditions, followed by washing. Add 200 μL of TG buffer solution to decompose the sample to the precipitate to release it, add 20 μL of proteolytic enzyme K (Proteinase K, 100 mg/mL), vortex gently, and react at 70° C. for 10 minutes. Made it. Then, 400 μL of TB buffer solution was added to the reaction product and stirred to mix the reaction product. Subsequently, the reaction product was loaded onto the upper layer of a spin column and centrifuged at 12,000 rpm for 2 minutes. The collection tube was replaced with a new one, 500 μL of a WB buffer solution to remove impurities from the membrane was added, followed by centrifugation at 12,000 rpm for 2 minutes. Thereafter, the upper layer of the spin column was transferred to a new Eppendorf tube, and 70 μL of deionized sterilized tertiary distilled water was loaded to elute the DNA, treated at room temperature for 2 minutes, and centrifuged at 12,000 rpm for 2 minutes to obtain pure DNA. Was separated.

4. Multiplex PCR Human papillomavirus through target Gene amplification

Prior to oligo DNA chip analysis, target genes of the chip reaction were amplified through a multiplex PCR reaction using viral DNA isolated from a clinical sample as a template. Thereafter, the amplified amplicons form a duplex with DNA probes on the chip surface, thereby confirming the result of determining the type of human papillomavirus causative bacteria. Multiplex PCR according to a preferred embodiment of the present invention includes a human GAPDH gene as an internal control.

The final concentration of the PCR buffer solution contained in the mixture of 29 human papillomavirus multiplex PCR reaction solutions preferably described in this example is 50 mM KCl, 3.5 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, and 2.5 units of Taq Polymerase, 300 μM dNTPs (Boehringer Mannheim, Mannheim, Germany), and 10 mg/mL Bovine serum albumin. Forward (sense) primers of individual genes included in multiplex PCR for diagnosis of human papillomavirus type are synthesized by labeling Cy3 or Cy5 fluorescent dye at the 5'- or 3'-end, or without modification at both ends. It was synthesized with nascent oligonucleotide (Integrated DNA Technologies, Inc., Coralville, IA, USA).

In a multiplex PCR kit comprising a primer without a fluorescent dye modification at the end according to a further preferred embodiment of the present invention, a Cy3 fluorescent dye-labeled deoxycytosine triphosphate (Cy3-dCTP) constitutes an amplification product during the PCR process. It was possible to improve the sensitivity and specificity of the reaction by allowing it to be added as a nucleotide. The PCR buffer used for 29 multiplex PCR reactions using Cy3-dCTP was 50 mM KCl, 3.5 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, and 2.5 units of Taq polymerase, 300 μM dATP. , 300 μM dGTP, 300 μM dTTP, 25 μM dCTP, 275 μM Cy3-dCTP (FluoroLink Cy3-dCTP, Amersham Pharmacia Biotech AB, Piscataway, NJ, USA), 10 mg/mL Bovine serum albumin was added Thus, the target genes were specifically amplified.

5. Human papillomavirus type analysis chip hybridization reaction and result analysis

A 1.5 mL Eppendorf tube containing 30 to 60 μL of each of the 29 human papillomavirus multiplex PCR amplification products according to a preferred embodiment of the present invention, each 10 to 20 μL each, to which the same volume of deionized tertiary sterilized distilled water was added in advance. Was added to. The mixture was vortexed softly, heat denatured at 95° C. for 5 minutes, stored on ice for 5 minutes, and spin down with a centrifuge. An 8 well hybridization chamber was placed on the surface of the chip, and the upper part of the well was covered with a well cover. Thereafter, a hybridization reaction solution of 60-80 μL (3X SSC, 0.1% SDS, 0.2 mg/mL bovine serum albumin, pH) previously heated at 56° C. After 7) was added and mixed, the reaction mixture was injected through the hole of the well cover, and care was taken not to generate bubbles. After fixing the chamber lid, specific nucleotide complementary binding was induced between the probe on the chip surface and the multiplex PCR reaction product through a hybridization reaction at 56° C. for 30 minutes. The well cover on the surface of the chip on which the hybridization reaction was completed was removed, and the chip was immersed in a solution of washing buffer 1 (0.1X SSC, 0.05% SDS) and washed with stirring at 2,000 rpm for 2 minutes, and this was repeated. Thereafter, washing solution 2 (2X SSC, 0.1% SDS) with stirring at 2,000 rpm for 2 minutes was repeated. Thereafter, the chips were dried by immersing in deionized tertiary sterilized distilled water, washing twice, and centrifuging at 1,000 rpm. The chip was read using a ScanArray Lite (Packard Instrument Co., Meriden, CT, USA) scanner, and the average fluorescence intensity and standard of the positive control spots using analysis software (QuantArray 2.0). The error was compared with the values around the spot to obtain a signal-to-noise (S/R) ratio, and if the value was 4 or more, it was scored as a positive value.

