KR20160014430A - HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof - Google Patents

Abstract

The present invention relates to an HPV specific probe and an HPV genetic type detecting DNA chip containing the same, and more specifically, to an HPV probe specific to at least one HPV genetic type selected among HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV-90, and HPV-91; an HPV genetic type detecting DNA chip containing the same; an HPV genetic type detecting kit; and a detecting method of the HPV genetic type. Since the invention detects genetic types of 36 types of HPV virus with high specificity and sensitivity, the invention is very useful in analyzing the precancerous change, condition, degree of risk, and prognosis of cervical cancer.

Description

[0001] The present invention relates to an HPV-specific probe and a DNA chip for use in the HPV genotype-

The present invention relates to an HPV-specific probe and a DNA chip for HPV genotyping comprising the same. More particularly, the present invention relates to a DNA chip for HPV-6, HPV-11, HPV-16, HPV-18, HPV- 32, HPV-33, HPV-35, HPV-39, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV- HPV-55, HPV-56, HPV-58, HPV-59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV- An HPV genotype-specific DNA chip, an HPV genotyping kit, and an HPV genotyping kit comprising the HPV probe specific for at least one HPV genotype selected from the group consisting of HPV-81, HPV-82, HPV-84, HPV-90 and HPV- Lt; / RTI >

Cervical cancer is a malignant tumor originating from the uterine cervix, accounting for more than 95% of all uterine cancer incidence. It is the second most common cancer among women worldwide, with an incidence of about 440,000 cases of cervical cancer per year Are reported as new. The incidence of cervical cancer in women is 10.6%, which is the third most common cause of gastric cancer (15.8%) and breast cancer (15.1%). Recently, cervical cancer incidence in women in their 20s and 30s has increased to 32% of all patients.

Cervical cancer is usually caused by HPV infection in the cervical epithelial basal cells, followed by long-term developmental stages such as low grade epithelial dysplasia (LSIL), advanced epithelial dysplasia (HSIL), and intraepithelial cancer (CIS) Develop. Since there is a pre-stage lesion before the final cancer, cervical cancer can be prevented early by effectively treating these lesions.

As described above, the onset of cervical cancer has been found to be a major factor in HPV infection due to sexual contact. HPV is an 8kb double-stranded circular DNA virus. The HPV gene has early (E) region functionally involved in transcription and gene regulation and late (L) region coding viral capsid protein. E6 The protein inhibits the p53 protein and the E7 protein inhibits the Rb protein. Therefore, the degree of E6 / E7 gene expression may be a marker of the risk of cervical cancer.

To date, more than 120 different genotypes have been identified based on sequence differences in the open reading frame, and among them about 32 HPV types (HPV-6, -11, -16, -18, -26 -30, -31, -32, -33, -35, -39, -40, -42, -43, -44, -45, -51, -52, -53, -54, 56, -57, -58, -59, -61, -66, -67, -68, -69, -70, -73) are known to cause cervical cancer.

Currently, methods for primary screening of cervical cancer and its precursor lesions can be classified into cytologic methods and molecular biologic methods. Molecular biological methods include direct contact between HPV DNA and probes And PCR using amplification of HPV DNA.

Cytologic methods including pap smears based on cytologic forms of cervical cytology have been used as a screening method for cervical cancer since the 1940s, but the results of the screening are subjective, especially with a false negative rate of 30-40% There are disadvantages.

In order to improve the inaccuracies of cervical cytology, various tests such as cervicography and biopsy have been used complementarily. In 1992, HPV test was performed to evaluate the efficacy of cervical cancer and precancerous lesion screening (Cox JT, et al ., Obstet Gynecol 80: 389, 1992).

Among the quantitative test methods, the Hybrid Capture II system utilizes a chemiluminescent detection method to detect high-risk HPV RNA probe cocktail or mixture in DNA extracted from cervical cells. And low-risk HPV RNA probe cocktail or mixture (HPV RNA probe cocktail or mixture). The RNA-DNA polymer is then bound to a primary immunoblot attached to the test tube, followed by a second immunoblot The method of quantifying HPV DNA by analyzing the relative amounts of the luminescence amount and the luminescence amount of the sample for the positive and negative control groups after the addition of the chemiluminescent substance and measuring the degree of the luminescence amount thereof (Impramin C. Abstract presented at 92nd General meeting of the American Society of Microbiology, 1992). However, the Hybrid Capture II system has a disadvantage in that each HPV genotype is unknown because the probes corresponding to each genotype are mixed. In addition, there is a disadvantage in that the sensitivity of the test is deteriorated because it is not amplified by the polymerase chain reaction method.

In order to overcome these drawbacks, the inventors of the present invention found that a DNA chip for HPV DNA test, which can be easily used by anyone, and both HPV viral load quantification and genotype analysis of HPV, which are known to cause cervical cancer, (Korean Patent No. 10-0914911). However, the HPV test chip has a disadvantage in that some genotypes cause interference, low specificity of detection, and low sensitivity of the probe.

Therefore, the present inventors have made intensive efforts to develop a DNA chip for HPV test with high diagnostic specificity and sensitivity without any interference between genotypes at the time of diagnosis of HPV using DNA chip. As a result, It has been confirmed that the genotype of HPV can be more accurately and efficiently tested than the conventional HPV test chip when the HPV probe having high sensitivity without causing interference is developed and fixed to the diagnostic chip, .

In order to achieve the above object, the present invention provides an HPV-specific probe having high diagnostic specificity and sensitivity without interference between genotypes, and a DNA chip for HPV testing comprising the same.

It is another object of the present invention to provide an HPV test kit having high diagnostic specificity and sensitivity without interference between genotypes.

Another object of the present invention is to provide an HPV test method having high diagnostic specificity and sensitivity without interference between genotypes.

In order to achieve the above-mentioned object, the present invention provides a method for screening for HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV- HPV-40, HPV-40, HPV-40, HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV- 59, HPV-62, HPV-66, HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV- Specific HPV-specific probe selected from the group consisting of SEQ ID NOS: 1 to 36, which is specific for at least one HPV genotype selected from the group consisting of HPV-91.

The present invention also provides a DNA chip for testing an HPV genotype comprising the probe.

The present invention also relates to a kit for the detection of HPV-specific probes; ii) primers for HPV gene amplification; And iii) means for PCR amplifying the HPV gene of the subject.

(A) PCR amplifying the HPV gene of the subject-derived sample; (b) hybridizing the amplified HPV gene product to the DNA chip for HPV genotyping; And (c) detecting whether the amplified HPV gene product and the DNA chip for HPV genotyping are hybridized.

(A) amplifying the L1 (late expressed gene) region of the HPV genotype with an amplification primer; And (b) inserting the amplified product into a vector to prepare a HPV genotype reference material plasmid.

According to the present invention, the genotype of 36 types of HPV viruses can be examined with high specificity and sensitivity, and it is very useful for analyzing the HPV-induced precancerous lesions and cervical cancer patterns, risk levels and prognosis.

