KR101761701B1 - HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof - Google Patents
HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof Download PDFInfo
- Publication number
- KR101761701B1 KR101761701B1 KR1020140096666A KR20140096666A KR101761701B1 KR 101761701 B1 KR101761701 B1 KR 101761701B1 KR 1020140096666 A KR1020140096666 A KR 1020140096666A KR 20140096666 A KR20140096666 A KR 20140096666A KR 101761701 B1 KR101761701 B1 KR 101761701B1
- Authority
- KR
- South Korea
- Prior art keywords
- hpv
- probe
- seq
- dna
- represented
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
본 발명은 HPV 특이적 프로브 및 이를 포함하는 HPV 유전자형 검사용 DNA 칩에 관한 것으로, 더욱 자세하게는 HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV-90 및 HPV-91로 구성된 군에서 선택된 적어도 1종의 HPV 유전자형에 대해 특이적인 HPV 프로브 및 이를 포함하는 HPV 유전자형 검사용 DNA 칩, HPV 유전자형 검사키트 및 HPV 검사방법에 관한 것이다.
본 발명에 따르면, 높은 특이도와 민감도로 36종의 HPV 바이러스의 유전자 형을 검사할 수 있어, HPV에 의한 자궁경부암 전암 병변 및 자궁경부암의 양상과 위험 정도, 예후를 분석하는데 매우 유용하다. The present invention relates to an HPV-specific probe and a DNA chip for HPV genotyping comprising the same. More particularly, the present invention relates to a DNA chip for HPV-6, HPV-11, HPV-16, HPV-18, HPV- 32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV- HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV- An HPV genotype-specific DNA chip, an HPV genotyping kit, and an HPV genotyping kit comprising the HPV probe specific for at least one HPV genotype selected from the group consisting of HPV-81, HPV-82, HPV-84, HPV-90 and HPV- Lt; / RTI >
According to the present invention, the genotype of 36 types of HPV viruses can be examined with high specificity and sensitivity, and it is very useful for analyzing the HPV-induced precancerous lesions and cervical cancer patterns, risk levels and prognosis.
Description
본 발명은 HPV 특이적 프로브 및 이를 포함하는 HPV 유전자형 검사용 DNA 칩에 관한 것으로, 더욱 자세하게는 HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV-90 및 HPV-91로 구성된 군에서 선택된 적어도 1종의 HPV 유전자형에 대해 특이적인 HPV 프로브 및 이를 포함하는 HPV 유전자형 검사용 DNA 칩, HPV 유전자형 검사키트 및 HPV 검사방법에 관한 것이다.
The present invention relates to an HPV-specific probe and a DNA chip for HPV genotyping comprising the same. More particularly, the present invention relates to a DNA chip for HPV-6, HPV-11, HPV-16, HPV-18, HPV- 32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV- HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV- An HPV genotype-specific DNA chip, an HPV genotyping kit, and an HPV genotyping kit comprising the HPV probe specific for at least one HPV genotype selected from the group consisting of HPV-81, HPV-82, HPV-84, HPV-90 and HPV- Lt; / RTI >
자궁경부암(Cervical cancer)은 자궁경부에서 발생하는 악성 종양으로 전체 자궁암 발생 빈도의 95% 이상을 차지하고 있으며, 전 세계 여성 암 가운데 유방암 다음으로 발생 빈도가 높아 연간 약 44만 건 정도의 자궁경부암 환자가 신규로 보고되고 있다. 여성암에 있어서, 자궁경부암 발생 빈도는 10.6%로서, 10대 암의 발생 빈도상 위암(15.8%)과 유방암(15.1%)에 이어 3위를 차지하고 있는 실정이다. 특히, 최근에는 20~30대 여성의 자궁경부암 감염률이 크게 증가하여 전체 환자의 32%를 차지하는 등 국민 보건상 심각한 문제로 대두되고 있다.Cervical cancer is a malignant tumor originating from the uterine cervix, accounting for more than 95% of all uterine cancer incidence. It is the second most common cancer among women worldwide, with an incidence of about 440,000 cases of cervical cancer per year Are reported as new. The incidence of cervical cancer in women is 10.6%, which is the third most common cause of gastric cancer (15.8%) and breast cancer (15.1%). Recently, cervical cancer incidence in women in their 20s and 30s has increased to 32% of all patients.
자궁경부암은 일반적으로 인유두종 바이러스(HPV)가 자궁경부 상피 기저 세포에 감염한 후 저급상피이형성증(LSIL), 고급상피이형성증(HSIL), 상피내암(CIS) 등의 오랜 전구 단계를 거쳐 최종 침윤암으로 발전한다. 이처럼 최종 암으로 진행되기 전의 병변(pre-stage lesion)이 존재하기 때문에 이들 병변을 효과적으로 치료함으로써 자궁경부암을 조기에 예방할 수 있다.Cervical cancer is usually caused by HPV infection in the cervical epithelial basal cells, followed by long-term developmental stages such as low grade epithelial dysplasia (LSIL), advanced epithelial dysplasia (HSIL), and intraepithelial cancer (CIS) Develop. Since there is a pre-stage lesion before the final cancer, cervical cancer can be prevented early by effectively treating these lesions.
상기한 바와 같이, 자궁경부암의 발병원은 성 접촉으로 인하여 감염되는 HPV가 주요 인자인 것으로 밝혀지고 있다. HPV는 약 8kb의 이중쇄 환상 DNA 바이러스로서, HPV 유전자는 기능적으로 transcription 및 gene regulation에 관여하는 early(E) region과 viral capsid protein을 coding하는 late(L) region 등이 있는데 E region으로부터 전사된 E6 단백질은 p53 단백질을, E7 단백질은 Rb 단백질을 억제시켜 세포의 암화 변형을 일으키게 된다. 따라서, E6/E7 유전자 발현의 정도를 자궁경부암 발생 위험의 표지자로 삼을 수 있다.As described above, the onset of cervical cancer has been found to be a major factor in HPV infection due to sexual contact. HPV is an 8kb double-stranded circular DNA virus. The HPV gene has early (E) region functionally involved in transcription and gene regulation and late (L) region coding viral capsid protein. E6 The protein inhibits the p53 protein and the E7 protein inhibits the Rb protein. Therefore, the degree of E6 / E7 gene expression may be a marker of the risk of cervical cancer.
현재까지 HPV는 열린 해독틀의 서열 차이에 근거하여 120가지 이상의 다른 유형(genotype)이 발견되었고, 특히 이 가운데 약 32종의 HPV 유형(HPV-6, -11, -16, -18, -26, -30, -31, -32, -33, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53, -54, -55, -56, -57, -58, -59, -61, -66, -67, -68, -69, -70, -73)이 자궁경부암을 야기하는 것으로 알려져 있다.To date, more than 120 different genotypes have been identified based on sequence differences in the open reading frame, and among them about 32 HPV types (HPV-6, -11, -16, -18, -26 -30, -31, -32, -33, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53, -54, 56, -57, -58, -59, -61, -66, -67, -68, -69, -70, -73) are known to cause cervical cancer.
현재 자궁경부암과 그 전구 병변의 일차 선별을 위한 방법으로는 크게 세포학적 방법과 분자생물학적 방법을 이용한 방법으로 구분될 수 있으며, 분자생물학적 방법은 HPV DNA와 탐침(probe) 사이의 직접적 접촉을 이용하는 방법과 HPV DNA의 증폭을 이용한 PCR 방법이 있다.Currently, methods for primary screening of cervical cancer and its precursor lesions can be classified into cytologic methods and molecular biologic methods. Molecular biological methods include direct contact between HPV DNA and probes And PCR using amplification of HPV DNA.
자궁경부 세포진의 세포학적 형태에 근거한 세포진 검사(pap smear)를 포함하는 세포학적 방법은 1940년대 이후로 자궁경부암 선별 방법으로 사용되고 있으나 검진 결과가 주관적이고, 특히 30~40%의 높은 위음성율을 보이는 단점이 있다.Cytologic methods including pap smears based on cytologic forms of cervical cytology have been used as a screening method for cervical cancer since the 1940s, but the results of the screening are subjective, especially with a false negative rate of 30-40% There are disadvantages.
자궁경부 세포진 검사의 부정확성을 개선하기 위한 방안으로 자궁경부 확대경검사 및 조직생검 등 여러 가지 검사법들이 상호 보완적으로 사용되어 왔으며, 1992년에 HPV 검사를 시행하여 자궁경부암 및 전암병변 선별검사의 효용성을 높일 수 있다는 연구가 보고되었다(Cox JT, et al., Obstet Gynecol 80:389, 1992).In order to improve the inaccuracies of cervical cytology, various tests such as cervicography and biopsy have been used complementarily. In 1992, HPV test was performed to evaluate the efficacy of cervical cancer and precancerous lesion screening (Cox JT, et al ., Obstet Gynecol 80: 389, 1992).
정량적 검사 방법 중 하이브리드 캡처 II 시스템(Hybrid Capture II system)은 화학발광 검출(chemiluminescent detection) 방법을 이용하는 것으로서, 자궁경부 세포에서 추출한 DNA에 고위험군 HPV의 RNA 프로브 혼합물(high risk HPV RNA probe cocktail or mixture) 및 저위험군 HPV의 RNA 프로브 혼합물(Low risk HPV RNA probe cocktail or mixture)을 혼성화하여 RNA-DNA 중합체를 만든 다음, 이를 시험관에 부착되어 있는 1차 면역 항체에 결합시키고 여기에 다시 2차 면역항체와 화학발광물질을 첨가한 다음 그 발광량의 정도를 측정한 후 양성 및 음성 대조군에 대한 발광량과 샘플의 발광량의 상대적인 수치를 분석함으로써 HPV DNA를 정량하는 방법이다(Impramin C. Abstract presented at 92nd General meeting of the American Society of Microbiology. 1992). 그러나 하이브리드 캡처 II 시스템(Hybrid Capture II system)은 각각의 유전자형에 대응하는 프로브(probe)가 혼합되어 있어 각각의 HPV 유전자형은 알 수 없다는 단점이 있다. 또한, 중합효소 연쇄반응 방법으로 증폭시키지 않기 때문에 검사의 민감도가 떨어지는 단점도 있다.Among the quantitative test methods, the Hybrid Capture II system utilizes a chemiluminescent detection method to detect high-risk HPV RNA probe cocktail or mixture in DNA extracted from cervical cells. And low-risk HPV RNA probe cocktail or mixture (HPV RNA probe cocktail or mixture). The RNA-DNA polymer is then bound to a primary immunoblot attached to the test tube, followed by a second immunoblot The method of quantifying HPV DNA by analyzing the relative amounts of the luminescence amount and the luminescence amount of the sample for the positive and negative control groups after the addition of the chemiluminescent substance and measuring the degree of the luminescence amount thereof (Impramin C. Abstract presented at 92nd General meeting of the American Society of Microbiology, 1992). However, the Hybrid Capture II system has a disadvantage in that each HPV genotype is unknown because the probes corresponding to each genotype are mixed. In addition, there is a disadvantage in that the sensitivity of the test is deteriorated because it is not amplified by the polymerase chain reaction method.