6. Probe Test

Table 3 shows a DNA chip for confirming the minimum detection limit of the probes (SEQ ID NOs: 1 to 29) for 29 types of HPV. The fluorescence signal was analyzed by measuring the intensity of the fluorescence signal between probes using Genepix 4100A (Epson, USA).

As shown in Table 3, as a result of analyzing the intensity of the fluorescence signal between the probes using the Genepix 4100A (Epson, USA) software, the S/N value is 11.25~13.32 as the minimum detection limit.

7. HPV -16, -18 infected cell lines and Non-infectious Cell line experiment

2A to 2C are photographs of chip analysis after PCR on the HPV-16-infected cell line Caski, the HPV-18-infected cell line HeLa, and the HPV-non-infected cell line K562 using the primers synthesized according to the present embodiment. to be. The probe responded only to the HPV-16 infected cell line Caski and the HPV-18 infected cell line HeLa in the chip hybridization reaction, and the non-HPV-infected cell line did not respond to the probe in the chip hybridization reaction to K562 cells.

8. Clinical specimen experiment

In this example, the clinical samples were examined for HPV infection and cervical cancer according to the conventional cytology. For this purpose, a colposcopy examination, cervicography examination, tissue biopsy, and pap-smear examination were conducted under the responsibility of the clinician in charge of 15 specimens requested by the Leewon Medical Foundation. Professional examinations such as inspection were performed. The examination results according to the cell test method according to this Example are shown in Table 4 below.

Subject No. Pathologic One LSIL ^* 2 LSIL 3 LSIL 4 HSIL ^** 5 LSIL 6 HSIL 7 HSIL 8 SCC ^*** 9 SCC 10 HSIL 11 Squamous ^**** 12 Squamous 13 Squamous 14 Squamous 15 Squamous

^* : Low-grade SIL;

^** : High-grade SIL;

^*** : Squamous intraepithelial lesion

^**** : squamous cell

As a result of the examination, as shown in Table 5, subjects 1, 2, 3, and 5 were low-grade epithelial dysplasia (Low-grade SIL), subjects 4, 6, 7 and 10 were high-grade epithelial dysplasia (High-grade SIL), subjects 8 and 9 were diagnosed as patients with squamous intraepithelial lesion (SIL). The remaining subjects (subjects 11 to 15) were diagnosed as unrelated cervical cancer patients with normal cells in the cervical cancer cytology smear according to the present embodiment.

In this example, the presence or absence of HPV DNA was screened for the clinical sample. For this, a DNA chip of the present invention that complementarily binds to HPV DNA was used, and the results are shown in Table 5 below and FIGS. 3A to 3O.

Subject No. DNA test One positivity 2 positivity 3 positivity 4 positivity 5 positivity 6 positivity 7 positivity 8 positivity 9 positivity 10 positivity 11 voice 12 voice 13 voice 14 voice 15 voice

In the HPV DNA test according to the present embodiment, HPV DNA was selected in all samples obtained from subjects (subjects 1 to 10) related to cervical cancer as a result of the examination in the above example, and subjects not related to cervical cancer (subject 11). In the samples obtained from to subject 15), HPV DNA was not selected.

Although the preferred embodiments of the present invention have been described above, this is only illustrative, and the present invention is not limited thereto, and various modifications and changes are made within the scope of the spirit of the present invention for those skilled in the art to which the present invention belongs. It is obvious that it is possible. However, the fact that all such modifications and changes belong to the scope of the present invention will become more apparent through the scope of the appended claims.