FIG. 1 shows the probe positions of a DNA chip for HPV genotyping according to the present invention.
Figure 2 shows a method of preparing a reference material of HPV genotype according to the present invention.
FIGS. 3 to 9 show results obtained by hybridizing a DNA chip for HPV genotyping according to the present invention with a standard HPV type reference material corresponding to a probe that can be compared with a conventional HPV genotyping DNA chip (Korean Patent No. 10-0914911) .
FIG. 10 shows the result of hybridizing a DNA chip for HPV genotyping according to the present invention with a reference material of HPV type corresponding to a probe of a gene which can be further detected.

In the present invention, the 31 kinds of HPV genotyping methods (Korean Patent No. 10-0914911) improve the signal interference between some HPV genotypes, improve the sensitivity and specificity of probes, We have developed a DNA chip capable of testing 36 types of HPV genotypes with high sensitivity and specificity.

In one aspect, the present invention relates to a pharmaceutical composition comprising HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV- , HPV-42, HPV-43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV- HPV-90, HPV-90, HPV-90, HPV-90, HPV-90, HPV- Wherein the probe is an HPV probe selected from the group consisting of SEQ ID NOS: 1 to 36, and a DNA chip for HPV genotyping comprising the probe.

The DNA chip for HPV genotyping of the present invention may further include a probe represented by SEQ ID NO: 37, which is a probe for the control probe human beta globin gene (HBB).

Preferably, the DNA chip for HPV genotyping of the present invention comprises an HPV-16 probe represented by SEQ ID NO: 3, an HPV-18 probe represented by SEQ ID NO: 4, an HPV-30 probe represented by SEQ ID NO: 5, 9, an HPV-33 probe represented by SEQ ID NO: 8, and an HPV-35 probe represented by SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, The HPV-59 probe, the HPV-56 probe, the HPV-58 probe, the HPV-59 probe, the HPV-59 probe, The HPV-68a probe of SEQ ID NO: 27, and the HPV-68b probe of SEQ ID NO: 28, and more preferably all of the probes of SEQ ID NOs: 1-36.

In one embodiment of the present invention, when a DNA chip (FIG. 1) in which 36 types of HPV probes shown in Table 2 were hybridized with 36 kinds of HPV DNA standards, a conventional HPV chip (Korean Patent No. 10-0914911) The interference between HPV-6 and HPV-11, the interference between HPV-33 and HPV-67, the interference between HPV 43 and HPV-91, the interference between HPV-44 and HPV-40, Interference, interference of HPV 53 with HPV-62, interference with HPV 59 and HPV 58, and interference with HPV-66 and HPV 56 were not confirmed in the DNA chip of the present invention. In addition, the sensitivity of the signal was enhanced in most genotypes. In particular, the sensitivity of the signal was enhanced in HPV-31, HPV-35, HPV-39, HPV-40, HPV-43, HPV-45, HPV- HPV-59 and HPV-69 were significantly improved in signal intensity and increased in sensitivity.

In another aspect, the present invention provides a method for detecting HPV, comprising: i) contacting the HPV-specific probe; ii) primers for HPV gene amplification; And iii) means for PCR amplifying the HPV gene of the subject.

In the present invention, the primer for amplifying the HPV gene (ii) comprises a primer represented by the nucleotide sequence of SEQ ID NO: 38 and a primer pair comprising the primer pair represented by the nucleotide sequence of SEQ ID NO: 40 And means for PCR amplifying the HPV gene of the subject includes a second labeling substance, a DNA polymerase, dNTPs, dUTP, UDG (Uracil DNA Glucosidase) and a PCR buffer solution indicating the HPV gene amplification amount in relation to the amplified HPV gene .

In the present invention, the kit may further comprise a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.

In the present invention, the HPV test kit may measure the intensity of fluorescence from the second labeling substance, which is a fluorescent substance, after amplification of the HPV gene, calculate the amplification amount of the HPV gene, and, based on the calculated amplification amount of the HPV gene Means for calculating an HPV virus load, and means for detecting the first labeling substance and detecting hybridization of the amplified HPV gene product and the HPV probe base sequence.

The HPV genetic test chip of an embodiment of the present invention may further include a substrate to which the base sequence of the HPV probe is attached, and a chamber coupled to the substrate and hybridizing the HPV gene and the HPV probe base sequence.

In one embodiment of the present invention, the first labeling substance may be a fluorescent substance Cy5 and the second labeling substance may be a fluorescent substance CyBR green I, but the present invention is not limited thereto, Various labeling substances such as known radioactive substances or luminescent substances can be used.

Preferably, the probe of the present invention comprises the HPV-16 probe of SEQ ID NO: 3, the HPV-18 probe of SEQ ID NO: 4, the HPV-31 probe of SEQ ID NO: 6, the HPV -33 probe and the HPV-35 probe shown in SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, An HPV-53 probe, an HPV-56 probe, an HPV-58 probe, an HPV-59 probe, The HPV-68 probe, the HPV-68 probe, the HPV-69 probe and the HPV-69 probe, which are shown in SEQ ID NO: And -82 probes, and more preferably all of the probes of SEQ ID NOS: 1-36.

In the present invention, a primer pair for HBB gene detection comprising a pair of primers represented by the nucleotide sequence of SEQ ID NO: 42 to which a primer represented by the nucleotide sequence of SEQ ID NO: 41 and a first labeling substance are combined and a nucleotide sequence of SEQ ID NO: And may further include an HBB probe to be displayed.

In addition, the kit of the present invention may further comprise a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.

In yet another aspect, the present invention provides a method for detecting an HPV infection comprising: (a) PCR amplifying an HPV gene of a subject-derived sample; (b) hybridizing the amplified HPV gene product to the DNA chip for HPV genotyping; And (c) detecting whether the amplified HPV gene product and the DNA chip for HPV genotyping are hybridized.

In the present invention, the step (a) of PCR amplifying the HPV gene of the sample derived from a subject comprises a primer represented by the nucleotide sequence of SEQ ID NO: 38 and a pair of primers represented by the nucleotide sequence of SEQ ID NO: 40 The HPV gene of the subject-derived sample can be amplified by PCR using a second labeling substance showing the amplification amount of the HPV gene in relation to the primer for amplifying the HPV gene and the HPV gene to be amplified,

The step of calculating the HPV virus load based on the amount of HPV gene amplification calculated using the second labeling substance may be performed.

The amplification of step (a) may be performed by additionally adding a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.

The detection of the hybridization can detect the hybridization of the amplified HPV gene product and the DNA chip for HPV genotyping by detecting the first labeling substance.

In the present invention, the second labeling substance is a fluorescent substance, and the amplification amount of the HPV gene is calculated by measuring the intensity of fluorescence from the second labeling substance.

In the present invention, the PCR may be a real-time PCR, and the HPV positive standard and the HPV negative standard may be tested together.

In the present invention, the first labeling material may be a fluorescent material such as Cy5, Cy3, Cy5.5, FAM, TAMRA, HEX, TEXASRED, and the second labeling material may be a CyberGreen I (SYBR green I) can be used.