이러한 단점을 극복하고자 본 발명자들은 자궁경부암(Cervical cancer)을 유발하는 원인으로 알려진 HPV의 바이러스 부하 정량과 HPV의 유전자형 분석이 모두 가능하며, 누구나 간편하게 이용할 수 있는 HPV DNA 검사용 DNA칩 및 이를 이용한 HPV 검사방법을 개발한 바 있다(대한민국 등록특허 10-0914911호). 그러나 상기 HPV 검사용 칩은 일부 유전자형에서 간섭현상이 발생하고, 검출 특이도가 낮고, 프로브의 민감도가 낮은 단점이 있었다.In order to overcome these drawbacks, the inventors of the present invention found that a DNA chip for HPV DNA test, which can be easily used by anyone, and both HPV viral load quantification and genotype analysis of HPV, which are known to cause cervical cancer, (Korean Patent No. 10-0914911). However, the HPV test chip has a disadvantage in that some genotypes cause interference, low specificity of detection, and low sensitivity of the probe.
이에, 본 발명자들은 DNA 칩을 이용한 HPV 진단 시에, 유전자형 사이의 간섭이 없으면서 높은 진단 특이도와 민감도를 가지는 HPV 검사용 DNA 칩을 개발하고자 예의 노력한 결과, 자궁경부암을 유발하는 HPV 유전자형에 대하여, 시그널 간섭을 일으키지 않으면서도 높은 민감도를 가지는 HPV 프로브를 개발하고, 이를 진단 칩에 고정하는 경우, 기존의 HPV 검사용 칩보다 정확하고 효율적으로 HPV의 유전자형을 검사할 수 있다는 것을 확인하고 본 발명을 완성하게 되었다.
Therefore, the present inventors have made intensive efforts to develop a DNA chip for HPV test with high diagnostic specificity and sensitivity without any interference between genotypes at the time of diagnosis of HPV using DNA chip. As a result, It has been confirmed that the genotype of HPV can be more accurately and efficiently tested than the conventional HPV test chip when the HPV probe having high sensitivity without causing interference is developed and fixed to the diagnostic chip, .
상기 목적을 달성하기 위하여, 본 발명은 유전자형 사이의 간섭이 없으면서 높은 진단 특이도와 민감도를 가지는 HPV 특이적 프로브 및 이를 포함하는 HPV 검사용 DNA 칩을 제공하는데 있다. In order to achieve the above object, the present invention provides an HPV-specific probe having high diagnostic specificity and sensitivity without interference between genotypes, and a DNA chip for HPV testing comprising the same.
본 발명의 다른 목적은 유전자형 사이의 간섭이 없으면서 높은 진단 특이도와 민감도를 가지는 HPV 검사키트를 제공하는데 있다.It is another object of the present invention to provide an HPV test kit having high diagnostic specificity and sensitivity without interference between genotypes.
본 발명의 또 다른 목적은 유전자형 사이의 간섭이 없으면서 높은 진단 특이도와 민감도를 가지는 HPV 검사방법을 제공하는데 있다.
Another object of the present invention is to provide an HPV test method having high diagnostic specificity and sensitivity without interference between genotypes.
상기 목적을 달성하기 위하여, 본 발명은 HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV-90 및 HPV-91로 구성된 군에서 선택된 적어도 1종의 HPV 유전자형에 대해 특이적인 서열번호 1~36으로 구성된 군에서 선택되는 HPV 특이적 프로브를 제공한다. In order to achieve the above-mentioned object, the present invention provides a method for screening for HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV- HPV-40, HPV-40, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV- 59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV- Specific HPV-specific probe selected from the group consisting of SEQ ID NOS: 1 to 36, which is specific for at least one HPV genotype selected from the group consisting of HPV-91.
본 발명은 또한, 상기 프로브를 포함하는 HPV 유전자형 검사용 DNA 칩을 제공한다.The present invention also provides a DNA chip for testing an HPV genotype comprising the probe.
본 발명은 또한, i) 상기 HPV 특이적 프로브; ii) HPV 유전자 증폭용 프라이머; 및 iii) 피검자의 HPV 유전자를 PCR 증폭하는 수단;을 포함하는 HPV 검사키트를 제공한다.The present invention also relates to a kit for the detection of HPV-specific probes; ii) primers for HPV gene amplification; And iii) means for PCR amplifying the HPV gene of the subject.
본 발명은 또한, (a) 피검자 유래 샘플의 HPV 유전자를 PCR 증폭하는 단계; (b) 상기 HPV 유전자형 검사용 DNA 칩에 상기 증폭된 HPV 유전자 산물을 혼성화하는 단계; 및 (c) 상기 증폭된 HPV 유전자 산물과 상기 HPV 유전자형 검사용 DNA 칩의 혼성화여부를 검출하는 단계를 포함하는 HPV 검사방법을 제공한다.(A) PCR amplifying the HPV gene of the subject-derived sample; (b) hybridizing the amplified HPV gene product to the DNA chip for HPV genotyping; And (c) detecting whether the amplified HPV gene product and the DNA chip for HPV genotyping are hybridized.
본 발명은 또한, (a) HPV 유전자형의 L1(후기발현 유전자)지역을 증폭용 프라이머로 증폭시키는 단계; 및 (b) 상기 증폭된 산물을 벡터에 삽입하여 HPV 유전자형 표준물질 플라스미드를 제작하는 단계를 포함하는 HPV 유전자형 표준물질의 제조방법을 제공한다.
(A) amplifying the L1 (late expressed gene) region of the HPV genotype with an amplification primer; And (b) inserting the amplified product into a vector to prepare a HPV genotype reference material plasmid.
본 발명에 따르면, 높은 특이도와 민감도로 36종의 HPV 바이러스의 유전자 형을 검사할 수 있어, HPV에 의한 자궁경부암 전암 병변 및 자궁경부암의 양상과 위험 정도, 예후를 분석하는데 매우 유용하다.
According to the present invention, the genotype of 36 types of HPV viruses can be examined with high specificity and sensitivity, and it is very useful for analyzing the HPV-induced precancerous lesions and cervical cancer patterns, risk levels and prognosis.
도 1은 본 발명에 따른 HPV 유전자형 검사용 DNA 칩의 프로브 위치를 나타낸 것이다.
도 2는 본 발명에 따른 HPV 유전자형의 표준물질을 제조하는 방법을 나타낸 것이다.
도 3~9는 본 발명에 따른 HPV 유전자형 검사용 DNA 칩과 기존의 HPV 유전자형 검사용 DNA 칩(한국등록특허 10-0914911)의 비교가 가능한 프로브에 해당하는 HPV 타입별 표준물질을 혼성화시킨 결과를 나타낸 것이다.
도 10은 발명에 따른 HPV 유전자형 검사용 DNA 칩에 기존보다 추가로 검출 가능한 유전자의 프로브에 해당하는 HPV 타입별 표준물질을 혼성화시킨 결과를 나타낸 것이다. FIG. 1 shows the probe positions of a DNA chip for HPV genotyping according to the present invention.
Figure 2 shows a method of preparing a reference material of HPV genotype according to the present invention.
FIGS. 3 to 9 show results obtained by hybridizing a DNA chip for HPV genotyping according to the present invention with a standard HPV type reference material corresponding to a probe that can be compared with a conventional HPV genotyping DNA chip (Korean Patent No. 10-0914911) .
FIG. 10 shows the result of hybridizing a DNA chip for HPV genotyping according to the present invention with a reference material of HPV type corresponding to a probe of a gene which can be further detected.
본 발명에서는 기존의 31종의 HPV 유전자형 검사 방법(대한민국 등록특허 10-0914911호)에서 일부 HPV 유전자형들 간의 시그널 간섭현상이 일어나는 것을 개선하고, 프로브의 민감도와 특이도를 개선하여, 유전자형 간의 간섭을 완전히 없애고 민감도와 특이도가 높은 36종의 HPV 유전자형의 검사가 가능한 DNA 칩을 개발하였다.In the present invention, the 31 kinds of HPV genotyping methods (Korean Patent No. 10-0914911) improve the signal interference between some HPV genotypes, improve the sensitivity and specificity of probes, We have developed a DNA chip capable of testing 36 types of HPV genotypes with high sensitivity and specificity.
일 관점에서, 본 발명은 HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV-90 및 HPV-91로 구성된 군에서 선택되는 HPV 유전자형에 대해 특이적인 HPV 프로브로서, 상기 프로브는 서열번호 1~36으로 구성된 군에서 선택되는 HPV 프로브 및 상기 프로브를 포함하는 HPV 유전자형 검사용 DNA 칩에 관한 것이다. In one aspect, the present invention relates to a pharmaceutical composition comprising HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV- , HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV- HPV-90, HPV-90, HPV-90, HPV-90, HPV-90, HPV- Wherein the probe is an HPV probe selected from the group consisting of SEQ ID NOS: 1 to 36, and a DNA chip for HPV genotyping comprising the probe.
본 발명의 HPV 유전자형 검사용 DNA 칩에는 대조군 프로브 인간 베타 글로빈 유전자(HBB)에 대한 프로브인 서열번호 37로 표시되는 프로브를 추가로 포함할 수 있다. The DNA chip for HPV genotyping of the present invention may further include a probe represented by SEQ ID NO: 37, which is a probe for the control probe human beta globin gene (HBB).
바람직하게는, 본 발명의 HPV 유전자형 검사용 DNA 칩은 서열번호 3으로 표시되는 HPV-16 프로브, 서열번호 4로 표시되는 HPV-18 프로브, 서열번호 5로 표시되는 HPV-30 프로브, 서열번호 6으로 표시되는 HPV-31 프로브, 서열번호 8로 표시되는 HPV-33 프로브, 서열번호 9로 표시되는 HPV-35 프로브. 서열번호 10으로 표시되는 HPV-39 프로브, 서열번호 15로 표시되는 HPV-45 프로브, 서열번호 16으로 표시되는 HPV-51 프로브, 서열번호 17로 표시되는 HPV-52 프로브, 서열번호 18로 표시되는 HPV-53 프로브, 서열번호 21로 표시되는 HPV-56 프로브, 서열번호 22로 표시되는 HPV-58 프로브, 서열번호 23으로 표시되는 HPV-59 프로브, 서열번호 26으로 표시되는 HPV-67 프로브, 서열번호 27로 표시되는 HPV-68a 프로브 및 서열번호 28로 표시되는 HPV-68b 프로브를 모두 포함할 수 있으며, 더욱 바람직하게는 서열번호 1~36로 표시되는 프로브를 모두 포함 할 수 있다. Preferably, the DNA chip for HPV genotyping of the present invention comprises an HPV-16 probe represented by SEQ ID NO: 3, an HPV-18 probe represented by SEQ ID NO: 4, an HPV-30 probe represented by SEQ ID NO: 5, 9, an HPV-33 probe represented by SEQ ID NO: 8, and an HPV-35 probe represented by SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, The HPV-59 probe, the HPV-56 probe, the HPV-58 probe, the HPV-59 probe, the HPV-59 probe, The HPV-68a probe of SEQ ID NO: 27, and the HPV-68b probe of SEQ ID NO: 28, and more preferably all of the probes of SEQ ID NOs: 1-36.