<110> daiogene <120> DNA chip for determining genomic types of human papillomavirus, kit comprising the same and determinig method of genomic types of human papillomavirus using the same <160> 90 <170> KopatentIn 2.0 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HPV-16 probe <400> 1 atcatgcatg gagatacacc tacattgcat g 31 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HPV-18 probe <400> 2 caacattgca agacattgta ttgcatttag ag 32 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-26 probe <400> 3 cagtggaaag ggttgtgtac aaattgttgg 30 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HPV-30 probe <400> 4 cgtccactga gacagcagta taatcatgc 29 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HPV-31 probe <400> 5 ctgacctcca ctgttatgag caattaccc 29 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-33 probe <400> 6 acgtagagaa actgcactgt gacgtgtaaa 30 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HPV-35 probe <400> 7 tgtattacat gtcaaaaacc gctgtgtcca gtt 33 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HPV-39 probe <400> 8 aagagaaacc caagtataac atcagatatg cg 32 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HPV-45 probe <400> 9 tgcatttgga acctcagaat gaattagatc ct 32 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HPV-51 probe <400> 10 atgtaccaca attaaaagat gtagtattgc at 32 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HPV-52 probe <400> 11 accccgacct gtgacccaag tgtaac 26 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HPV-53 probe <400> 12 cacttccaca atatattata gaacttatac ca 32 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-56 probe <400> 13 ctgcaagacg ttgtattaga actaacacct 30 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HPV-58 probe <400> 14 ccatgagagg aaacaaccca acgctaag 28 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-59 probe <400> 15 aacaatgcat ggaccaaaag caacactttg 30 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HPV-66 probe <400> 16 taccaacgtt gcaagaggtt atattagaac ttg 33 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HPV-67 probe <400> 17 agtgtgttgg agacctcaac gaacg 25 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HPV-68 probe <400> 18 tgcaatgaaa tagagccggt cgaccttg 28 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HPV-70 probe <400> 19 cggtcgacct tgtatgtcac gagcaattag a 31 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-73 probe <400> 20 aggcgatata gacaatcagt atatggcact 30 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HPV-6 probe <400> 21 aggtaaaaca tatactaacc aaggcgcgg 29 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HPV-11 probe <400> 22 ttacctgtgt cacaagccgt tgtgtgaaa 29 <210> 23 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HPV-34 probe <400> 23 tagaagatat aaccaatcag tgtatggacg g 31 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HPV-40 probe <400> 24 ctgcaccctg aacctgtatg tctaaact 28 <210> 25 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> HPV-43 probe <400> 25 catggaaaaa agccgacgat cagagactat g 31 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-44 probe <400> 26 gaaacaaata agtcaattct ggacgtgctg 30 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HPV-54 probe <400> 27 acacaggcat aagggtactg caggaactg 29 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-55 probe <400> 28 cgttcggctg gttgtgcagt gcacaggaac 30 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HPV-61 probe <400> 29 aaccataaag gacatagtcc ttgaagagcg 30 <210> 30 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> GAPDH probe <400> 30 ctattaaagg ttcctttgtt ccctaagtcc aact 34 <210> 31 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> TSP-16 forward primer <400> 31 gagcgaccca gaaagttacc acagttatgc acagag 36 <210> 32 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSP-16 reverse primer <400> 32 gcacacaatt cctagtgtgc ccattaacag gtc 33 <210> 33 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-18 forward primer <400> 33 gaggatccaa cacggcgacc ctacaagcta c 31 <210> 34 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSP-18 reverse primer <400> 34 tgctgagctt tctactacta gctcaattct ggc 33 <210> 35 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-26 forward primer <400> 35 gagctatgtg aaagcttgaa tactactttg c 31 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TSP-26 reverse primer <400> 36 gtgcagcaca ctgatggcac acc 23 <210> 37 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> TSP-30 forward primer <400> 37 caccatcttt gtgaggtaca agaaacatcg ttgc 34 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> TSP-30 reverse primer <400> 38 gcacacaggg gacacactag ctccag 26 <210> 39 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-31 forward primer <400> 39 cctgcagaaa gacctcggaa attgcatgaa c 31 <210> 40 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TSP-31 reverse primer <400> 40 ggcacacgat tccaaatgag ccca 24 <210> 41 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> TSP-33 forward primer <400> 41 gcagtaaggt actgcacgac tatgtttcaa gacactg 37 <210> 42 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> TSP-33 reverse primer <400> 42 taggtcactt gctgtactgt tgacacataa acgaactg 38 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> TSP-35 forward primer <400> 43 ttacaaactg catgatttgt gcaacgaggt agaag 35 <210> 44 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TSP-35 reverse primer <400> 44 gaacagccgg ggcacactat tccaaatg 28 <210> 45 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSP-39 forward primer <400> 45 tagcctgtgt ctattgcaga cgaccac 27 <210> 46 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-39 reverse primer <400> 46 gttgcacacc acggacacac aaatcctagt g 31 <210> 47 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> TSP-45 forward primer <400> 47 tacaagacgt