In the present invention, a sample derived from a subject can be a sample from which HPV can be detected, such as cervical-derived cells, oral mucosal cells, blood, semen and the like.

In one embodiment of the present invention, HPV genotyping of the present invention using a sample of 424 cervical cell samples revealed that the sensitivity, specificity, and accuracy were 99.0%, 100%, and 99.3%, respectively, .

In another aspect, the present invention provides a method for amplifying an HPV genotype comprising the steps of (a) amplifying an L1 (late expressed gene) region of an HPV genotype with an amplification primer; And (b) inserting the amplified product into a vector to prepare a HPV genotype reference material plasmid.

In the present invention, the primers include a pair of HPV-6 amplification primers of SEQ ID NOs: 43 and 44, a pair of HPV-11 amplification primers of SEQ ID NOs: 45 and 46, a pair of HPV-16 amplification primers of SEQ ID NOs: 47 and 48, 51, 52, a pair of primers for amplification of HPV-31 of SEQ ID NOs: 53 and 54, a pair of primers for amplification of HPV-18 of SEQ ID NOs: 59 and 60, primer pairs for HPV-35 amplification of SEQ ID Nos. 59 and 60, primer pairs for HPV-39 amplification of SEQ ID Nos. 61 and 62, primer pairs for priming HPV- The primer pairs for HPV-40 amplification for the HPV-40 amplification, the primers for the HPV-40 amplification for the HPV-40 amplification, the primer pair for the HPV-40 amplification for the HPV- Primer pairs for the HPV-45 amplification, HPV-51 amplification primer pairs for the SEQ ID NOs: 73 and 74, HPs for the HPV-51 amplification primer pair for the HPV- Primer pairs for amplification of V-52, primers for amplification of HPV-53 of SEQ ID NOs: 77 and 78, primers for amplification of HPV-54 of SEQ ID NOs: 79 and 80, primers for amplification of HPV-55 of SEQ ID NOs: 81 and 82, A primer pair for amplification of HPV-56 of SEQ ID NOS: 83 and 84, a pair of primers for amplification of HPV-58 of SEQ ID NO: 85 and 86, a pair of primers for amplification of HPV-59 of SEQ ID NO: 87, A primer pair for HPV-68 amplification, a primer pair for HPV-68 amplification, a primer pair for HPV-68 amplification, a pair of primers for amplification of HPV- A primer pair for amplification of HPV-70 of SEQ ID NOS: 97 and 98, a pair of primers for amplification of HPV-70 of SEQ ID NOS: 99 and 100, a pair of primers for amplification of HPV- 81, amplification primer pairs, primers of HPV-82 amplification primers of SEQ ID NOs: 105, 106, primer pairs of HPV-84 of SEQ ID NOs: 107, 108, A primer pair for amplification of HPV-90, and a pair of primers for amplifying HPV-91 of SEQ ID NO: 111 and 112.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Selection of common primers for HPV DNA genotypes

 A common HPV DNA primer capable of amplifying all 36 types of HPV DNA genotypes accurately and with high binding efficiency with the template was constructed as follows.

-11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, ..., 43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -70, -72, -81, -82, -84, -90, and -91 genomic DNA sequences of 36 HPV DNA genotypes. The obtained 36 kinds of HPV DNA sequences were subjected to pairwise alignment and multiple sequence alignment using the computer program DNASTAR Lagergene 7.1 (DNASTAR Inc.) according to the ClustalW method, and 36 kinds of HPV The HPV DNA genotype common primer capable of amplifying the DNA genotype was finally selected and designated as GPM7F primer (SEQ ID NO: 38), GPM7F2 primer (SEQ ID NO: 39) and GPM7R primer (SEQ ID NO: 40) Table 1).

For signal validation, the GPM7R primer is labeled with Cy5 and labeled with a fluorescent material other than Cy5.

Sequence of HPV common PCR primer Primer name Base sequence SEQ ID NO: GPM7F AGTGGTCATCCWTTWTTWAATAAATTKGATGA 38 GPM7F2 AGTGGCCATCCWTTDTWKAATAGGYWKGATGA 39 GPM7R CCAWAGCCWGTATCWACCATRTCACCATC 40

Example 2: Selection and synthesis of HPV DNA genotype-specific probes

-11, -16, -18, -30, -31, -32, -33, -35, -39, -40, -42, ..., 43, -44, -45, -51, -52, -53, -54, -55, -56, -58, -59, -62, -66, -67, -68a, -68b, -70, -72, -81, -82, -84, -90, and -91 genomic DNA sequences of 36 HPV DNA genotypes. The obtained 36 kinds of HPV DNA sequences were subjected to pairwise alignment and multiple sequence alignment using the computer program DNASTAR Lagergene 7.1 (DNASTAR Inc.) according to the ClustalW method, and 36 kinds of HPV Probes specific to DNA genotypes (SEQ ID NOS: 1 to 36) were finally selected (Table 2).

HPV DNA genotype specific probe base sequence SEQ ID NO: HPV genotype Base sequence One TYPE 6  ACTAATACACCTGTACAGGCT 2 TYPE 11  TCAAATACCTCTGTACAAAAT 3 TYPE 16  ACCAATGTTGCAGTAAATCCA 4 TYPE 18  CCATGCCGCCACGTCTAATGTTTC 5 TYPE 30  CGTTCTGCGCCCCCTGCACAA 6 TYPE 31  AGTAACAATGCTATTACCCCT 7 TYPE 32  GCTTGCTCTGCACAATCAAAT 8 TYPE 33  TGTACTAATGCAGCACCTGCC 9 TYPE 35  AATGCTAACCAGGTAAAAGCA 10 TYPE 39  AAGCCCAATAATGTATCTACG 11 TYPE 40  AATGCTTCTCGGGTAACCCTT 12 TYPE 42  GCCTGTACACCACAGTCCAAT 13 TYPE 43  AACGCATCAGGTGTTACCCAA 14 TYPE 44  AATAATGTTAGTGTTAAGGAT 15 TYPE 45  AAACCTGCACAATTGCAACCT 16 TYPE 51  AAAAACACACCTGTACCTCCA 17 TYPE 52  AATAATAATTCAGGAAATCCT 18 TYPE 53  CGTTCCACACCTACTACAGCG 19 TYPE 54  ACACCTAATACATTGGCTGCT 20 TYPE 55  AATAATGGTAGTGTAAATCGC 21 TYPE 56  AAGTCCACACAAGTTACCACA 22 TYPE 58  TGTAACAATAATGCAGCTGCT 23 TYPE 59  AAGCCTAATACTGTGGTTCAG 24 TYPE 62  TTATGCCCCAATGCTGCCCC 25 TYPE 66  AAGTCTACACCAGTCAATACA 26 TYPE 67  GTGGTAACAGTAATGGGCCAG 27 TYPE 68a  AAGCCTACCAATGTACAACAA 28 TYPE 68b  TTCCTCCAACAAAAATCCTAAGG 29 TYPE 69  GCACAGTCTCAGGTACAGCGT 30 TYPE 70  GCCTGTAAGTCCACTCAACAG 31 TYPE 72  TCTCAGCCAACTGACTGCC 32 TYPE 81  ATTTGGCTGCTGCCAGTGAG 33 TYPE 82  AAAAACGTACCTGTACCTCAG 34 TYPE 84  ACTAATGTGCAATATCGTGCG 35 TYPE 90  CCCGGGACAATCTTACTA 36 TYPE 91  AGCACCTCAGGTATTACACAA

The probe for the human beta globin (HBB) gene to be used as an internal control is shown in SEQ ID NO: 37.