본 발명의 일 실시예에서는, 표 2에 나타낸 36종의 HPV 프로브가 고정된 DNA 칩(도 1)을 36종 HPV DNA 표준물질과 혼성화시켰을 때, 기존 HPV 칩(대한민국 등록특허 10-0914911호)에서 간섭이 발생하였던 HPV-6과 HPV-11 사이의 간섭, HPV-33과 HPV-67 사이의 간섭, HPV 43과 HPV-91 사이의 간섭, HPV-44와 HPV-40, HPV-55 사이의 간섭, HPV 53과 HPV-62의 간섭, HPV 59와 HPV 58과의 간섭 및 HPV-66과 HPV 56과의 간섭이 본 발명의 DNA 칩에서는 확인되지 않았다. 또한, 대부분의 유전자형에서 시그널의 민감도가 강화 되었으며, 특히 HPV-31, HPV-35, HPV-39, HPV-40, HPV-43, HPV-45, HPV-55, HPV-56, HPV-58, HPV-59 및 HPV-69에서 현저히 시그널 강도가 향상되어 민감도가 높아진 것으로 확인되었다. In one embodiment of the present invention, when a DNA chip (FIG. 1) in which 36 types of HPV probes shown in Table 2 were hybridized with 36 kinds of HPV DNA standards, a conventional HPV chip (Korean Patent No. 10-0914911) The interference between HPV-6 and HPV-11, the interference between HPV-33 and HPV-67, the interference between
다른 관점에서, 본 발명은 i) 상기 HPV 특이적 프로브; ii) HPV 유전자 증폭용 프라이머; 및 iii) 피검자의 HPV 유전자를 PCR 증폭하는 수단;을 포함하는 HPV 검사키트에 관한 것이다. In another aspect, the present invention provides a method for detecting HPV, comprising: i) contacting the HPV-specific probe; ii) primers for HPV gene amplification; And iii) means for PCR amplifying the HPV gene of the subject.
본 발명에서, 상기 ii) HPV 유전자 증폭용 프라이머는 서열번호 38의 염기서열로 표시되는 프라이머 및 제1표지물질이 결합된 서열번호 40의 염기서열로 표시되는 프라이머 쌍으로 이루어지는 HPV 유전자 증폭용 프라이머일 수 있으며, 상기 피검자의 HPV 유전자를 PCR 증폭하는 수단은 증폭되는 HPV 유전자와 관련하여 HPV 유전자 증폭량을 나타내는 제2표지물질, DNA 중합효소, dNTPs, dUTP, UDG(Uracil DNA Glucosidase) 및 PCR 완충용액을 포함할 수 있다. In the present invention, the primer for amplifying the HPV gene (ii) comprises a primer represented by the nucleotide sequence of SEQ ID NO: 38 and a primer pair comprising the primer pair represented by the nucleotide sequence of SEQ ID NO: 40 And means for PCR amplifying the HPV gene of the subject includes a second labeling substance, a DNA polymerase, dNTPs, dUTP, UDG (Uracil DNA Glucosidase) and a PCR buffer solution indicating the HPV gene amplification amount in relation to the amplified HPV gene .
본 발명에서, 상기 키트는 HPV 유전자 증폭용 프라이머로 서열번호 39의 염기서열로 표시되는 GPM7F2 프라이머를 추가로 포함할 수 있다. In the present invention, the kit may further comprise a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.
본 발명에 있어서, 상기 HPV 검사 키트는 상기 HPV 유전자의 증폭 후, 형광물질인 상기 제2표지물질로부터의 형광의 세기를 측정하여 상기 HPV 유전자의 증폭량을 산출하고, 산출된 HPV 유전자 증폭량에 기초하여 HPV 바이러스 부하량을 산출하는 수단 및 상기 제1표지물질을 검출하여 상기 증폭된 HPV 유전자 산물과 상기 HPV 프로브 염기서열의 혼성화여부를 검출하는 수단을 포함할 수 있다. In the present invention, the HPV test kit may measure the intensity of fluorescence from the second labeling substance, which is a fluorescent substance, after amplification of the HPV gene, calculate the amplification amount of the HPV gene, and, based on the calculated amplification amount of the HPV gene Means for calculating an HPV virus load, and means for detecting the first labeling substance and detecting hybridization of the amplified HPV gene product and the HPV probe base sequence.
본 발명의 일실시예의 HPV 유전자 검사 칩은 상기 HPV 프로브 염기서열이 부착되는 기판과, 상기 기판에 결합되고 HPV 유전자와 HPV 프로브 염기서열이 혼성화되는 챔버를 더 포함할 수 있다.The HPV genetic test chip of an embodiment of the present invention may further include a substrate to which the base sequence of the HPV probe is attached, and a chamber coupled to the substrate and hybridizing the HPV gene and the HPV probe base sequence.
본 발명의 일실시예에서, 제1표지물질은 형광물질인 Cy5이고, 제2표지물질은 형광물질인 사이버 그린 I(SYBR green I)일 수 있지만, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 방사성 물질 또는 발광성 물질등 다양한 표지물질이 사용될 수 있다.In one embodiment of the present invention, the first labeling substance may be a fluorescent substance Cy5 and the second labeling substance may be a fluorescent substance CyBR green I, but the present invention is not limited thereto, Various labeling substances such as known radioactive substances or luminescent substances can be used.
바람직하게는, 본 발명의 상기 프로브는 서열번호 3으로 표시되는 HPV-16 프로브, 서열번호 4로 표시되는 HPV-18 프로브, 서열번호 6으로 표시되는 HPV-31 프로브, 서열번호 8로 표시되는 HPV-33 프로브, 서열번호 9로 표시되는 HPV-35 프로브. 서열번호 10으로 표시되는 HPV-39 프로브, 서열번호 15로 표시되는 HPV-45 프로브, 서열번호 16으로 표시되는 HPV-51 프로브, 서열번호 17로 표시되는 HPV-52 프로브, 서열번호 18로 표시되는 HPV-53 프로브, 서열번호 21로 표시되는 HPV-56 프로브, 서열번호 22로 표시되는 HPV-58 프로브, 서열번호 23으로 표시되는 HPV-59 프로브, 서열번호 25로 표시되는 HPV-66 프로브, 서열번호 26으로 표시되는 HPV-67 프로브, 서열번호 27로 표시되는 HPV-68a 프로브, 서열번호 28로 표시되는 HPV-68b 프로브, 서열번호 29로 표시되는 HPV-69 프로브 및 서열번호 33으로 표시되는 HPV-82 프로브를 모두 포함하는 것을 특징으로 하는 HPV 유전자형 검사용 DNA 칩을 모두 포함할 수 있으며, 더욱 바람직하게는 서열번호 1~36로 표시되는 프로브를 모두 포함 할 수 있다. Preferably, the probe of the present invention comprises the HPV-16 probe of SEQ ID NO: 3, the HPV-18 probe of SEQ ID NO: 4, the HPV-31 probe of SEQ ID NO: 6, the HPV -33 probe and the HPV-35 probe shown in SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, An HPV-53 probe, an HPV-56 probe, an HPV-58 probe, an HPV-59 probe, The HPV-68 probe, the HPV-68 probe, the HPV-69 probe and the HPV-69 probe, which are shown in SEQ ID NO: And -82 probes, and more preferably all of the probes of SEQ ID NOS: 1-36.
본 발명에 있어서, 서열번호 41의 염기서열로 표시되는 프라이머와 제1표지물질이 결합된 서열번호 42의 염기서열로 표시되는 프라이머 쌍으로 이루어지는 HBB 유전자 검출용 프라이머쌍 및 서열번호 37의 염기서열로 표시되는 HBB 프로브를 추가로 포함할 수 있다. In the present invention, a primer pair for HBB gene detection comprising a pair of primers represented by the nucleotide sequence of SEQ ID NO: 42 to which a primer represented by the nucleotide sequence of SEQ ID NO: 41 and a first labeling substance are combined and a nucleotide sequence of SEQ ID NO: And may further include an HBB probe to be displayed.
또한, 본 발명의 키트는 HPV 유전자 증폭용 프라이머로 서열번호 39의 염기서열로 표시되는 GPM7F2 프라이머를 추가로 포함할 수 있다. In addition, the kit of the present invention may further comprise a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.
또 다른 관점에서, 본 발명은 (a) 피검자 유래 샘플의 HPV 유전자를 PCR 증폭하는 단계; (b) 상기 HPV 유전자형 검사용 DNA 칩에 상기 증폭된 HPV 유전자 산물을 혼성화하는 단계; 및 (c) 상기 증폭된 HPV 유전자 산물과 상기 HPV 유전자형 검사용 DNA 칩의 혼성화여부를 검출하는 단계를 포함하는 HPV 검사방법에 관한 것이다. In yet another aspect, the present invention provides a method for detecting an HPV infection comprising: (a) PCR amplifying an HPV gene of a subject-derived sample; (b) hybridizing the amplified HPV gene product to the DNA chip for HPV genotyping; And (c) detecting whether the amplified HPV gene product and the DNA chip for HPV genotyping are hybridized.
본 발명에서 상기 (a) 피검자 유래 샘플의 HPV 유전자를 PCR 증폭하는 단계는 서열번호 38의 염기서열로 표시되는 프라이머 및 제1표지물질이 결합된 서열번호 40의 염기서열로 표시되는 프라이머 쌍으로 이루어지는 HPV 유전자 증폭용 프라이머 및 증폭되는 HPV 유전자와 관련하여 HPV 유전자 증폭량을 나타내는 제2표지물질을 이용하여 피검자 유래 샘플의 HPV 유전자를 PCR 증폭할 수 있으며, In the present invention, the step (a) of PCR amplifying the HPV gene of the sample derived from a subject comprises a primer represented by the nucleotide sequence of SEQ ID NO: 38 and a pair of primers represented by the nucleotide sequence of SEQ ID NO: 40 The HPV gene of the subject-derived sample can be amplified by PCR using a second labeling substance showing the amplification amount of the HPV gene in relation to the primer for amplifying the HPV gene and the HPV gene to be amplified,
추가적으로 상기 제2표지물질을 이용하여 산출된 HPV 유전자 증폭량에 기초하여 HPV 바이러스 부하량을 산출하는 단계를 수행할 수 있다. The step of calculating the HPV virus load based on the amount of HPV gene amplification calculated using the second labeling substance may be performed.
상기 (a) 단계의 증폭은 HPV 유전자 증폭용 프라이머로 서열번호 39의 염기서열로 표시되는 GPM7F2 프라이머를 추가적으로 첨가하여 수행할 수 있다. The amplification of step (a) may be performed by additionally adding a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.
상기 혼성화 여부의 검출은 제1표지물질을 검출하여 상기 증폭된 HPV 유전자 산물과 상기 HPV 유전자형 검사용 DNA 칩의 혼성화여부를 검출할 수 있다. The detection of the hybridization can detect the hybridization of the amplified HPV gene product and the DNA chip for HPV genotyping by detecting the first labeling substance.
본 발명에 있어서, 상기 제2표지물질은 형광물질이고, 상기 제2표지물질로부터의 형광의 세기를 측정하여 상기 HPV 유전자의 증폭량을 산출하는 것을 특징으로 할 수 있다. In the present invention, the second labeling substance is a fluorescent substance, and the amplification amount of the HPV gene is calculated by measuring the intensity of fluorescence from the second labeling substance.
본 발명에 있어서, 상기 PCR은 리얼타임 PCR인 것을 특징으로 할 수 있으며, HPV 양성표준자와 HPV 음성표준자를 함께 검사하는 것을 특징으로 할 수 있다. In the present invention, the PCR may be a real-time PCR, and the HPV positive standard and the HPV negative standard may be tested together.
본 발명에 있어서, 상기 제1표지물질은 형광물질인 Cy5, Cy3, Cy5.5, FAM, TAMRA, HEX, TEXASRED등의 형광물질을 사용할 수 있으며, 상기 제2표지물질은 형광물질인 사이버 그린 I(SYBR green I)을 사용할 수 있다. In the present invention, the first labeling material may be a fluorescent material such as Cy5, Cy3, Cy5.5, FAM, TAMRA, HEX, TEXASRED, and the second labeling material may be a CyberGreen I (SYBR green I) can be used.