atctattgcc tgtgtatatt gcaaagc 37 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> TSP-45 reverse primer <400> 48 acggacacac aaaggacaag gtgctc 26 <210> 49 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> TSP-51 forward primer <400> 49 caagagggaa agaccacgaa cgctgcatg 29 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TSP-51 reverse primer <400> 50 taacatctgc tgtacaacgc gaagggtgtc 30 <210> 51 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSP-52 forward primer <400> 51 cggccatgtt tgaggatcca gcaacac 27 <210> 52 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> TSP-52 reverse primer <400> 52 caacagcatt tgctgtagag tacgaaggtc cgtc 34 <210> 53 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSP-53 forward primer <400> 53 gcactgtgta caacacccag gacatcc 27 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TSP-53 reverse primer <400> 54 ctgcaccaac gactcacacc tacaacactg 30 <210> 55 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TSP-56 forward primer <400> 55 ccacaattca acaatccaca ggaacgtcca cg 32 <210> 56 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSP-56 reverse primer <400> 56 caggtcctct ttggtactct gaatgtccaa ctg 33 <210> 57 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> TSP-58 forward primer <400> 57 gatttgtgtc aggcgttgga gacatctgtg catg 34 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TSP-58 reverse primer <400> 58 gtgcacagct agggcacaca atggtacatg 30 <210> 59 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> TSP-59 forward primer <400> 59 atttgagcac aacattgaat attcctctgc atgatattcg c 41 <210> 60 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSP-59 reverse primer <400> 60 cagctgctgt aaggctcgca atccgtc 27 <210> 61 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> TSP-66 forward primer <400> 61 ccatattcag caatacacag gaacgtccac gaagc 35 <210> 62 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> TSP-66 reverse primer <400> 62 cgtagctcct ctttggtact ctgaatgtcc aactgc 36 <210> 63 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> TSP-67 forward primer <400> 63 cagacgaaaa accacgcaac ctgcacgaat tgtg 34 <210> 64 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> TSP-67 reverse primer <400> 64 ctattcctag tgtgttcata agcatctgct ggattgttcg g 41 <210> 65 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> TSP-68 forward primer <400> 65 cattggacac cacattgcat gacgttacaa tagactg 37 <210> 66 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-68 reverse primer <400> 66 gtccataaac agcagttcta cgttccgcag g 31 <210> 67 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> TSP-70 forward primer <400> 67 tagactgtgt ctattgtaaa acacagctac agcaaac 37 <210> 68 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-70 reverse primer <400> 68 gatgcacacc agggacacac aaatgacagt g 31 <210> 69 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> TSP-73 forward primer <400> 69 gtttcccaat tcagaagaac gaccatacaa gctac 35 <210> 70 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> TSP-73 reverse primer <400> 70 ggcacacaat acctagtgta cccataagca actc 34 <210> 71 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> TSP-6 forward primer <400> 71 ggcattatgg aaagtgcaaa tgcctccacg tctgcaac 38 <210> 72 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> TSP-6 reverse primer <400> 72 ggtcttcggt gcgcagatgg gacacactat gtttag 36 <210> 73 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> TSP-11 forward primer <400> 73 gcagacgagg cattatggaa agtaaagatg cctccacg 38 <210> 74 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> TSP-11 reverse primer <400> 74 gtgtgcccag caaaaggtct tgtagttgtc tgatgtctc 39 <210> 75 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSP-34 forward primer <400> 75 caatcctgag gaacggccat acaagctacc agc 33 <210> 76 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> TSP-34 reverse primer <400> 76 cacccataag caggtcttct aacactaata ggtcagcg 38 <210> 77 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> TSP-40 forward primer <400> 77 ccaggaccct gtatgaactg tgtgaccagt gc 32 <210> 78 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> TSP-40 reverse primer <400> 78 cactctgtag ctgcacagtt ggggcacact atatgtaatg tg 42 <210> 79 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> TSP-43 forward primer <400> 79 gactgcacgt agctgctccc aaaacg 26 <210> 80 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TSP-43 reverse primer <400> 80 cccaacagca ggtcttctag cttcttgatg 30 <210> 81 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-44 forward primer <400> 81 gcaagcgggg cataatggaa agtgcaaatg c 31 <210> 82 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> TSP-44 reverse primer <400> 82 cacacaggac acaatatatc cagtgaaccc agcag 35 <210> 83 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> TSP-54 forward primer <400> 83 ccgaaaccgg tacatataaa agcggttgta gaaaacag 38 <210> 84 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> TSP-54 reverse primer <400> 84 gtcgtgaagc acaggtggga cacactattt gcagtgc 37 <210> 85 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TSP-55 forward primer <400> 85 gcaagcgggg cataatggaa agtgcaaatg c 31 <210> 86 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> TSP-55 reverse primer <400> 86 caggacacag tatttccagt gaacccagca gaagcgtatg 40 <210> 87 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> TSP-61 forward primer <400> 87 cgtagggtca gcaaagcaca ctcatctatg ggaccg 36 <210> 88 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> TSP-61 reverse primer <400> 88 cagccaggac acactatgga caagtcgccc agcag 35 <210> 89 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 89 cccacaagta tcactaagct cgctttcttg ctgtcc 36 <210> 90 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 90 gtccataaac agcagttcta cgttccgcag g 31