HBB probe: TGCTCGGTGCCTTTAGTGAT (SEQ ID NO: 37)

To attach 36 selected HPV DNA-specific probes and HBB-specific probes to aldehyde-coated slides, amine groups were attached at the 5 'end. To enhance the binding strength between the probe attached to the HPV DNA chip and the PCR amplification product The probe was synthesized by attaching a non-specific base to the 5 'amine group.

Example 3: Production of HPV DNA chip for HPV genotyping

An oligonucleotide microarray DNA chip for analyzing HPV DNA genotypes containing probes capable of analyzing genotype of HPV DNA selected in Example 2 with high specificity and sensitivity was prepared as follows.

6 μl of a spotting solution was added to 6 μl of the 36 kinds of HPV DNA-specific probes (50 pmol / μl) and HBB-specific probes (50 pmol / μl) prepared in Example 2 to obtain a concentration of 25 pmol / And uniformly mixed. A glass slide (Luminano, Inc.) coated with an aldehyde group on the surface of the slide was prepared and the glass slide was divided into 8 sections using an 8-well hybridization chamber (Gracebio Inc.). 36 kinds of HPV DNA-specific probes and HBB-specific probes set at a concentration of 25 pmol / l per zone were attached to the glass slides at regular intervals and arrangements using a microarrayer. Each of the 36 HPV DNA-specific probes and HBB-specific probes were attached to each probe, and a fluorescent positive control with a fluorescent material Cy3 attached thereto was attached so that the position of the amplification product bound to the probe could be confirmed. It was kept at room temperature, shade, humidity less than 30% until use.

The location of the probes immobilized on the prepared DNA chip for HPV genotyping is shown in FIG.

Example 4 Production of Reference Materials for HPV DNA

To confirm the sensitivity and specificity of the probes specific for 36 HPV genotypes, 36 standard HPV DNA hybridization standards were prepared.

PCR products obtained using the genotype specific primers shown in Table 3 were cloned into pGEM T Easy vector (Promega, USA) (Fig. 2), and plasmid isolation kit core Biosystems, Korea; product number standard material using a PM-200) purified plasmid and extraction with Tris-EDTA to a minimum detection limit near concentration (1x10 ¹ ~ 5x10 ³ copies / ㎕) of each species After dilution, 20 μl of each solution was dispensed into 1.5 ml tubes and stored at -20 ° C or below.

genotype
(Gene number) Sequence (upstream / downstream) SEQ ID NO: Start / End (bp) Product size (bp) HPV 6
(NC_001355) tgccacggatgcttatgtta 43 5851 1421 cttacgtttaggggcagcag 44 7271 HPV 11
(M14119) tgttgccagatcctaacaagttt 45 5989 1185 tttgcaataaaaacttacgtccaa 46 7173 HPV 16
(GQ465893.1) ttgcctcctgtcccagtatc 47 115 1401 ttttggtttggccttcaatc 48 1515 HPV 18
(AY262282) tcttccacctccttctgtgg 49 5648 1461 agtggcagatggagcagaac 50 7108 HPV 30
(X74474) gttcccaaggtgtctgcatt 51 5836 1510 ggacacaaccgcaccttagt 52 7345 HPV 31
(J04353) ggcagtgctaggctgcttac 53 5663 1381 gctgagggtgcactacgttt 54 7043 HPV 32
(X74475) tgcagtatagagtatttagggttaggc 55 6072 1295 gcgttttgcaggagaagaag 56 7366 HPV 33
(M12732) ttggatttcctgacacctcc 57 5844 1570 agggaaataaaggtaggtacattgc 58 7413 HPV 35
(GQ479039.1) agatgtctctgtggcggtct 59 5572 1436 ctggcctttagtcctgcttg 60 7007 HPV 39
(M62849) agcaggacattccaaaggtg 61 5828 1482 gtcacagggtgtgcaatcac 62 7309 HPV 40
(X74478) tagggtacgtttgcctgacc 63 5992 1440 catacacagtaccatacggacacat 64 7431 HPV 42
(M73236) accatgccagcagttctagg 65 5940 1353 gctgtagacgcctttcgttt 66 7292 HPV 43
(AJ620205.1) tgtgcaacgcaccaacttat 67 5833 1403 ggcagacgtagaggaggatg 68 7235 HPV 44
(U31788) gcctaaggtttcgggatttc 69 5870 1265 acccacacgaacagaggaac 70 7134 HPV 45
(X74479) tatccgcatatcagtatagggtgtt 71 5805 1477 tacatgccacaaggcacatt 72 7281 HPV 51
(M62877) tgcaggcagttccagactaa 73 5628 1386 ttggctgaagaggaagagga 74 7013 HPV 52
(GQ472848.1) ccactgtgtacctgcctcct 75 5668 1440 atgcagggcgttttagtttg 76 7107 HPV 53
(EF546474.1) gtctgcatttcagtatagggtgttt 77 5844 1482 ttatgcaaccacgcgtaaaa 78 7325 HPV 54
(NC_001676) tacctgcctcctaccccagt 79 5641 1441 gcgctgtacccttagaggag 80 7081 HPV 55
(U31791) tgggttggaagtgggtagag 81 5994 1191 cgtttgggtttactggagga 82 7184 HPV 56
(X74483) gattgcttgccgtaggacat 83 5719 1392 cacaacaacacactaccgcc 84 7110 HPV 58
(D90400) gacttttggctgttggcaat 85 5764 1348 gatggtgcacgggtagtagg 86 7111 HPV 59
(X77858) cccaataaatttggccttcc 87 5842 1258 ttttggtgatggggtagagg 88 7099 HPV 62
(AY395706) acctgatgcaaccttatataatcca 89 6032 1258 ttacttcctgcgctttcgtt 90 7289 HPV 66
(EF177188.1) tagggtacggttgcctgatc 91 5862 1269 agaggaagaggtaggagccg 92 7130 HPV 67
(D21208.1) ggtgttagtgcccaaggtgt 93 5796 1497 ttactcattgggtgcaacca 94 7292 HPV 68
(DQ080079) aagcagggcattcctaaggt 95 5662 1418 caacataccaacaccaacatgac 96 7078 HPV 69
(AB027020) tgggtcatccctattttcca 97 5671 1338 aagaagctggacgtttggtg 98 7008 HPV 70
(U21941) ccgcaagcaggaaataccta 99 5760 1336 cacacgtttccgtttgtgtt 100 7095 HPV 72
(X94164) acaatccagatactgaacggct 101 6063 1174 tgacactgaaacagccctagaa 102 7236 HPV 81
(AJ620209) tgaagctccctgaccctaataa 103 6085 1200 acccagactgcaacaaaaactt 104 7284 HPV 82
(AB027021) gaccccaacaaatttggtctt 105 5701 1258 tggctgaagaggaagaggaa 106 6958 HPV 84
(AF293960) gtccatttacctgaccccaata 107 5881 1367 caaaatggcacacacagagatt 108 7247 HPV 90
(NC_004104.1) agtggttcccaaggtgtctg 109 5974 1329 cgtttggaccgtttacgttt 110 7302 HPV 91
(AF419318.1) gcgcaccaacttattttacca 111 5954 1391 ctgaactggaggatggtgct 112 7344