본 발명에서 피검자 유래의 샘플은 자궁경부 유래 세포, 구강점막세포, 혈액, 정액 등 HPV가 검출될 수 있는 샘플을 사용할 수 있다. In the present invention, a sample derived from a subject can be a sample from which HPV can be detected, such as cervical-derived cells, oral mucosal cells, blood, semen and the like.
본 발명의 일실시예에서, 임상실험을 통하여, 424명의 자궁경부세포 샘플을 이용하여, 본 칩으로 HPV 유전자형을 검사한 결과, 민감도는 99.0%, 특이도는 100%, 정확도는 99.3%로 효능의 우수성을 확인하였다.In one embodiment of the present invention, HPV genotyping of the present invention using a sample of 424 cervical cell samples revealed that the sensitivity, specificity, and accuracy were 99.0%, 100%, and 99.3%, respectively, .
또 다른 관점에서, 본 발명은 (a) HPV 유전자형의 L1(후기발현 유전자)지역을 증폭용 프라이머로 증폭시키는 단계; 및 (b) 상기 증폭된 산물을 벡터에 삽입하여 HPV 유전자형 표준물질 플라스미드를 제작하는 단계를 포함하는 HPV 유전자형 표준물질의 제조방법에 관한 것이다. In another aspect, the present invention provides a method for amplifying an HPV genotype comprising the steps of (a) amplifying an L1 (late expressed gene) region of an HPV genotype with an amplification primer; And (b) inserting the amplified product into a vector to prepare a HPV genotype reference material plasmid.
본 발명에 있어서, 상기 프라이머는 서열번호 43, 44의 HPV-6 증폭용 프라이머 쌍, 서열번호 45, 46의 HPV-11 증폭용 프라이머 쌍, 서열번호 47, 48의 HPV-16 증폭용 프라이머 쌍, 서열번호 49, 50의 HPV-18 증폭용 프라이머 쌍, 서열번호 51, 52의 HPV-30 증폭용 프라이머 쌍, 서열번호 53, 54의 HPV-31 증폭용 프라이머 쌍, 서열번호 55, 56의 HPV-32 증폭용 프라이머 쌍, 서열번호 57, 58의 HPV-33 증폭용 프라이머 쌍, 서열번호 59, 60의 HPV-35 증폭용 프라이머 쌍, 서열번호 61, 62의 HPV-39 증폭용 프라이머 쌍, 서열번호 63, 64의 HPV-40 증폭용 프라이머 쌍, 서열번호 65, 66의 HPV-42 증폭용 프라이머 쌍, 서열번호 67, 68의 HPV-43 증폭용 프라이머 쌍, 서열번호 69, 70의 HPV-44 증폭용 프라이머 쌍, 서열번호 71, 72의 HPV-45 증폭용 프라이머 쌍, 서열번호 73, 74의 HPV-51 증폭용 프라이머 쌍, 서열번호 75, 76의 HPV-52 증폭용 프라이머 쌍, 서열번호 77, 78의 HPV-53 증폭용 프라이머 쌍, 서열번호 79, 80의 HPV-54 증폭용 프라이머 쌍, 서열번호 81, 82의 HPV-55 증폭용 프라이머 쌍, 서열번호 83, 84의 HPV-56 증폭용 프라이머 쌍, 서열번호 85, 86의 HPV-58 증폭용 프라이머 쌍, 서열번호 87, 88의 HPV-59 증폭용 프라이머 쌍, 서열번호 89, 90의 HPV-62 증폭용 프라이머 쌍, 서열번호 91, 92의 HPV-66 증폭용 프라이머 쌍, 서열번호 93, 94의 HPV-67 증폭용 프라이머 쌍, 서열번호 95, 96의 HPV-68a, 68b 증폭용 프라이머 쌍, 서열번호 97, 98의 HPV-69 증폭용 프라이머 쌍, 서열번호 99, 100의 HPV-70 증폭용 프라이머 쌍, 서열번호 101, 102의 HPV-72 증폭용 프라이머 쌍, 서열번호 103, 104의 HPV-81 증폭용 프라이머 쌍, 서열번호 105, 106의 HPV-82 증폭용 프라이머 쌍, 서열번호 107, 108의 HPV-84 증폭용 프라이머 쌍, 서열번호 109, 110의 HPV-90 증폭용 프라이머 쌍 및 서열번호 111, 112의 HPV-91 증폭용 프라이머 쌍 으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
In the present invention, the primers include a pair of HPV-6 amplification primers of SEQ ID NOs: 43 and 44, a pair of HPV-11 amplification primers of SEQ ID NOs: 45 and 46, a pair of HPV-16 amplification primers of SEQ ID NOs: 47 and 48, 51, 52, a pair of primers for amplification of HPV-31 of SEQ ID NOs: 53 and 54, a pair of primers for amplification of HPV-18 of SEQ ID NOs: 59 and 60, primer pairs for HPV-35 amplification of SEQ ID Nos. 59 and 60, primer pairs for HPV-39 amplification of SEQ ID Nos. 61 and 62, primer pairs for priming HPV- The primer pairs for HPV-40 amplification for the HPV-40 amplification, the primers for the HPV-40 amplification for the HPV-40 amplification, the primer pair for the HPV-40 amplification for the HPV- Primer pairs for the HPV-45 amplification, HPV-51 amplification primer pairs for the SEQ ID NOs: 73 and 74, HPs for the HPV-51 amplification primer pair for the HPV- Primer pairs for amplification of V-52, primers for amplification of HPV-53 of SEQ ID NOs: 77 and 78, primers for amplification of HPV-54 of SEQ ID NOs: 79 and 80, primers for amplification of HPV-55 of SEQ ID NOs: 81 and 82, A primer pair for amplification of HPV-56 of SEQ ID NOS: 83 and 84, a pair of primers for amplification of HPV-58 of SEQ ID NO: 85 and 86, a pair of primers for amplification of HPV-59 of SEQ ID NO: 87, A primer pair for HPV-68 amplification, a primer pair for HPV-68 amplification, a primer pair for HPV-68 amplification, a pair of primers for amplification of HPV- A primer pair for amplification of HPV-70 of SEQ ID NOS: 97 and 98, a pair of primers for amplification of HPV-70 of SEQ ID NOS: 99 and 100, a pair of primers for amplification of HPV- 81, amplification primer pairs, primers of HPV-82 amplification primers of SEQ ID NOs: 105, 106, primer pairs of HPV-84 of SEQ ID NOs: 107, 108, A primer pair for amplification of HPV-90, and a pair of primers for amplifying HPV-91 of SEQ ID NO: 111 and 112.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.
실시예 1: HPV DNA 유전자형의 공통 프라이머의 선별Example 1: Selection of common primers for HPV DNA genotypes
36종의 HPV DNA 유전자형 전부를 정확하고, 주형과의 결합 효율(binding efficiency)이 높게 증폭할 수 있는 HPV DNA 공통 프라이머를 하기와 같이 제작하였다. A common HPV DNA primer capable of amplifying all 36 types of HPV DNA genotypes accurately and with high binding efficiency with the template was constructed as follows.
NCBI(National Center for Biotechnology Information)의 데이터베이스로 부터 HPV-6, -11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -69, -70, -72, -81, -82, -84, -90, -91의 총 36가지 HPV DNA 유전자형의 전체 DNA 염기서열을 확보하였다. 확보된 36종의 HPV DNA 염기서열을 컴퓨터 프로그램 DNASTAR Lagergene 7.1(DNASTAR Inc.)를 이용하여 ClustalW 방법으로 쌍정렬(pairwise alignment) 및 다중서열정렬(multiple sequence alignment)을 실행하였으며, 상기 36종의 HPV DNA 유전자형의 증폭이 모두 가능한 HPV DNA 유전자형 공통 프라이머(general primer)를 최종적으로 선별하여 이를 GPM7F 프라이머(서열번호 38), GPM7F2 프라이머(서열번호 39) 및 GPM7R 프라이머(서열번호 40) 로 각각 명명하였다(표 1).-11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, ..., 43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -70, -72, -81, -82, -84, -90, and -91 genomic DNA sequences of 36 HPV DNA genotypes. The obtained 36 kinds of HPV DNA sequences were subjected to pairwise alignment and multiple sequence alignment using the computer program DNASTAR Lagergene 7.1 (DNASTAR Inc.) according to the ClustalW method, and 36 kinds of HPV The HPV DNA genotype common primer capable of amplifying the DNA genotype was finally selected and designated as GPM7F primer (SEQ ID NO: 38), GPM7F2 primer (SEQ ID NO: 39) and GPM7R primer (SEQ ID NO: 40) Table 1).
시그널 확인을 위하여, GPM7R 프라이머는 Cy5로 라벨링 하였으며, Cy5이외의 다른 형광물질로의 라벨링도 가능하다.For signal validation, the GPM7R primer is labeled with Cy5 and labeled with a fluorescent material other than Cy5.
실시예 2:HPV DNA 유전자형 특이 프로브의 선별 및 합성Example 2: Selection and synthesis of HPV DNA genotype-specific probes
NCBI(National Center for Biotechnology Information)의 데이터베이스로 부터 HPV-6, -11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -69, -70, -72, -81, -82, -84, -90, -91의 총 36가지 HPV DNA 유전자형의 전체 DNA 염기서열을 확보하였다. 확보된 36종의 HPV DNA 염기서열을 컴퓨터 프로그램 DNASTAR Lagergene 7.1(DNASTAR Inc.)를 이용하여 ClustalW 방법으로 쌍정렬(pairwise alignment) 및 다중서열정렬(multiple sequence alignment)을 실행하였으며, 상기 36종의 HPV DNA 유전자형에 특이적인 프로브(서열번호 1~36)을 최종적으로 선별하였다(표 2).-11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, ..., 43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -70, -72, -81, -82, -84, -90, and -91 genomic DNA sequences of 36 HPV DNA genotypes. The obtained 36 kinds of HPV DNA sequences were subjected to pairwise alignment and multiple sequence alignment using the computer program DNASTAR Lagergene 7.1 (DNASTAR Inc.) according to the ClustalW method, and 36 kinds of HPV Probes specific to DNA genotypes (SEQ ID NOS: 1 to 36) were finally selected (Table 2).
내부 대조군으로 사용할 인간 베타 글로빈(HBB) 유전자에 대한 프로브를 서열번호 37에 나타내었다. The probe for the human beta globin (HBB) gene to be used as an internal control is shown in SEQ ID NO: 37.
HBB 프로브: TGCTCGGTGCCTTTAGTGAT(서열번호 37)HBB probe: TGCTCGGTGCCTTTAGTGAT (SEQ ID NO: 37)
선별된 36종의 HPV DNA 특이 프로브와 HBB 특이 프로브를 알데하이드가 코팅된 슬라이드에 부착시키기 위하여 5'말단에 아민기를 부착하였으며, HPV DNA 칩에 부착되어 있는 프로브와 PCR 증폭산물의 결합력을 보강하기 위하여 5'의 아민기 다음에 비특이 염기를 부착하여 프로브를 합성하였다.
To attach 36 selected HPV DNA-specific probes and HBB-specific probes to aldehyde-coated slides, amine groups were attached at the 5 'end. To enhance the binding strength between the probe attached to the HPV DNA chip and the PCR amplification product The probe was synthesized by attaching a non-specific base to the 5 'amine group.