Claims (6)

SEQ ID NO: 31 to SEQ ID NO: 88, SEQ ID NO: 31 and SEQ ID NO: 32 are HPV-16, SEQ ID NO: 33 and SEQ ID NO: 34 are HPV-18, SEQ ID NO: 39 and SEQ ID NO: 40 are HPV-31, SEQ ID NO: 41 and SEQ ID NO: 42 are HPV-33, SEQ ID NO: 43, SEQ ID NO: 36 and SEQ ID NO: SEQ ID NO: 49 and SEQ ID NO: 50 are HPV-51, SEQ ID NO: 51 and SEQ ID NO: 51, SEQ ID NO: 56, SEQ ID NO: 57 and SEQ ID NO: 58 are HPV-58, SEQ ID NO: 59 and SEQ ID NO: 60 are HPV-52, SEQ ID NO: 53 and SEQ ID NO: 54 are HPV-53, SEQ ID NO: 55 and SEQ ID NO: 56 are HPV- 59, SEQ ID NO: 61 and SEQ ID NO: 62 are HPV-66, SEQ ID NO: 63 and SEQ ID NO: 64 are HPV-67, SEQ ID NO: 65 and SEQ ID NO: 66 are HPV-68, SEQ ID NO: 72, SEQ ID NO: 73 and SEQ ID NO: 74 correspond to HPV-11, SEQ ID NO: 75 and SEQ ID NO: 75, SEQ ID NO: SEQ ID NO: 77 and SEQ ID NO: 78 are HPV-40, SEQ ID NO: 79 and SEQ ID NO: 80 are HPV-43, SEQ ID NO: 81 and SEQ ID NO: 82 are HPV-44, SEQ ID NO: 54, SEQ ID NO: 85 and SEQ ID NO: 86 specifically amplify the E6 and E7 genes of HPV-61 and HPV-55 and SEQ ID NO: 87 and SEQ ID NO: 88, respectively. Amplification of E6 and E7 genes by HPV type, characterized in that the target gene of the test sample is amplified by a multiflex PCR method.
delete delete The method according to claim 1,
And amplifying the E6 and E7 genes by HPV type using the plasmid vectors inserted with the HPV type E6 and E7 genes as a positive control clone.
delete The method according to claim 1,
The sample may be a cervix or vaginal swab; Tissue of the cervix; Tissue of male penis; Pee; Aneurysm, rectum, rectum, pharynx, oral or head and neck swabs.

Images