Example 5: Production of positive standard and negative standard (positive / negative control) for HPV test

(1) Preparation of Positive Reference Solution

Plasmid isolation kit (Core Biotechnology, Korea, PM-200) was used to clone the L1 (late expressed gene) region of HPV 16 type and human beta globin gene into pGEM T Easy vector (Promega, USA) And the extracted positive control solution was diluted with Tris-EDTA to a concentration of ⁵ × 10 ⁵ copies / μl, and the solution was dispensed into a 1.5 ml tube and stored at -20 ° C. or lower.

The L1 (late expressed gene) region of the HPV 16 type was amplified by PCR using the primer pairs of SEQ ID NOS: 47 and 48, and the human beta globin gene was amplified using the primers of SEQ ID NO: 113 and SEQ ID NO: 114 Table 4).

genotype
(Gene number) Sequence (upstream / downstream) Start / End (bp) Purpose Product Size (bp) Human Beta Globin
(NT_009237.18)
catatg gggccc - tctgtccactcctgatgctg (SEQ ID NO: 113)
ApaI-target gene-specific sequence 959 193 catatg ccatgg -tcaagcgtcccatagactca (SEQ ID NO: 114)
Nco I-specific gene specific sequence 1151

(2) Preparation of negative control solution

The human beta globin gene was amplified with the primer pairs of SEQ ID NOs: 41 and 42 and cloned into pGEM T Easy vector (Promega, USA). Plasmid isolation kit (Core Biosystem, Korea, PM-200) And the extracted positive control solution was diluted with Tris-EDTA to a concentration of ⁵ × 10 ⁵ copies / μl, and the solution was dispensed into a 1.5 ml tube and stored at -20 ° C. or lower.

genotype
(Gene number) Sequence (upstream / downstream) Start / End (bp) Purpose Product Size (bp) Human Beta Globin
(NT_009237.18 tctgtccactcctgatgctg (SEQ ID NO: 41) 959 193 tcaagcgtcccatagactca (SEQ ID NO: 42) 1151

Example 6: Sensitivity and specificity analysis of DNA chip for HPV genotyping

The sensitivity and specificity of the DNA chip for HPV genotyping prepared in Example 3 were confirmed using the standard material prepared in Example 4, and in order to compare with the HPV test chip, Korean Patent No. 10-0914911 Was used as a control.

To amplify the HPV reference material, prepare a real-time PCR reaction mixture at the following volumes: At this time, a solution obtained by diluting 1 ng / 占 퐇 of Human Genomic DNA (Roche, Germany, 1 691 112) was added to the PCR reaction mixture.

The HPV real-time PCR reaction mixture and human beta globin real-time PCR reaction mixture were dispensed into a 96-well plate in 15-μl aliquots, and HPV standard material, a positive control and a negative control solution were added and the total volume was adjusted to 20 μl. Real-time PCR was performed by placing a 96 well plate in an amplification apparatus.

HPV real-time PCR reaction mixture Configuration Capacity per reaction 40 Reaction capacity 2X Cyber Green Master Mix 10 μl 400 쨉 l GPM7F primer (SEQ ID NO: 38) 0.4 쨉 l 16 쨉 l GPM7F2 primer (SEQ ID NO: 39) 0.4 쨉 l 16 쨉 l GPM7R primer (SEQ ID NO: 40) 0.8 l 32 쨉 l UDG (5 units / L) 0.1 μl 4 μl Human genome DNA 1 μl 40 쨉 l Third distilled water 2.3 μl 92 쨉 l Total capacity 15 μl 600 쨉 l

Human Beta Globin Real Time PCR Reaction Mixture Configuration Capacity per reaction 40 Reaction capacity 2X Cyber Green Master Mix 10 μl 400 쨉 l Upstream human beta globin primer
(SEQ ID NO: 41) 0.5 μl 20 쨉 l Downstream human beta globin primer
(SEQ ID NO: 42) 0.5 μl 20 쨉 l UDG (5 units / L) 0.1 μl 4 μl Human genome DNA 1 μl 40 쨉 l Third distilled water 2.9 l 116 쨉 l Total capacity 15 μl 600 쨉 l

5 μl of the HPV real-time PCR product and 5 μl of the human Beta globin real-time PCR product were placed in the same 20 μl tube, followed by gentle centrifugation. The mixture was heated in a 95 ° C. heat block for 10 minutes and then immersed in ice ethanol Min or ice for 5 minutes. After gently centrifuging the tube, add 40 μl of a hybridization solution composed of SSC and SDS, mix well using a vortexer, and centrifuge again lightly.

The mixed solution was slowly poured into a well of a DNA chip for HPV genotyping and HPV test chip prepared in Example 4 and an HPV test chip published in Korean Patent No. 10-0914911, , And the mixture was placed in a 60 DEG C thermostat and allowed to react for 20 minutes. After the hybridization reaction, remove the well chamber with the chip immersed in the step 1 chip washing solution, and insert the chip into a tray.

The chips were placed in a tray and placed in a washing container containing 400 ml of the first stage chip washing solution (Table 8) and washed three times with a stirrer at 135 rpm for 2 minutes at room temperature. The chips were placed in a slide tray and placed in a washing container containing 400 ml of a two-step chip washing solution (Table 8) and washed three times with a stirrer at 135 rpm for 2 minutes at room temperature. The chip was placed in a slide tray and placed in a washing container containing 400 ml of the signal holding dilution solution (Table 9), allowed to stand for 30 seconds, and then centrifuged for 3 minutes in a slide-type dryer.

Composition of HPV chip washing solution Step 1 Chip Wash Solution Step 2 chip cleaning solution Chip Wash Solution I 75ml 60ml Chip Wash Solution II 7.5ml -   Third distilled water 1417.5ml 1140ml   Total capacity 1500ml 1200ml

  (Chip cleaning solution I consists of SSC and chip cleaning solution II consists of SDS)

Signal retention composition of dilute solution Signal Retention Dilution Solution Chip Wash Solution I 20ml Signal holding solution (20% SDS) 1ml   Third distilled water 379ml   Total capacity 400ml

The dried DNA chip was detected with a MS 200 program using a NimbleGen MS 200 scanner, the signal of position marker (M) at a wavelength of 532 nm, and the signal of HPV and human beta globin spot at a wavelength of 635 nm.