실시예 3: HPV 유전자형 검사용 HPV DNA 칩 제작Example 3: Production of HPV DNA chip for HPV genotyping
실시예 2에서 선별한 HPV DNA의 유전자형을 높은 특이도와 민감도로 분석할 수 있는 프로브를 포함하는 HPV DNA 유전자형 분석용 올리고뉴클레오티드 마이크로어레이(oligonucleotide microarray) DNA 칩(chip)을 하기와 같이 제작하였다.An oligonucleotide microarray DNA chip for analyzing HPV DNA genotypes containing probes capable of analyzing genotype of HPV DNA selected in Example 2 with high specificity and sensitivity was prepared as follows.
실시예 2에서 제작한 36종의 HPV DNA 특이 프로브(50pmol/㎕)와 HBB 특이 프로브(50pmol/㎕) 6㎕에 스폿팅 용액(spotting solution)을 6㎕씩 첨가하여 농도가 25pmol/㎕이 되도록 균일하게 혼합하였다. 슬라이드의 표면이 알데하이드기로 코팅된 유리 슬라이드(Luminano, Inc.)를 준비하고, 8-well 혼성화 챔버(Coverwell perfusion chamber,Gracebio Inc.)를 이용하여 상기 유리 슬라이드를 8개 구역으로 분할하였다. 상기 8개의 구역에 1 구역 당 25pmol/㎕의 농도로 맞춰진 36종의 HPV DNA 특이 프로브와 HBB 특이 프로브를 마이크로어레이어(microarrayer)를 이용하여 일정한 간격과 배열로 상기 유리 슬라이드에 부착하였다. 상기 36종의 HPV DNA 특이 프로브들과 HBB 특이 프로브는 각 프로브 마다 2개씩 부착시키고, 상기 프로브에 결합된 증폭 산물의 위치를 확인할 수 있도록 형광물질 Cy3가 부착되어 있는 형광 양성 대조군을 부착시켰으며, 사용시까지 실온, 차광, 습도 30%미만의 환경에서 보관하였다.6 μl of a spotting solution was added to 6 μl of the 36 kinds of HPV DNA-specific probes (50 pmol / μl) and HBB-specific probes (50 pmol / μl) prepared in Example 2 to obtain a concentration of 25 pmol / And uniformly mixed. A glass slide (Luminano, Inc.) coated with an aldehyde group on the surface of the slide was prepared and the glass slide was divided into 8 sections using an 8-well hybridization chamber (Gracebio Inc.). 36 kinds of HPV DNA-specific probes and HBB-specific probes set at a concentration of 25 pmol / l per zone were attached to the glass slides at regular intervals and arrangements using a microarrayer. Each of the 36 HPV DNA-specific probes and HBB-specific probes were attached to each probe, and a fluorescent positive control with a fluorescent material Cy3 attached thereto was attached so that the position of the amplification product bound to the probe could be confirmed. It was kept at room temperature, shade, humidity less than 30% until use.
제작된 HPV 유전자형 검사용 DNA 칩상에 고정된 프로브의 위치는 도 1에 나타내었다.
The location of the probes immobilized on the prepared DNA chip for HPV genotyping is shown in FIG.
실시예 4: HPV DNA의 표준물질 제작Example 4 Production of Reference Materials for HPV DNA
36종의 HPV 유전자형에 특이적인 프로브의 민감도와 특이도를 확인하기 위하여, 36종의 HPV의 DNA 하이브리다이제이션용 표준물질을 제작하였다.To confirm the sensitivity and specificity of the probes specific for 36 HPV genotypes, 36 standard HPV DNA hybridization standards were prepared.
36종의 HPV 유전자형의 L1(후기발현 유전자)지역을 표 3에 나타낸 유전자형 특이 프라이머를 이용하여 획득한 PCR산물을 pGEM T Easy vector (Promega, USA)에 클로닝하고(도 2), Plasmid isolation kit(코아바이오 시스템, 한국; 제품번호. PM-200)를 이용하여 플라스미드를 정제하고, 추출된 표준물질은 각 종의 최소검출한계 근처 농도 (1x101 ~ 5x103카피/㎕)가 되도록 Tris-EDTA로 희석한 후 1.5ml 튜브에 20㎕씩 분주하여 -20℃ 이하에 보관하여 사용하였다.PCR products obtained using the genotype specific primers shown in Table 3 were cloned into pGEM T Easy vector (Promega, USA) (Fig. 2), and plasmid isolation kit core Biosystems, Korea; product number standard material using a PM-200) purified plasmid and extraction with Tris-EDTA to a minimum detection limit near concentration (1x10 1 ~ 5x10 3 copies / ㎕) of each species After dilution, 20 μl of each solution was dispensed into 1.5 ml tubes and stored at -20 ° C or below.
(유전자번호)genotype
(Gene number)
(NC_001355)
(NC_001355)
(M14119)
(M14119)
(GQ465893.1)
(GQ465893.1)
(AY262282)
(AY262282)
(X74474)
(X74474)
(J04353)
(J04353)
( X74475)
(X74475)
(M12732)
(M12732)
(GQ479039.1)
(GQ479039.1)
(M62849)
(M62849)
(X74478)
(X74478)
( M73236)
(M73236)
(AJ620205.1)
(AJ620205.1)
(U31788)
(U31788)
(X74479)
(X74479)
(M62877)
(M62877)
(GQ472848.1)
(GQ472848.1)
(EF546474.1)
(EF546474.1)
( NC_001676)
(NC_001676)
(U31791)
(U31791)
(X74483)
(X74483)
(D90400)
(D90400)
(X77858)
(X77858)
(AY395706)
(AY395706)
(EF177188.1)
(EF177188.1)
(D21208.1)
(D21208.1)
(DQ080079)HPV 68
(DQ080079)
(AB027020)
(AB027020)
(U21941)
(U21941)
(X94164)
(X94164)
(AJ620209)
(AJ620209)
(AB027021)
(AB027021)
( AF293960)
(AF293960)
(NC_004104.1)
(NC_004104.1)
(AF419318.1)
(AF419318.1)
실시예 5: HPV 검사용 양성표준자와 음성표준자 (양성/음성 대조액)의 제작Example 5: Production of positive standard and negative standard (positive / negative control) for HPV test
(1) 양성대조액의 제조(1) Preparation of Positive Reference Solution
HPV 16형의 L1(후기발현 유전자)지역과 인체 베타글로빈 유전자를 pGEM T Easy vector (Promega, USA)에 클로닝한 후, Plasmid isolation kit (코아바이오 시스템, 한국, PM-200)를 이용하여 플라스미드를 정제하고, 추출된 양성대조액은 농도 5x105카피/㎕가 되도록 Tris-EDTA로 희석한 후 1.5ml 튜브에 분주하여 -20℃ 이하에 보관하여 사용하였다. Plasmid isolation kit (Core Biotechnology, Korea, PM-200) was used to clone the L1 (late expressed gene) region of
상기 HPV 16형의 L1(후기발현 유전자)지역은 서열번호 47 및 48의 프라이머쌍을 이용하여 PCR로 증폭하였으며, 상기 인체 베타글로빈 유전자는 서열번호 113 및 서열번호 114의 프라이머를 이용하여 증폭하였다(표 4).The L1 (late expressed gene) region of the
(유전자번호)genotype
(Gene number)
(NT_009237.18)
Human Beta Globin
(NT_009237.18)
ApaⅠ- 목적유전자 특이 시퀀스 catatg gggccc - tctgtccactcctgatgctg (SEQ ID NO: 113)
ApaI-target gene-specific sequence
NcoⅠ- 목적유전자 특이 시퀀스 catatg ccatgg -tcaagcgtcccatagactca (SEQ ID NO: 114)
Nco I-specific gene specific sequence
(2) 음성대조액의 제조(2) Preparation of negative control solution
인체 베타글로빈 유전자를 서열번호 41 및 42의 프라이머 쌍으로 증폭하여, pGEM T Easy vector (Promega, USA)에 클로닝한 후, Plasmid isolation kit (코아바이오 시스템, 한국, PM-200)를 이용하여 플라스미드를 정제하고, 추출된 양성대조액은 농도 5x105카피/㎕가 되도록 Tris-EDTA로 희석한 후 1.5ml 튜브에 분주하여 -20℃ 이하에 보관하여 사용하였다. The human beta globin gene was amplified with the primer pairs of SEQ ID NOs: 41 and 42 and cloned into pGEM T Easy vector (Promega, USA). Plasmid isolation kit (Core Biosystem, Korea, PM-200) And the extracted positive control solution was diluted with Tris-EDTA to a concentration of 5 × 10 5 copies / μl, and the solution was dispensed into a 1.5 ml tube and stored at -20 ° C. or lower.
(유전자번호)genotype
(Gene number)
(NT_009237.18Human Beta Globin
(NT_009237.18
실시예 6: HPV 유전자형 검사용 DNA 칩의 민감도 및 특이도 분석Example 6: Sensitivity and specificity analysis of DNA chip for HPV genotyping
실시예 4에서 제작된 표준물질을 이용하여, 실시예 3에서 제작된 HPV 유전자형 검사용 DNA 칩의 민감도 및 특이도를 확인하였으며, 기존 HPV 검사용 칩과의 비교하기 위하여, 대한민국 등록특허 10-0914911에 게시된 HPV 검사용 칩을 대조군으로 사용하였다. The sensitivity and specificity of the DNA chip for HPV genotyping prepared in Example 3 were confirmed using the standard material prepared in Example 4, and in order to compare with the HPV test chip, Korean Patent No. 10-0914911 Was used as a control.
HPV 표준물질을 증폭하기 위하여, 아래의 용량으로 리얼타임 PCR 반응 혼합액을 준비한다. 이때 Human Genomic DNA(Roche의, 독일, 1 691 112)를 1ng/㎕로 희석한 용액을 PCR 반응 혼합액에 첨가하였다. To amplify the HPV reference material, prepare a real-time PCR reaction mixture at the following volumes: At this time, a solution obtained by diluting 1 ng / 占 퐇 of Human Genomic DNA (Roche, Germany, 1 691 112) was added to the PCR reaction mixture.
HPV 리얼타임 PCR 반응 혼합액과 인체 베타글로빈 리얼타임 PCR 반응 혼합액을 15㎕씩 96웰 플레이트에 분주하고, HPV 표준물질과 양성대조액, 음성대조액을 첨가하여, 총 volume은 20㎕로 맞춘 후, 실시간 유전자 증폭장치에 96웰 플레이트를 넣고 리얼타임 PCR을 수행하였다. The HPV real-time PCR reaction mixture and human beta globin real-time PCR reaction mixture were dispensed into a 96-well plate in 15-μl aliquots, and HPV standard material, a positive control and a negative control solution were added and the total volume was adjusted to 20 μl. Real-time PCR was performed by placing a 96 well plate in an amplification apparatus.
(서열번호 41)Upstream human beta globin primer
(SEQ ID NO: 41)
(서열번호 42)Downstream human beta globin primer
(SEQ ID NO: 42)
상기 HPV 리얼타임 PCR 산물 5㎕와 인체 베타글로빈 리얼타임 PCR 산물 5㎕를 동일한 20㎕ 튜브에 담고 가볍게 원심분리한 후, 95℃ 힛블럭에서 10분간 가열한 후, 아이스 에탄올 (Ice EtOH)에 3분 또는 얼음에서 5분간 냉각시킨 후, 상기 튜브를 가볍게 원심분리한 후, SSC와 SDS로 구성된 교잡반응용액 40㎕를 넣고 볼텍서 (vortexer)를 이용해 잘 섞어주고 다시 가볍게 원심분리하였다.
5 μl of the HPV real-time PCR product and 5 μl of the human Beta globin real-time PCR product were placed in the same 20 μl tube, followed by gentle centrifugation. The mixture was heated in a 95 ° C. heat block for 10 minutes and then immersed in ice ethanol Min or ice for 5 minutes. After gently centrifuging the tube, add 40 μl of a hybridization solution composed of SSC and SDS, mix well using a vortexer, and centrifuge again lightly.
실시예 4에서 제작된 HPV 유전자형 검사용 DNA 칩 및 대한민국 등록특허 10-0914911에 게시된 HPV 검사용 칩에 상기혼합액을 칩의 표면에 부착된 웰 쳄버의 주입구로 천천히 넣어준 후, 칩의 습도를 유지하면서, 60℃ 항온기에 넣고 20분간 반응시켰다. 교잡반응 후, 1단계 칩 세척용액에 칩을 담근 상태에서 웰 쳄버를 제거하고 칩을 슬라이드 트레이(tray)에 꽂는다.The mixed solution was slowly poured into a well of a DNA chip for HPV genotyping and HPV test chip prepared in Example 4 and an HPV test chip published in Korean Patent No. 10-0914911, , And the mixture was placed in a 60 DEG C thermostat and allowed to react for 20 minutes. After the hybridization reaction, remove the well chamber with the chip immersed in the step 1 chip washing solution, and insert the chip into a tray.
칩을 슬라이드 트레이(tray)에 꽂은 상태로 1단계 칩 세척용액 400ml(표 8)이 담긴 세척용기에 넣고, 실온에서 135rpm으로 2분간 교반기를 이용하여 3회 세척하였다. 상기 칩을 슬라이드 트레이(tray)에 꽂은 상태로 2단계 칩 세척용액(표 8) 400ml이 담긴 세척용기에 넣고, 실온에서 135rpm으로 2분간 교반기를 이용하여 3회 세척하였다. 칩을 슬라이드 트레이(tray)에 꽂은 상태로 시그날 유지 희석용액 (표 9) 400ml이 담긴 세척용기에 넣고 30초간 정치시킨 후, 슬라이드 전용 dryer에서 3분간 원심 분리하여 건조하였다. The chips were placed in a tray and placed in a washing container containing 400 ml of the first stage chip washing solution (Table 8) and washed three times with a stirrer at 135 rpm for 2 minutes at room temperature. The chip was placed in a slide tray and placed in a washing container containing 400 ml of a two-step chip washing solution (Table 8). The chip was washed three times with a stirrer at 135 rpm for 2 minutes at room temperature. The chip was placed in a slide tray and placed in a washing container containing 400 ml of the signal holding dilution solution (Table 9), allowed to stand for 30 seconds, and then centrifuged for 3 minutes in a slide-type dryer.
(칩 세척용액 Ⅰ은 SSC, 칩 세척용액 Ⅱ는 SDS로 구성) (Chip cleaning solution I consists of SSC and chip cleaning solution II consists of SDS)
상기 건조된 DNA 칩은 NimbleGen MS 200 스캐너를 이용하여, MS200 프로그램으로, 위치마커(M)의 시그날은 532nm 파장에서, HPV와 인체 베타글로빈 스팟의 시그날은 635nm 파장에서 검출하였다. The dried DNA chip was detected with a MS 200 program using a NimbleGen MS 200 scanner, the signal of position marker (M) at a wavelength of 532 nm, and the signal of HPV and human beta globin spot at a wavelength of 635 nm.
각 바이러스 유전자형 별 검출결과를 도 3~10에 나타내었으며, 기존 HPV 칩에서 간섭이 발생하였던 HPV-6과 HPV-11 사이의 간섭, HPV-33과 HPV-67 사이의 간섭, HPV 43과 HPV-91 사이의 간섭, HPV-44와 HPV-40, HPV-55사이의 간섭, HPV 53과 HPV-62의 간섭, HPV 59와 HPV 58과의 간섭 및 HPV-66과 HPV 56의 간섭이 본 발명의 DNA 칩에서는 확인되지 않았다. The detection results of each virus genotype are shown in FIGS. 3 to 10. The interference between HPV-6 and HPV-11, interference between HPV-33 and HPV-67,
또한, 대부분의 유전자형에서 시그널의 민감도가 강화되었으며, 특히 HPV-31, HPV-35, HPV-39, HPV-40, HPV-43, HPV-45, HPV-55, HPV-56, HPV-58, HPV-59 및 HPV-69에서 현저히 시그널 강도가 향상되어 민감도가 높아진 것으로 확인되었다.
In addition, the sensitivity of the signal was enhanced in most genotypes. In particular, the sensitivity of the signal was enhanced in HPV-31, HPV-35, HPV-39, HPV-40, HPV-43, HPV-45, HPV- HPV-59 and HPV-69 were significantly improved in signal intensity and increased in sensitivity.
실시예 7: 임상샘플을 이용한 HPV 유전자형 분석Example 7: Analysis of HPV genotypes using clinical samples
본 실시예에서는 자궁경부세포의 임상샘플에서 분리한 DNA를 이용하여 실시예 6의 방법으로, HPV 유전자형을 분석하였다. In this example, HPV genotypes were analyzed by the method of Example 6 using DNA isolated from clinical samples of cervical cells.
피험자는 자궁경부 세포검사(Pap smear)를 시행하여 결과가 정상으로 판정된 여성 환자 27 명과, 결과가 비정상으로 판정되어 질확대경조준생검과 HPV 검사를 실시하는 여성 환자 397명, 총 424명의 여성 환자들을 대상으로 하였다.The subjects were 27 female patients whose Pap smear results were normal, 397 female patients who underwent a magnifying glass biopsy and HPV test and 424 female patients .
(의)제일의료재단 제일병원에 내원한 환자 중 연구 참여에 동의한 환자들을 대상으로 자궁경부 세포검사를 시행한 후, 결과가 정상인 여성 환자들과 결과가 비정상으로 판정되어 생검을 시행하는 여성 환자들의 자궁경부로부터 탈락된 자궁경부세포를 담당의사가 채취한 샘플을 사용하였다. The results of this study were as follows: 1) Patients who were admitted to Cheil Hospital of Cheil Medical Center (Cheil Medical Center) and who agreed to participate in the study were followed up for cervical cytology. A sample of the cervix removed from the cervix was used by a physician.
상기 샘플로부터 추출한 DNA를 이용하여, 실시예 6의 방법으로 HPV 유전자형 검사용 DNA 칩 분석을 수행하고, 그 결과의 정확성을 각 샘플의 HPV 유전자 형의 DNA sequencing으로 확인하였다. Using the DNA extracted from the sample, DNA chip analysis for HPV genotyping was performed by the method of Example 6, and the accuracy of the result was confirmed by DNA sequencing of the HPV genotype of each sample.
실시예 3에서 제작된 본원발명의 HPV 유전자형 검사용 DNA 칩을 사용한 결과 전체 424예 중 293예 (69.10%)에서 HPV DNA가 검출되었으며, 131예 (30.90%)에서는 HPV DNA가 검출되지 않았다. HPV가 검출된 총 293예 중 16 HPV DNA 유전자형의 출현이 61예 (14.39%), 58 HPV DNA 유전자형의 출현이 22예 (5.19%), 52형이 19예 (4.48%), 51형이 15예 (3.54%), 18형이 14예(3.30%), 56형이 13예 (3.07%), 31형과 68b형이 각각 11예 (2.59%) 등의 순으로 관찰되었다. HPV가 검출된 총 293예 중 기타 유전자형은 3예 (0.71%), 다중 감염은 26예 (6.13%)로 관찰되었다. 상기 내용은 표 10에 나타내었다.HPV DNA was detected in 293 cases (69.10%) out of 424 cases and HPV DNA was not detected in 131 cases (30.90%) using the DNA chip for HPV genotyping of the present invention prepared in Example 3. Of the 293 HPV positive cases, 16 HPV DNA genotypes were present in 61 cases (14.39%), 58 HPV DNA genotypes were present in 22 cases (5.19%), 52 cases were in 19 cases (4.48%), 51 cases were in 15 cases 14 cases (3.30%) in 18 cases, 13 cases (3.07%) in 56 cases, and 11 cases (2.59%) in 31 cases and 68b cases respectively. Of the 293 cases detected in HPV, 3 cases (0.71%) of other genotypes and 26 cases (6.13%) of multiple infection were observed. The above contents are shown in Table 10.
출현빈도HYPVYP genotype
Appearance frequency
민감도, 특이도 및 정확도를 분석하기 위하여 본 Chip에서 검출된 HPV 유전자형을 시퀀싱으로 확진하여 양성, 위양성, 위음성, 음성으로 분류하였고, 표 11에 나타내었다. 이를 이용하여 민감도등을 백분율로 계산하였을 때, 표 12에 나타낸 결과, 민감도는 99.0%, 특이도는 100%, 정확도는 99.3% 였으며, 위양성율은 0%, 위음성율은 0.7%였다.
To analyze sensitivity, specificity and accuracy, HPV genotypes detected in this chip were classified by positive sequence, positive, false positive, false negative, and negative. The sensitivity, specificity, and accuracy were 99.0%, 100%, and 99.3%, respectively. The false positive rate was 0% and the false negative rate was 0.7%.
자궁경부 세포 검사와 HPV의 검출율과의 상관성을 분석했을 때의 결과를 표 13에 타나내었고, 세포검사로 병증이 없는 Normal의 경우 HPV 양성율은 29.63%이고, 병증의 정도에 따라 HPV의 양성율도 상당한 상관성을 보임을 확인하였다. The HPV positive rate was 29.63% in normal cases without cytopathologic findings, and the positive rate of HPV according to the severity of pathology. Of the total population.
* Normal: 정상* Normal: Normal
* AGUS: 비정형 선상피세포 이상증 * AGUS: Atypical dysplasia
* ASC-US: 비정형 편평상피세포 이상증 * ASC-US: atypical squamous cell epithelial disorder
* ASC-H: 고등급병변 의심 비정형 편평상피세포 이상증 * ASC-H: High grade lesion suspected atypical squamous cell epithelial disorder
* LSIL: 저등급 편평상피내병변 * LSIL: low-grade squamous intraepithelial lesion
* HSIL: 고등급 편평상피내병변 * HSIL: High grade squamous intraepithelial lesion
* AIS: 선상피내암* AIS:
* CIS: 편평상피내암* CIS: squamous intraepithelial cancer
* ACC: 침윤성 선상피세포 암* ACC: invasive dermal cell carcinoma
* SCC: 침윤성 평편상피세포 암
* SCC: invasive flat epithelial cell cancer
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.