The detection results of each virus genotype are shown in FIGS. 3 to 10. The interference between HPV-6 and HPV-11, interference between HPV-33 and HPV-67, HPV 43 and HPV- 91, interference between HPV-44 and HPV-40, HPV-55, interference of HPV 53 with HPV-62, interference with HPV 59 and HPV 58, and interference of HPV- It was not confirmed on the DNA chip.

In addition, the sensitivity of the signal was enhanced in most genotypes. In particular, the sensitivity of the signal was enhanced in HPV-31, HPV-35, HPV-39, HPV-40, HPV-43, HPV-45, HPV- HPV-59 and HPV-69 were significantly improved in signal intensity and increased in sensitivity.

Example 7: Analysis of HPV genotypes using clinical samples

In this example, HPV genotypes were analyzed by the method of Example 6 using DNA isolated from clinical samples of cervical cells.

The subjects were 27 female patients whose Pap smear results were normal, 397 female patients who underwent a magnifying glass biopsy and HPV test and 424 female patients .

The results of this study were as follows: 1) Patients who were admitted to Cheil Hospital of Cheil Medical Center (Cheil Medical Center) and who agreed to participate in the study were followed up for cervical cytology. A sample of the cervix removed from the cervix was used by a physician.

Using the DNA extracted from the sample, DNA chip analysis for HPV genotyping was performed by the method of Example 6, and the accuracy of the result was confirmed by DNA sequencing of the HPV genotype of each sample.

HPV DNA was detected in 293 cases (69.10%) out of 424 cases and HPV DNA was not detected in 131 cases (30.90%) using the DNA chip for HPV genotyping of the present invention prepared in Example 3. Of the 293 HPV positive cases, 16 HPV DNA genotypes were present in 61 cases (14.39%), 58 HPV DNA genotypes were present in 22 cases (5.19%), 52 cases were in 19 cases (4.48%), 51 cases were in 15 cases 14 cases (3.30%) in 18 cases, 13 cases (3.07%) in 56 cases, and 11 cases (2.59%) in 31 cases and 68b cases respectively. Of the 293 cases detected in HPV, 3 cases (0.71%) of other genotypes and 26 cases (6.13%) of multiple infection were observed. The above contents are shown in Table 10.

The HPV genotyping result using the DNA chip of the present invention HYPVYP genotype Classification of HIPP Risk HYPVYP genotype
Appearance frequency Number of specimens % voice 131 30.90 Genotype 16 High 61 14.39 Genotype 58 High 22 5.19 Genotype 52 High 19 4.48 Genotype 51 High 15 3.54 Genotype 18 High 14 3.30 Genotype 56 High 13 3.07 Genotype 31 High 11 2.59 Genotype 68b High 11 2.59 Genotype 35 High 10 2.36 Genotype 53 High 10 2.36 Genotype 39 High 9 2.12 Genotype 33 High 8 1.89 Genotype 70 Low 8 1.89 Genotype 45 High 6 1.42 Genotype 90 Low 5 1.18 Genotype 42 Low 4 0.94 Genotype 54 Low 4 0.94 Genotype 81 Low 4 0.94 Genotype 84 Low 4 0.94 Genotype 91 Low 4 0.94 Genotype 30 Low 3 0.71 Genotype 62 Low 3 0.71 Genotype 66 High 3 0.71 Genotype 43 Low 2 0.47 Genotype 67 High 2 0.47 Genotype 82 High 2 0.47 Genotype 40 Low One 0.24 Genotype 44 Low One 0.24 Genotype 55 Low One 0.24 Genotype 59 High One 0.24 Genotype 68a High One 0.24 Genotype 69 High One 0.24 Genotype 72 Low One 0.24 Other genotypes 3 0.71 Multiple infection genotype 26 6.13 Sum 424 100.00

To analyze sensitivity, specificity and accuracy, HPV genotypes detected in this chip were classified by positive sequence, positive, false positive, false negative, and negative. The sensitivity, specificity, and accuracy were 99.0%, 100%, and 99.3%, respectively. The false positive rate was 0% and the false negative rate was 0.7%.

Genotyping results of HPV chip division positivity False positive False negative voice Sum Invention Number of specimens 293 0 3 128 424 % 69.1 0.0 0.7 30.2 100.0

Efficiency of HPV DNA Chip division Test Products responsiveness 99.0 Specificity 100 accuracy 99.3 False positive rate 0 False negative rate 0.7

The HPV positive rate was 29.63% in normal cases without cytopathologic findings, and the positive rate of HPV according to the severity of pathology. Of the total population.

Cervical cytology results Number of specimens HPV detection results Number of specimens % Normal 27 8 29.63 AGUS 3 0 0.00 ASC-US 174 98 56.32 ASC-H 41 29 70.73 LSIL 81 69 85.19 HSIL 83 74 89.16 AIS 2 2 100.00 CIS One One 100.00 ACC 3 3 100.00 SCC 9 9 100.00 Sum 424 293 69.10

* Normal: Normal

* AGUS: Atypical dysplasia

* ASC-US: atypical squamous cell epithelial disorder

* ASC-H: High grade lesion suspected atypical squamous cell epithelial disorder

* LSIL: low-grade squamous intraepithelial lesion

* HSIL: High grade squamous intraepithelial lesion

* AIS:

* CIS: squamous intraepithelial cancer

* ACC: invasive dermal cell carcinoma

* SCC: invasive flat epithelial cell cancer

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Cheil General Hospital & Women's Healthcare Center <120> HPV Specific Probe and DNA Chip for Detection Genetic Type of HPV          Containing Thereof <130> P14-B188 <160> 114 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 6 HPV <400> 1 actaatacac ctgtacaggc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 11 HPV <400> 2 tcaaatacct ctgtacaaaa t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 16 HPV <400> 3 accaatgttg cagtaaatcc a 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 18 HPV <400> 4 ccatgccgcc acgtctaatg tttc 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 30 HPV <400> 5 cgttctgcgc cccctgcaca a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 31 HPV <400> 6 agtaacaatg ctattacccc t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 32 HPV <400> 7 gcttgctctg cacaatcaaa t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 33 HPV <400> 8 tgtactaatg cagcacctgc c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 35 HPV <400> 9 aatgctaacc aggtaaaagc a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 39 HPV <400> 10 aagcccaata atgtatctac g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 40 HPV <400> 11 aatgcttctc gggtaaccct t 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 42 HPV <400> 12 gcctgtacac cacagtccaa t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 43 HPV <400> 13 aacgcatcag gtgttaccca a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 44 HPV <400> 14 aataatgtta gtgttaagga t 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 45 HPV <400> 15 aaacctgcac aattgcaacc t 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 51 HPV <400> 16 aaaaacacac ctgtacctcc a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 52 HPV <400> 17 aataataatt caggaaatcc t 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 53 HPV <400> 18 cgttccacac ctactacagc g 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 54 HPV <400> 19 acacctaata cattggctgc t 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 55 HPV <400> 20 aataatggta gtgtaaatcg c 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 56 HPV <400> 21 aagtccacac aagttaccac a 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 58 HPV <400> 22 tgtaacaata atgcagctgc t 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 59 HPV <400> 23 aagcctaata ctgtggttca g 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 62 HPV <400> 24 ttatgcccca atgctgcccc 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 66 HPV <400> 25 aagtctacac cagtcaatac a 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 67 HPV <400> 26 gtggtaacag taatgggcca g 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68a HPV <400> 27 aagcctacca atgtacaaca a 21 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 68b HPV <400> 28 ttcctccaac aaaaatccta agg 23 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 69 HPV <400> 29 gcacagtctc aggtacagcg t 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 70 HPV <400> 30 gcctgtaagt ccactcaaca g 21 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 72 HPV <400> 31 tctcagccaa ctgactgcc 19 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 81 HPV <400> 32 atttggctgc tgccagtgag 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 82 HPV <400> 33 aaaaacgtac ctgtacctca g 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 84 HPV <400> 34 actaatgtgc aatatcgtgc g 21 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 90 HPV <400> 35 cccgggacaa tcttacta 18 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe for Type 91 HPV <400> 36 agcacctcag gtattacaca a 21 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe for HBB <400> 37 tgctcggtgc ctttagtgat 20 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F <400> 38 agtggtcatc cwttwttwaa taaattkgat ga 32 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GPM7F2 <400> 39 agtggccatc cwttdtwkaa taggywkgat ga 32 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GPM7R <400> 40 ccawagccwg tatcwaccat rtcaccatc 29 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 tctgtccact cctgatgctg 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tcaagcgtcc catagactca 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 43 tgccacggat gcttatgtta 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV6 <400> 44 cttacgttta ggggcagcag 20 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 45 tgttgccaga tcctaacaag ttt 23 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV11 <400> 46 tttgcaataa aaacttacgt ccaa 24 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 47 ttgcctcctg tcccagtatc 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV16 <400> 48 ttttggtttg gccttcaatc 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 49 tcttccacct ccttctgtgg 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV18 <400> 50 agtggcagat ggagcagaac 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 51 gttcccaagg tgtctgcatt 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV30 <400> 52 ggacacaacc gcaccttagt 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 53 ggcagtgcta ggctgcttac 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV31 <400> 54 gctgagggtg cactacgttt 20 <210> 55 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 55 tgcagtatag agtatttagg gttaggc 27 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV32 <400> 56 gcgttttgca ggagaagaag 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 57 ttggatttcc tgacacctcc 20 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV33 <400> 58 agggaaataa aggtaggtac attgc 25 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 59 agatgtctct gtggcggtct 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV35 <400> 60 ctggccttta gtcctgcttg 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 61 agcaggacat tccaaaggtg 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV39 <400> 62 gtcacagggt gtgcaatcac 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 63 tagggtacgt ttgcctgacc 20 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV40 <400> 64 catacacagt accatacgga cacat 25 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 65 accatgccag cagttctagg 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV42 <400> 66 gctgtagacg cctttcgttt 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 67 tgtgcaacgc accaacttat 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV43 <400> 68 ggcagacgta gaggaggatg 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 69 gcctaaggtt tcgggatttc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV44 <400> 70 acccacacga acagaggaac 20 <210> 71 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 71 tatccgcata tcagtatagg gtgtt 25 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV45 <400> 72 tacatgccac aaggcacatt 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 73 tgcaggcagt tccagactaa 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV51 <400> 74 ttggctgaag aggaagagga 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 75 ccactgtgta cctgcctcct 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV52 <400> 76 atgcagggcg ttttagtttg 20 <210> 77 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 77 gtctgcattt cagtataggg tgttt 25 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV53 <400> 78 ttatgcaacc acgcgtaaaa 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 79 tacctgcctc ctaccccagt 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV54 <400> 80 gcgctgtacc cttagaggag 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 81 tgggttggaa gtgggtagag 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV55 <400> 82 cgtttgggtt tactggagga 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 83 gattgcttgc cgtaggacat 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV56 <400> 84 cacaacaaca cactaccgcc 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 85 gacttttggc tgttggcaat 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV58 <400> 86 gatggtgcac gggtagtagg 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 87 cccaataaat ttggccttcc 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV59 <400> 88 ttttggtgat ggggtagagg 20 <210> 89 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 89 acctgatgca accttatata atcca 25 <210> 90 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV62 <400> 90 ttacttcctg cgctttcgtt 20 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 91 tagggtacgg ttgcctgatc 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV66 <400> 92 agaggaagag gtaggagccg 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 93 ggtgttagtg cccaaggtgt 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV67 <400> 94 ttactcattg ggtgcaacca 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 95 aagcagggca ttcctaaggt 20 <210> 96 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV68 <400> 96 caacatacca acaccaacat gac 23 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 97 tgggtcatcc ctattttcca 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV69 <400> 98 aagaagctgg acgtttggtg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 99 ccgcaagcag gaaataccta 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV70 <400> 100 cacacgtttc cgtttgtgtt 20 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 101 acaatccaga tactgaacgg ct 22 <210> 102 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV72 <400> 102 tgacactgaa acagccctag aa 22 <210> 103 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 103 tgaagctccc tgaccctaat aa 22 <210> 104 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV81 <400> 104 acccagactg caacaaaaac tt 22 <210> 105 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 105 gaccccaaca aatttggtct t 21 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV82 <400> 106 tggctgaaga ggaagaggaa 20 <210> 107 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 107 gtccatttac ctgaccccaa ta 22 <210> 108 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV84 <400> 108 caaaatggca cacacagaga tt 22 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 109 agtggttccc aaggtgtctg 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV90 <400> 110 cgtttggacc gtttacgttt 20 <210> 111 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 111 gcgcaccaac ttattttacc a 21 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for HPV91 <400> 112 ctgaactgga ggatggtgct 20 <210> 113 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 113 catatggggc cctctgtcca ctcctgatgc tg 32 <210> 114 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for HBB <400> 114 catatgccat ggtcaagcgt cccatagact ca 32

Claims (25)