<110> Cheil General Hospital & Women's Healthcare Center <120> HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof <130> P14-B188 <160> 114 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 6 HPV <400> 1 actaatacac ctgtacaggc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 11 HPV <400> 2 tcaaatacct ctgtacaaaa t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 16 HPV <400> 3 accaatgttg cagtaaatcc a 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 18 HPV <400> 4 ccatgccgcc acgtctaatg tttc 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 30 HPV <400> 5 cgttctgcgc cccctgcaca a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 31 HPV <400> 6 agtaacaatg ctattacccc t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 32 HPV <400> 7 gcttgctctg cacaatcaaa t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 33 HPV <400> 8 tgtactaatg cagcacctgc c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 35 HPV <400> 9 aatgctaacc aggtaaaagc a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 39 HPV <400> 10 aagcccaata atgtatctac g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 40 HPV <400> 11 aatgcttctc gggtaaccct t 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 42 HPV <400> 12 gcctgtacac cacagtccaa t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 43 HPV <400> 13 aacgcatcag gtgttaccca a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 44 HPV <400> 14 aataatgtta gtgttaagga t 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 45 HPV <400> 15 aaacctgcac aattgcaacc t 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 51 HPV <400> 16 aaaaacacac ctgtacctcc a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 52 HPV <400> 17 aataataatt caggaaatcc t 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 53 HPV <400> 18 cgttccacac ctactacagc g 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 54 HPV <400> 19 acacctaata cattggctgc t 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 55 HPV <400> 20 aataatggta gtgtaaatcg c 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 56 HPV <400> 21 aagtccacac aagttaccac a 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 58 HPV <400> 22 tgtaacaata atgcagctgc t 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 59 HPV <400> 23 aagcctaata ctgtggttca g 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 62 HPV <400> 24 ttatgcccca atgctgcccc 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 66 HPV <400> 25 aagtctacac cagtcaatac a 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 67 HPV <400> 26 gtggtaacag taatgggcca g 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68a HPV <400> 27 aagcctacca atgtacaaca a 21 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68b HPV <400> 28 ttcctccaac aaaaatccta agg 23 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 69 HPV <400> 29 gcacagtctc aggtacagcg t 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 70 HPV <400> 30 gcctgtaagt ccactcaaca g 21 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 72 HPV <400> 31 tctcagccaa ctgactgcc 19 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 81 HPV <400> 32 atttggctgc tgccagtgag 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 82 HPV <400> 33 aaaaacgtac ctgtacctca g 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 84 HPV <400> 34 actaatgtgc aatatcgtgc g 21 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 90 HPV <400> 35 cccgggacaa tcttacta 18 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 91 HPV <400> 36 agcacctcag gtattacaca a 21 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for HBB <400> 37 tgctcggtgc ctttagtgat 20 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F <400> 38 agtggtcatc cwttwttwaa taaattkgat ga 32 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F2 <400> 39 agtggccatc cwttdtwkaa taggywkgat ga 32 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GPM7R <400> 40 ccawagccwg tatcwaccat rtcaccatc 29 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 tctgtccact cctgatgctg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tcaagcgtcc catagactca 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 43 tgccacggat gcttatgtta 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 44 cttacgttta ggggcagcag 20 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 45 tgttgccaga tcctaacaag ttt 23 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 46 tttgcaataa aaacttacgt ccaa 24 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 47 ttgcctcctg tcccagtatc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 48 ttttggtttg gccttcaatc 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 49 tcttccacct ccttctgtgg 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 50 agtggcagat ggagcagaac 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 51 gttcccaagg tgtctgcatt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 52 ggacacaacc gcaccttagt 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 53 ggcagtgcta ggctgcttac 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 54 gctgagggtg cactacgttt 20 <210> 55 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 55 tgcagtatag agtatttagg gttaggc 27 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 56 gcgttttgca ggagaagaag 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 57 ttggatttcc tgacacctcc 20 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 58 agggaaataa aggtaggtac attgc 25 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 59 agatgtctct gtggcggtct 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 60 ctggccttta gtcctgcttg 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 61 agcaggacat tccaaaggtg 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 62 gtcacagggt gtgcaatcac 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 63 tagggtacgt ttgcctgacc 20 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 64 catacacagt accatacgga cacat 25 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 65 accatgccag cagttctagg 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 66 gctgtagacg cctttcgttt 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 67 tgtgcaacgc accaacttat 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 68 ggcagacgta gaggaggatg 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 69 gcctaaggtt tcgggatttc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 70 acccacacga acagaggaac 20 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 71 tatccgcata tcagtatagg gtgtt 25 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 72 tacatgccac aaggcacatt 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 73 tgcaggcagt tccagactaa 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 74 ttggctgaag aggaagagga 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 75 ccactgtgta cctgcctcct 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 76 atgcagggcg ttttagtttg 20 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 77 gtctgcattt cagtataggg tgttt 25 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 78 ttatgcaacc acgcgtaaaa 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 79 tacctgcctc ctaccccagt 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 80 gcgctgtacc cttagaggag 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 81 tgggttggaa gtgggtagag 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 82 cgtttgggtt tactggagga 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 83 gattgcttgc cgtaggacat 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 84 cacaacaaca cactaccgcc 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 85 gacttttggc tgttggcaat 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 86 gatggtgcac gggtagtagg 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 87 cccaataaat ttggccttcc 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 88 ttttggtgat ggggtagagg 20 <210> 89 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 89 acctgatgca accttatata atcca 25 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 90 ttacttcctg cgctttcgtt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 91 tagggtacgg ttgcctgatc 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 92 agaggaagag gtaggagccg 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 93 ggtgttagtg cccaaggtgt 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 94 ttactcattg ggtgcaacca 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 95 aagcagggca ttcctaaggt 20 <210> 96 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 96 caacatacca acaccaacat gac 23 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 97 tgggtcatcc ctattttcca 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 98 aagaagctgg acgtttggtg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 99 ccgcaagcag gaaataccta 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 100 cacacgtttc cgtttgtgtt 20 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 101 acaatccaga tactgaacgg ct 22 <210> 102 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 102 tgacactgaa acagccctag aa 22 <210> 103 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 103 tgaagctccc tgaccctaat aa 22 <210> 104 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 104 acccagactg caacaaaaac tt 22 <210> 105 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 105 gaccccaaca aatttggtct t 21 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 106 tggctgaaga ggaagaggaa 20 <210> 107 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 107 gtccatttac ctgaccccaa ta 22 <210> 108 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 108 caaaatggca cacacagaga tt 22 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 109 agtggttccc aaggtgtctg 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 110 cgtttggacc gtttacgttt 20 <210> 111 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 111 gcgcaccaac ttattttacc a 21 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 112 ctgaactgga ggatggtgct 20 <210> 113 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 113 catatggggc cctctgtcca ctcctgatgc tg 32 <210> 114 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 114 catatgccat ggtcaagcgt cccatagact ca 32 <110> Cheil General Hospital & Women's Healthcare Center <120> HPV Specific Probe and DNA Chip for Detection Genetic Type of HPV Containing Thereof <130> P14-B188 <160> 114 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 6 HPV <400> 1 actaatacac ctgtacaggc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 11 HPV <400> 2 tcaaatacct ctgtacaaaa t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 16 HPV <400> 3 accaatgttg cagtaaatcc a 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 18 HPV <400> 4 ccatgccgcc acgtctaatg tttc 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 30 HPV <400> 5 cgttctgcgc cccctgcaca a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 31 HPV <400> 6 agtaacaatg ctattacccc t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 32 HPV <400> 7 gcttgctctg cacaatcaaa t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 33 HPV <400> 8 tgtactaatg cagcacctgc c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 35 HPV <400> 9 aatgctaacc aggtaaaagc a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 39 HPV <400> 10 aagcccaata atgtatctac g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 40 HPV <400> 11 aatgcttctc gggtaaccct t 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 42 HPV <400> 12 gcctgtacac cacagtccaa t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 43 HPV <400> 13 aacgcatcag gtgttaccca a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 44 HPV <400> 14 aataatgtta gtgttaagga t 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 45 HPV <400> 15 aaacctgcac aattgcaacc t 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 51 HPV <400> 16 aaaaacacac ctgtacctcc a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 52 HPV <400> 17 aataataatt caggaaatcc t 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 53 HPV <400> 18 cgttccacac ctactacagc g 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 54 HPV <400> 19 acacctaata cattggctgc t 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 55 HPV <400> 20 aataatggta gtgtaaatcg c 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 56 HPV <400> 21 aagtccacac aagttaccac a 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 58 HPV <400> 22 tgtaacaata atgcagctgc t 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 59 HPV <400> 23 aagcctaata ctgtggttca g 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 62 HPV <400> 24 ttatgcccca atgctgcccc 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 66 HPV <400> 25 aagtctacac cagtcaatac a 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 67 HPV <400> 26 gtggtaacag taatgggcca g 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68a HPV <400> 27 aagcctacca atgtacaaca a 21 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68b HPV <400> 28 ttcctccaac aaaaatccta agg 23 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 69 HPV <400> 29 gcacagtctc aggtacagcg t 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 70 HPV <400> 30 gcctgtaagt ccactcaaca g 21 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 72 HPV <400> 31 tctcagccaa ctgactgcc 19 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 81 HPV <400> 32 atttggctgc tgccagtgag 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 82 HPV <400> 33 aaaaacgtac ctgtacctca g 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 84 HPV <400> 34 actaatgtgc aatatcgtgc g 21 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 90 HPV <400> 35 cccgggacaa tcttacta 18 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 91 HPV <400> 36 agcacctcag gtattacaca a 21 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for HBB <400> 37 tgctcggtgc ctttagtgat 20 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F <400> 38 agtggtcatc cwttwttwaa taaattkgat ga 32 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F2 <400> 39 agtggccatc cwttdtwkaa taggywkgat ga 32 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GPM7R <400> 40 ccawagccwg tatcwaccat rtcaccatc 29 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 tctgtccact cctgatgctg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tcaagcgtcc catagactca 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 43 tgccacggat gcttatgtta 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 44 cttacgttta ggggcagcag 20 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 45 tgttgccaga tcctaacaag ttt 23 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 46 tttgcaataa aaacttacgt ccaa 24 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 47 ttgcctcctg tcccagtatc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 48 ttttggtttg gccttcaatc 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 49 tcttccacct ccttctgtgg 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 50 agtggcagat ggagcagaac 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 51 gttcccaagg tgtctgcatt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 52 ggacacaacc gcaccttagt 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 53 ggcagtgcta ggctgcttac 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 54 gctgagggtg cactacgttt 20 <210> 55 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 55 tgcagtatag agtatttagg gttaggc 27 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 56 gcgttttgca ggagaagaag 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 57 ttggatttcc tgacacctcc 20 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 58 agggaaataa aggtaggtac attgc 25 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 59 agatgtctct gtggcggtct 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 60 ctggccttta gtcctgcttg 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 61 agcaggacat tccaaaggtg 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 62 gtcacagggt gtgcaatcac 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 63 tagggtacgt ttgcctgacc 20 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 64 catacacagt accatacgga cacat 25 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 65 accatgccag cagttctagg 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 66 gctgtagacg cctttcgttt 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 67 tgtgcaacgc accaacttat 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 68 ggcagacgta gaggaggatg 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 69 gcctaaggtt tcgggatttc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 70 acccacacga acagaggaac 20 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 71 tatccgcata tcagtatagg gtgtt 25 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 72 tacatgccac aaggcacatt 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 73 tgcaggcagt tccagactaa 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 74 ttggctgaag aggaagagga 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 75 ccactgtgta cctgcctcct 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 76 atgcagggcg ttttagtttg 20 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 77 gtctgcattt cagtataggg tgttt 25 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 78 ttatgcaacc acgcgtaaaa 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 79 tacctgcctc ctaccccagt 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 80 gcgctgtacc cttagaggag 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 81 tgggttggaa gtgggtagag 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 82 cgtttgggtt tactggagga 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 83 gattgcttgc cgtaggacat 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 84 cacaacaaca cactaccgcc 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 85 gacttttggc tgttggcaat 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 86 gatggtgcac gggtagtagg 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 87 cccaataaat ttggccttcc 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 88 ttttggtgat ggggtagagg 20 <210> 89 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 89 acctgatgca accttatata atcca 25 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 90 ttacttcctg cgctttcgtt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 91 tagggtacgg ttgcctgatc 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 92 agaggaagag gtaggagccg 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 93 ggtgttagtg cccaaggtgt 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 94 ttactcattg ggtgcaacca 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 95 aagcagggca ttcctaaggt 20 <210> 96 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 96 caacatacca acaccaacat gac 23 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 97 tgggtcatcc ctattttcca 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 98 aagaagctgg acgtttggtg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 99 ccgcaagcag gaaataccta 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 100 cacacgtttc cgtttgtgtt 20 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 101 acaatccaga tactgaacgg ct 22 <210> 102 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 102 tgacactgaa acagccctag aa 22 <210> 103 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 103 tgaagctccc tgaccctaat aa 22 <210> 104 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 104 acccagactg caacaaaaac tt 22 <210> 105 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 105 gaccccaaca aatttggtct t 21 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 106 tggctgaaga ggaagaggaa 20 <210> 107 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 107 gtccatttac ctgaccccaa ta 22 <210> 108 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 108 caaaatggca cacacagaga tt 22 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 109 agtggttccc aaggtgtctg 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 110 cgtttggacc gtttacgttt 20 <210> 111 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 111 gcgcaccaac ttattttacc a 21 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 112 ctgaactgga ggatggtgct 20 <210> 113 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 113 catatggggc cctctgtcca ctcctgatgc tg 32 <210> 114 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 114 catatgccat ggtcaagcgt cccatagact ca 32
Claims (25)
The probe comprising the HPV-16 probe represented by SEQ ID NO: 3, the HPV-18 probe represented by SEQ ID NO: 4, the HPV-31 probe represented by SEQ ID NO: 6, the HPV-33 probe represented by SEQ ID NO: HPV-35 probe. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, An HPV-53 probe, an HPV-56 probe, an HPV-58 probe, an HPV-59 probe, 28, an HPV-68 probe, an HPV-69 probe, an HPV-69 probe and an HPV-69 probe, which are shown in SEQ ID NO: A DNA probe for genotyping HPV genotypes, which comprises both a -82 probe and an internal control probe.