HPV-6, HPV-11, HPV-16, HPV-18, HPV-30, HPV-31, HPV-32, HPV-33, HPV- 43, HPV-44, HPV-45, HPV-51, HPV-52, HPV-53, HPV-54, HPV-55, HPV-56, HPV- HPV-67, HPV-68a, HPV-68b, HPV-69, HPV-70, HPV-72, HPV-81, HPV-82, HPV-84, HPV- Wherein the probe is selected from the group consisting of SEQ ID NOS: 1-36.
A DNA chip for HPV genotyping comprising the probe of claim 1.
The DNA chip for HPV genotyping according to claim 2, further comprising a human beta globin (HBB) probe represented by SEQ ID NO: 37.
4. The method according to claim 2, wherein the HPV-16 probe, the HPV-18 probe, the HPV-31 probe, the HPV-33 probe, The HPV-35 probe represented by SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, An HPV-53 probe, an HPV-56 probe, an HPV-58 probe, an HPV-59 probe, The HPV-68 probe, the HPV-68 probe, the HPV-69 probe and the HPV-69 probe, which are shown in SEQ ID NO: -82 probe of the present invention.
The DNA chip according to claim 2, which comprises all the probes of SEQ ID NOS: 1-36.
i) The HPV-specific probe of claim 1.
ii) primers for HPV gene amplification; And
iii) means for PCR amplifying the subject &apos; s HPV gene.
The HPV test kit according to claim 6, wherein the primer for amplifying the HPV gene is a primer pair represented by the nucleotide sequence of SEQ ID NO: 40 to which the primer represented by the nucleotide sequence of SEQ ID NO: 38 and the first labeling substance are bonded. .
7. The method according to claim 6, wherein the means for PCR amplifying the HPV gene of the subject comprises a second labeling substance, DNA polymerase, dNTPs, dUTP, UDG (Uracil DNA Glucosidase) and PCR buffer. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt;
7. The method according to claim 6, wherein the amplification amount of the HPV gene is measured by measuring the intensity of fluorescence from the second labeling substance, which is a fluorescent substance, after the amplification of the HPV gene, and the HPV virus loading amount Means for calculating; And
And means for detecting the hybridization of the amplified HPV gene product and the HPV probe base sequence by detecting the first labeling substance.
The HPV test kit according to claim 6, further comprising a chamber for hybridizing the amplified HPV gene product and the HPV probe base sequence.
The method according to claim 6, wherein the primer pair comprises a pair of primers represented by the nucleotide sequence of SEQ ID NO: 42 to which the primer represented by the nucleotide sequence of SEQ ID NO: 41 and the first label substance are bound, &Lt; / RTI &gt; wherein the HBV probe further comprises an HBB probe, which is represented by the sequence.
The HPV test kit according to claim 7, wherein the HPV gene amplification primer further comprises a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39.
The method according to any one of claims 6 to 12, wherein the HPV-16 probe represented by SEQ ID NO: 3, the HPV-18 probe represented by SEQ ID NO: 4, the HPV-30 probe represented by SEQ ID NO: 5, 9, an HPV-33 probe represented by SEQ ID NO: 8, and an HPV-35 probe represented by SEQ ID NO: 9. The probe comprising the HPV-39 probe represented by SEQ ID NO: 10, the HPV-45 probe represented by SEQ ID NO: 15, the HPV-51 probe represented by SEQ ID NO: 16, the HPV-52 probe represented by SEQ ID NO: 17, The HPV-59 probe, the HPV-56 probe, the HPV-58 probe, the HPV-59 probe, the HPV-59 probe, An HPV-68a probe represented by SEQ. ID. NO. 27, and an HPV-68b probe represented by SEQ ID NO: 28.
13. The HPV test kit according to any one of claims 6 to 12, wherein all of the probes of SEQ ID NOS: 1-36 are included.
HPV testing methods including the following steps:
(a) PCR amplifying the HPV gene of the sample from the subject;
(b) hybridizing the amplified HPV gene product to a DNA chip for HPV genotyping according to any one of claims 2 to 5; And
(c) detecting hybridization of the amplified HPV gene product with the DNA chip for HPV genotyping.
The method according to claim 15, wherein the step (a) of PCR amplifying the HPV gene of the subject-derived sample comprises the step of detecting the primer represented by the nucleotide sequence of SEQ ID NO: 38 and the primer pair represented by the nucleotide sequence of SEQ ID NO: Wherein the HPV gene of the subject-derived sample is subjected to PCR amplification using a primer for amplifying the HPV gene and a second labeling substance showing an amplification amount of the HPV gene in relation to the amplified HPV gene.
The method according to claim 16, further comprising the step of calculating an HPV virus load based on the amount of HPV gene amplification calculated using the second labeling substance.
The method according to claim 16, further comprising using a GPM7F2 primer represented by the nucleotide sequence of SEQ ID NO: 39 as a primer for HPV gene amplification.
17. The method according to claim 16, wherein hybridization of the DNA chip is detected by detecting the first labeling substance.
17. The method according to claim 16, wherein the second labeling substance is a fluorescent substance, and the amplification amount of the HPV gene is calculated by measuring the intensity of fluorescence from the second labeling substance.
16. The method of claim 15, wherein the PCR is real-time PCR.
16. The method of claim 15, wherein the HPV positive standard and the HPV negative standard are tested together.
17. The method of claim 16, wherein the first labeling material is selected from the group consisting of Cy5, Cy3, Cy5.5, FAM, TAMRA, HEX, and TEXASRED, Wherein the second labeling material is a fluorescent material, SYBR green I.
A method for preparing an HPV genotype reference material comprising the steps of:
(a) amplifying the L1 (late expressed gene) region of the HPV genotype with an amplification primer; And
(b) inserting the amplified product into a vector to prepare a plasmid for HPV genotype reference material.
The primer set according to claim 24, wherein the primers are selected from the group consisting of HPV-6 amplification primer pairs of SEQ ID NOs: 43 and 44, HPV-11 amplification primer pairs of SEQ ID NOs: 45 and 46, 51, 52, HPV-31 amplification primers of SEQ ID NOs: 53, 54, HPV of SEQ ID NOs: 55, 56, Primer pairs for amplification of HPV-33, HPV-33 for amplification primer pair, SEQ ID Nos. 57 and 58, primer pair for HPV-35 amplification for SEQ ID Nos. 59 and 60, A primer pair for amplification of HPV-40 of SEQ ID NOS: 65 and 66, a pair of primers for amplification of HPV-43 of SEQ ID Nos. 67 and 68, a pair of primers for amplification of HPV- Primer pairs for amplification, HPV-45 amplification primers for SEQ ID NOs: 71 and 72, HPV-5 amplification primer pairs for SEQ ID NOs: 73 and 74, HPV-5 for SEQ ID NOs: 75 and 76 Primer pairs for amplification, HPV-53 amplification primer pairs for SEQ ID Nos. 77 and 78, HPV-54 amplification primer pairs for SEQ ID Nos. 79 and 80, HPV-55 amplification primer pairs for SEQ ID Nos. 81 and 82, Primer pair for amplification of HPV-58 of SEQ ID NO: 85, 86, pair of primers for amplification of HPV-59 of SEQ ID NO: 87, 88, pair of primers of SEQ ID NO: A primer pair for amplification of HPV-66 of SEQ ID NOS: 91 and 92, a pair of primers for amplification of HPV-67 of SEQ ID NO: 93 and 94, a pair of primers for amplification of HPV-68a and 68b of SEQ ID NO: A primer pair for amplification of HPV-70 of SEQ ID NOS: 97 and 98, a pair of primers for amplification of HPV-70 of SEQ ID NOS: 99 and 100, a pair of primers for amplification of HPV- 81 amplification primer pairs, the HPV-82 amplification primer pairs of SEQ ID Nos. 105 and 106, the HPV-84 amplification primer pairs of SEQ ID Nos. 107 and 108, 9, and 110, and a pair of primers for amplifying HPV-91 of SEQ ID NOS: 111 and 112, respectively.

Images