The DNA chip according to claim 2, wherein the internal control probe is a human beta globin (HBB) probe represented by SEQ ID NO: 37.
The DNA chip according to claim 2, which comprises all the probes of SEQ ID NOS: 1-36.
ii) 서열번호 38의 염기서열로 표시되는 프라이머 및 제1표지물질이 결합된 서열번호 40의 염기서열로 표시되는 프라이머 쌍인 것을 특징으로 하는 HPV 유전자 증폭용 프라이머; 및
iii) 피검자의 HPV 유전자를 PCR 증폭하는 수단;을 포함하는 HPV 검사키트.
(i) the HPV-16 probe represented by SEQ ID NO: 3, the HPV-18 probe represented by SEQ ID NO: 4, the HPV-31 probe represented by SEQ ID NO: 6, the HPV-33 probe represented by SEQ ID NO: The displayed HPV-35 probe. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, An HPV-53 probe, an HPV-56 probe, an HPV-58 probe, an HPV-59 probe, The HPV-68 probe, the HPV-68 probe, the HPV-69 probe and the HPV-69 probe, which are shown in SEQ ID NO: -82 probe;
(ii) a primer represented by the nucleotide sequence of SEQ ID NO: 40 to which the primer represented by the nucleotide sequence of SEQ ID NO: 38 and the first labeling substance are bound; And
iii) means for PCR amplifying the subject ' s HPV gene.
7. The method according to claim 6, wherein the means for PCR amplifying the HPV gene of the subject comprises a second labeling substance, DNA polymerase, dNTPs, dUTP, UDG (Uracil DNA Glucosidase) and PCR buffer. ≪ RTI ID = 0.0 > 8. < / RTI >
상기 제1표지물질을 검출하여 상기 증폭된 HPV 유전자 산물과 상기 HPV 프로브 염기서열의 혼성화여부를 검출하는 수단을 포함하는 것을 특징으로 하는 HPV 검사키트.
9. The method according to claim 8, wherein the amplification amount of the HPV gene is measured by measuring the intensity of fluorescence from the second labeling substance, which is a fluorescent substance, after amplification of the HPV gene, Means for calculating; And
And means for detecting the hybridization of the amplified HPV gene product and the HPV probe base sequence by detecting the first labeling substance.
The HPV test kit according to claim 6, further comprising a chamber for hybridizing the amplified HPV gene product and the HPV probe base sequence.
The method according to claim 6, wherein the primer pair comprises a pair of primers represented by the nucleotide sequence of SEQ ID NO: 42 to which the primer represented by the nucleotide sequence of SEQ ID NO: 41 and the first label substance are bound, ≪ / RTI > wherein the HBV probe further comprises an HBB probe, which is represented by the sequence.
The HPV test kit according to claim 6, wherein the HPV gene amplification primer further comprises a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39.
7. The HPV test kit according to claim 6, which comprises all the probes of SEQ ID NOS: 1-36.
(a) 피검자 유래 샘플의 HPV 유전자를 PCR 증폭하는 단계;
(b) 제2항 내지 제3항 및 제5항 중 어느 한 항의 HPV 유전자형 검사용 DNA 칩에 상기 증폭된 HPV 유전자 산물을 혼성화하는 단계; 및
(c) 상기 증폭된 HPV 유전자 산물과 상기 HPV 유전자형 검사용 DNA 칩의 혼성화여부를 검출하는 단계.
HPV testing methods including the following steps:
(a) PCR amplifying the HPV gene of the sample from the subject;
(b) hybridizing the amplified HPV gene product to a DNA chip for HPV genotyping according to any one of (2) to (3) and (5); And
(c) detecting hybridization of the amplified HPV gene product with the DNA chip for HPV genotyping.
The method according to claim 15, wherein the step (a) of PCR amplifying the HPV gene of the subject-derived sample comprises the step of detecting the primer represented by the nucleotide sequence of SEQ ID NO: 38 and the primer pair represented by the nucleotide sequence of SEQ ID NO: Wherein the HPV gene of the subject-derived sample is subjected to PCR amplification using a primer for amplifying the HPV gene and a second labeling substance showing an amplification amount of the HPV gene in relation to the amplified HPV gene.
The method according to claim 16, further comprising the step of calculating an HPV virus load based on the amount of HPV gene amplification calculated using the second labeling substance.
The method according to claim 16, further comprising using a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.
17. The method according to claim 16, wherein hybridization of the DNA chip is detected by detecting the first labeling substance.
17. The method according to claim 16, wherein the second labeling substance is a fluorescent substance, and the amplification amount of the HPV gene is calculated by measuring the intensity of fluorescence from the second labeling substance.
16. The method of claim 15, wherein the PCR is real-time PCR.
16. The method of claim 15, wherein the HPV positive standard and the HPV negative standard are tested together.
17. The method of claim 16, wherein the first labeling material is selected from the group consisting of Cy5, Cy3, Cy5.5, FAM, TAMRA, HEX, and TEXASRED, Wherein the second labeling material is a fluorescent material, SYBR green I.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140096666A KR101761701B1 (en) | 2014-07-29 | 2014-07-29 | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140096666A KR101761701B1 (en) | 2014-07-29 | 2014-07-29 | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20160014430A KR20160014430A (en) | 2016-02-11 |
KR101761701B1 true KR101761701B1 (en) | 2017-07-26 |
Family
ID=55351644
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020140096666A KR101761701B1 (en) | 2014-07-29 | 2014-07-29 | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101761701B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107828920A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | A variety of high-risk human mammilla papillomavirus are realized with the kit of parting |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101886278B1 (en) * | 2016-11-04 | 2018-08-08 | 주식회사 퀀타매트릭스 | Composition for determinating genomic types of human papillomavirus |
KR102350455B1 (en) * | 2019-08-22 | 2022-01-11 | 김성현 | DNA kit for early diagnosis of oral cancer and its use |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6218104B1 (en) | 1987-02-26 | 2001-04-17 | Biosearch International Pty. Ltd. | Method of detection of carcinogenic human papillomavirus |
-
2014
- 2014-07-29 KR KR1020140096666A patent/KR101761701B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6218104B1 (en) | 1987-02-26 | 2001-04-17 | Biosearch International Pty. Ltd. | Method of detection of carcinogenic human papillomavirus |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107828920A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | A variety of high-risk human mammilla papillomavirus are realized with the kit of parting |
CN107828920B (en) * | 2017-12-18 | 2021-08-06 | 苏州国科闻普生物科技有限公司 | Kit for realizing typing of multiple high-risk human papilloma viruses |
Also Published As
Publication number | Publication date |
---|---|
KR20160014430A (en) | 2016-02-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Yang et al. | Quantification of human papillomavirus DNA in the plasma of patients with cervical cancer | |
CN105087827B (en) | Detection primer, probe and the kit of 16 kinds of type HPV viruses | |
WO2022100444A1 (en) | Probe set for human papillomavirus (hpv) typing and integration detection and kit thereof | |
KR101761701B1 (en) | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof | |
KR100914911B1 (en) | Method and kit for detecting human papillomavirus quantitatively and qualitatively using real-time pcr and hpv dna chip | |
CN112575123B (en) | Primer combination, probe combination and human papillomavirus nucleic acid detection kit | |
EP2373819B1 (en) | Multiparameter assay | |
KR101402204B1 (en) | A method for detecting oncogenic types of human papilloma virus using liquid beads array and multiplex pcr | |
Wang et al. | Diagnostic performance of the E6/E7 mRNA-based Optimygene HR-HPV RT-qDx assay for cervical cancer screening | |
CN116769964A (en) | Primer, primer probe composition and kit for detecting high-risk human papilloma virus | |
CN113584225B (en) | Primer and probe combination for detecting HPV (human papillomavirus) virus, typing detection reagent and application thereof | |
WO2018207022A1 (en) | Association between integration of high-risk hpv genomes detected by molecular combing and the severity and/or clinical outcome of cervical lesions | |
KR101413702B1 (en) | Method for genotyping oncogenic types of human papillomavirus by nmrt-pcr | |
KR101462643B1 (en) | Dna chip for determining genomic types of human papillomavirus, kit comprising the same and determining method of genomic types of human papillomavirus using the same | |
EP3317429A1 (en) | Hpv detection method | |
JP3600616B2 (en) | Primer set for detecting human papilloma virus, detection method, and DNA array for detection | |
CN113316648A (en) | Association between the integration of the viral HPV or HIV genome and the severity and/or clinical outcome of HPV-related cervical lesions or AIDS pathological conditions | |
JP5898831B2 (en) | Detection of human papillomavirus | |
CN102033099B (en) | Method for quantifying HPV (human papilloma virus) by utilizing mass-spectrometric technique | |
CN109777887B (en) | Method for detecting multiple types of viruses and detection kit | |
Guo et al. | Physical status and variant analysis of human papillomavirus 16 in women from Shanghai | |
KR20180007432A (en) | Multianalytical HPV Genotyping Luminex kit and HPV gene Detection Method Thereof | |
CN115927760A (en) | Primer group for detecting high-risk subtype of human papilloma virus, detection method and application | |
KR20060005089A (en) | Type-specific oligonucleotide, primers and methods for determining of human papillomavirus genotypes by pcr | |
KR101459074B1 (en) | Dna chip for determining genomic types of human papillomavirus, kit comprising the same and determining method of genomic types of human papillomavirus using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
AMND | Amendment | ||
E601 | Decision to refuse application | ||
AMND | Amendment | ||
E90F | Notification of reason for final refusal | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant |